ID: 981633188

View in Genome Browser
Species Human (GRCh38)
Location 4:146845327-146845349
Sequence TGTATGTAACCTGTGTCTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 109}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981633188 Original CRISPR TGTATGTAACCTGTGTCTAC TGG (reversed) Intronic
900138957 1:1131046-1131068 GGTATGGAACCTGTTTCTGCGGG + Intergenic
907699637 1:56772579-56772601 TTTATGAAAAATGTGTCTACAGG + Intronic
915977802 1:160401880-160401902 TGTGTGTAACCTGTGTTGATGGG + Intronic
918429664 1:184445939-184445961 TGTATGGACCCTGTGTTTAGAGG + Intronic
918717851 1:187814841-187814863 TGTCTCTAACCTGGGTCTACAGG - Intergenic
1062996351 10:1870503-1870525 TGGATGTAACAAGTGTCTCCAGG + Intergenic
1073126256 10:101151959-101151981 TGTCTGTAGCCTGGGACTACAGG + Intergenic
1073664380 10:105513745-105513767 TGTTTGTATCCTGTTTCTCCAGG + Intergenic
1078279312 11:9883915-9883937 TCTTTATAACCAGTGTCTACTGG + Intronic
1078920922 11:15829819-15829841 TCTATGTACCTTGTGTCTCCTGG - Intergenic
1090074581 11:123572154-123572176 TGTAAGAAACCTGAGTCTAGGGG - Intronic
1090720277 11:129466519-129466541 TCTATATAACCTGTGCCTGCAGG + Intergenic
1091127856 11:133118004-133118026 TGTTTTCAACCTGAGTCTACAGG + Intronic
1092367310 12:7887631-7887653 TGTATGTTACCTGTGTTGCCTGG + Intronic
1094219665 12:27978362-27978384 AGAATGTGACCTGTGTTTACAGG - Intergenic
1095351908 12:41223490-41223512 TCAATGTATTCTGTGTCTACAGG - Intronic
1096297213 12:50393772-50393794 TGTATGCAACCTCTGCCTCCGGG - Intronic
1098414156 12:70214667-70214689 AGGCTGAAACCTGTGTCTACAGG + Intergenic
1100779985 12:98013781-98013803 GGTATGGAACCTGGGTCTACTGG - Intergenic
1105267245 13:18831780-18831802 TGTCTTTAGCCTGTCTCTACTGG - Intergenic
1107402193 13:40080397-40080419 TGTAAGTCACCTGTGTATACTGG - Intergenic
1107434884 13:40373401-40373423 TGTATGAAACCTGTTTATCCTGG + Intergenic
1108963093 13:56261965-56261987 TTTTTGTAACCTAGGTCTACTGG + Intergenic
1111436986 13:88224265-88224287 TGTAACTAACCTCTGTCTCCCGG + Intergenic
1112339585 13:98542105-98542127 TGTAAATAACCTTTGTCTTCAGG - Intronic
1116699903 14:48227323-48227345 TGTATATAACCTGGGTTTATTGG - Intergenic
1118520280 14:66575754-66575776 GGCATGGAACCTGTGTCTATGGG + Intronic
1118564298 14:67122820-67122842 TTTATGTAACCTGTTTCTCCAGG + Intronic
1120471959 14:84937210-84937232 GGTATGTAACATGAGTCTCCTGG + Intergenic
1124104184 15:26722064-26722086 TGCATGGAACCTGCATCTACTGG - Intronic
1126954185 15:53914155-53914177 TGTATAAAACCTGTGTGTCCAGG + Intergenic
1135510707 16:23080745-23080767 TGAATGTTTCCTGTGTCTATGGG + Intronic
1143244595 17:5472937-5472959 TTTATGGAACCTGGGTCTATGGG - Exonic
1146578708 17:34016651-34016673 TGTGTGTAACCTATCTTTACTGG + Intronic
1150114628 17:62535692-62535714 TGCATGCAACCTCTGTCTCCTGG - Intronic
1150740270 17:67773906-67773928 TCACTGTAACCTCTGTCTACTGG + Intergenic
