ID: 981625078 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 4:146746285-146746307 |
| Sequence | CTAGGGCTACAACACTGTGT AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 94 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 5, 4: 88} |
Found 0 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary |
|---|
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 981625078 | Original CRISPR | CTAGGGCTACAACACTGTGT AGG | Intronic | ||