ID: 981628280

View in Genome Browser
Species Human (GRCh38)
Location 4:146786897-146786919
Sequence GAGGCTAGGTGTTTGAGACC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981628277_981628280 -3 Left 981628277 4:146786877-146786899 CCAAGGCAGGAGGATTGCTTGAG 0: 2512
1: 7707
2: 20795
3: 42782
4: 76651
Right 981628280 4:146786897-146786919 GAGGCTAGGTGTTTGAGACCAGG No data
981628272_981628280 14 Left 981628272 4:146786860-146786882 CCCAGTGCTTTGGGAGGCCAAGG 0: 907
1: 5637
2: 99883
3: 224288
4: 240329
Right 981628280 4:146786897-146786919 GAGGCTAGGTGTTTGAGACCAGG No data
981628274_981628280 13 Left 981628274 4:146786861-146786883 CCAGTGCTTTGGGAGGCCAAGGC 0: 524
1: 3708
2: 64368
3: 179830
4: 225335
Right 981628280 4:146786897-146786919 GAGGCTAGGTGTTTGAGACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981628280 Original CRISPR GAGGCTAGGTGTTTGAGACC AGG Intronic
No off target data available for this crispr