1151863639 17:76784822-76784844 TTGATGTAACCTCTGTCTCCTGG - Intergenic
1156862347 18:41852654-41852676 TGCATGTAACCGGTGTCCACGGG - Intergenic
1160293274 18:77614928-77614950 CGTATGTTAGCTGTGTCTTCTGG - Intergenic
1163133406 19:15291103-15291125 TGTTCCTAACATGTGTCTACTGG + Intronic
1163895026 19:20051306-20051328 TGTATTTCACCTGGCTCTACTGG - Intergenic
1167053296 19:47093341-47093363 AGTATCTAACCTCTGCCTACTGG + Intronic
1167128780 19:47570710-47570732 TTTATGTAAACTTTATCTACTGG - Intergenic
1168604848 19:57750355-57750377 TCTCTGCAACCTCTGTCTACTGG - Intronic
928715012 2:34050052-34050074 TGTATGAACCCTGTGGTTACAGG + Intergenic
931945222 2:67298909-67298931 TGTCTGTAACCTCTGCCTCCTGG - Intergenic
935663499 2:105489442-105489464 AGTATTTAGGCTGTGTCTACAGG + Intergenic
935827819 2:106968997-106969019 TGTAGGTTATCTGTGTCTTCTGG + Intergenic
937149684 2:119678036-119678058 TATATGTAACCTGTGCCTCACGG - Intergenic
939931786 2:148244085-148244107 TGTATGTTAACTGTCTCTGCTGG + Intronic
940236718 2:151519060-151519082 TGTATTTAACCTGTGTGTTATGG + Exonic
940405876 2:153301233-153301255 TCACTGTAACCTCTGTCTACCGG - Intergenic
942162507 2:173206510-173206532 AGTATGTAAGGTGTGTCTAGAGG - Intronic
943713032 2:191119155-191119177 TGTACTTCACCTGTGTATACTGG + Intronic
944195996 2:197053556-197053578 TCTTTGTAACCTCTGTCTCCTGG + Intronic
944968542 2:204964663-204964685 TGTATGTAGAGTGTATCTACAGG + Intronic
947260047 2:228210755-228210777 TGTAAAGCACCTGTGTCTACAGG + Intergenic
1168737854 20:159003-159025 TTTATGTAGACTGTGTCTTCAGG - Exonic
1175273087 20:57748677-57748699 TGTGAGTCACCTCTGTCTACTGG + Intergenic
1176894948 21:14366452-14366474 TCAATGTAACCTCTGTCTCCTGG + Intergenic
1181926661 22:26365180-26365202 TGTATGTAATCTGTGCCCAGAGG + Intronic
1182153309 22:28046739-28046761 TGTGTGTAGCCTATGTTTACAGG - Intronic
1182166898 22:28184043-28184065 GGTTTGAATCCTGTGTCTACTGG + Intronic
1185362339 22:50415837-50415859 CGTATGTAAGCTCTGTCTTCAGG - Intronic
949437966 3:4049813-4049835 TGTATGTGACCTGACTCTTCTGG - Intronic
952197184 3:31088265-31088287 TTTATGTATCTTGTGTCTCCTGG + Intergenic
952275588 3:31872694-31872716 TTGATGTAACCTCTGTCTCCTGG + Intronic
952587690 3:34912446-34912468 TGTATCTTACTTGTGTCTTCAGG + Intergenic
960184649 3:114623874-114623896 AGTATGAAACCTATGCCTACAGG + Intronic
962235509 3:133703871-133703893 TGCATTTAACCTGTTTCTATGGG - Intergenic
962768507 3:138590734-138590756 TGTCTGCAACCTCTGTCTCCTGG - Intronic
969037297 4:4264979-4265001 TGTTTGTCAACTGTGTGTACCGG - Intergenic
970389780 4:15596383-15596405 TGTGTGTAAGATGTGTATACTGG - Intronic
976945015 4:90754513-90754535 TATATGCAACCTGTGTAAACTGG - Intronic
978310109 4:107378433-107378455 TGTATGTAACACATGGCTACTGG - Intergenic
979048227 4:115896738-115896760 TCTATTTAACTTGTGTCTTCAGG - Intergenic
981596142 4:146424583-146424605 TCAATGTAACCTCTGTCTCCTGG - Intronic
981633188 4:146845327-146845349 TGTATGTAACCTGTGTCTACTGG - Intronic
982359602 4:154505364-154505386 TTTATGTAAGCTGTGTATATGGG - Intergenic
986215740 5:5717218-5717240 TGCATGTAACCTGTGTGCATGGG + Intergenic
986400803 5:7377783-7377805 TGTATGTAACCTATCACTAATGG - Intergenic
988511121 5:31865595-31865617 AGCCTGTAATCTGTGTCTACTGG + Intronic
989790831 5:45399289-45399311 TGCATGTCTCCTGTGCCTACAGG + Intronic
990824392 5:59880868-59880890 TGTATGTGACCTGTTATTACTGG + Intronic
992207327 5:74443886-74443908 ACCATGTAACCTGTGTCAACAGG + Intergenic
995865305 5:116683975-116683997 TTTATTTAACCTGTATCCACTGG - Intergenic
996517219 5:124383899-124383921 TGTATGTATCCACTGTCTTCTGG - Intergenic
996800008 5:127392680-127392702 TGAATGTAACCTGGGGTTACTGG + Intronic
999672162 5:153967362-153967384 TCTCTGTAACCTCTGTCTCCCGG + Intergenic
1000642206 5:163716235-163716257 TGTATTTACTCTCTGTCTACTGG - Intergenic
1001393478 5:171399605-171399627 TGTATTTAACCTGTATATTCGGG + Intronic
1004835374 6:19525582-19525604 TGTTTTTAACCTGTTTCTAAAGG + Intergenic
1016178284 6:141108131-141108153 TGTATGTGCCTTGTGTCTATTGG + Intergenic
1018793180 6:167165588-167165610 TGAATGTATCCTCCGTCTACAGG - Intronic
1018965321 6:168481782-168481804 CTTATGTAACTTGTGTCTAAAGG + Intronic
1020992503 7:15217944-15217966 TGTAGGTAAACTGTGTGTCCTGG + Intronic
1021107282 7:16652597-16652619 TGACTGTAACCTCTGTCTCCTGG + Intronic
1023332495 7:39133312-39133334 TGTATGTAGCCTGTGTGTTGTGG + Intronic
1023747266 7:43332937-43332959 TGTTTGTTACCTGTGACTATGGG - Intronic
1024412600 7:49063147-49063169 TGTATGGATCATGTGCCTACAGG + Intergenic
1034184812 7:149167325-149167347 TGGATGTCATCAGTGTCTACTGG - Intronic
1035293259 7:157853481-157853503 TGTGTGTAACCTTTGTGTACAGG + Intronic
1037663405 8:20945626-20945648 TGACTGTAACCTCTGTCTCCCGG + Intergenic
1038461095 8:27717708-27717730 TCTCTGTAACCTCTGTCTCCCGG - Intergenic
1042520099 8:69702489-69702511 TGTGTGTAAGATGTGTGTACCGG - Intronic
1045474525 8:102541822-102541844 TTTATGTAACCTGAGTGCACTGG + Intergenic
1051531133 9:18104851-18104873 TTTATCTTACCTGTGTCTACTGG + Intergenic
1056385718 9:86095301-86095323 TGTCTGTAACCTCTGCCTCCTGG + Intronic
1056772063 9:89484842-89484864 TGTGTGTAATGTGTGTATACTGG + Intronic
1186673082 X:11787068-11787090 TGTGTGTACCCTTTGTCTTCTGG + Intergenic
1189921189 X:45904673-45904695 TGTTTGTGACCAGGGTCTACTGG + Intergenic
1190073870 X:47301279-47301301 TGTATTTAACATGTGTACACAGG + Intergenic
1191965947 X:66758290-66758312 TATATTTAAGCTGTGTCTTCAGG - Intergenic
1194563948 X:95458659-95458681 TGGATGTAGGCTTTGTCTACAGG + Intergenic
1194999487 X:100628597-100628619 GGGATGTAACCTGTATCTTCAGG - Intronic
1198840444 X:140851246-140851268 TATATTTAACCTGTGTATTCTGG - Intergenic
1199670388 X:150142527-150142549 TGTATGTAATGTGTATCTTCTGG + Intergenic