ID: 981636474

View in Genome Browser
Species Human (GRCh38)
Location 4:146886565-146886587
Sequence GAGGAGAGAAGGCCTGATAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 340
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 311}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981636474 Original CRISPR GAGGAGAGAAGGCCTGATAA AGG Intronic
901206642 1:7501320-7501342 GAGGAAGGGAGGCCTGAGAACGG + Intronic
902723403 1:18319722-18319744 GAGGAGCAAAGTCCTGACAAAGG - Intronic
902834821 1:19040199-19040221 GAGGAGAGATGGGTTGAGAACGG + Intergenic
902910910 1:19596755-19596777 GAGGAGGAAAGGCCTGGTCACGG + Intergenic
903270591 1:22185868-22185890 GATGAGAAAAGGCAGGATAATGG - Intergenic
905879829 1:41456168-41456190 GAGGAGAGAGGGCAAGATGAGGG - Intergenic
905918557 1:41703131-41703153 GAGGTGACAAGGCTTGACAAAGG + Intronic
906295642 1:44647433-44647455 GAGGAGGGAAGGGATGGTAAAGG + Intronic
907255592 1:53176274-53176296 GAGGAAAGAAGCCCTGGTGAAGG + Intergenic
907384317 1:54116111-54116133 GAGGAGAGGTGGCCTGACCAAGG - Intergenic
911869944 1:103084519-103084541 AAGGAAAGAAGTCCTGATACAGG + Intronic
912823473 1:112885551-112885573 GAGGGGAGAAGGCATGAACACGG + Intergenic
913230759 1:116739096-116739118 GAGGAGATAACACCTGACAAAGG + Intergenic
915288206 1:154866176-154866198 GAGGGAAGAAGTCCTGAGAAGGG - Intronic
915581482 1:156815656-156815678 CAGGAGAGAAGGACTGAGACGGG + Intronic
916793476 1:168144918-168144940 GTGGAGAGAAAGCCTGCTCAGGG - Intergenic
918262639 1:182809606-182809628 GTGGAGAGAAGGAAGGATAAGGG + Intronic
918795019 1:188883114-188883136 GAGGAGAGAAGGATCGACAAGGG + Intergenic
920122723 1:203670852-203670874 GAGGAGAGAGGGCAGGAGAAGGG - Intronic
920612803 1:207458101-207458123 GAGGATGGAAAGCCTGAAAAAGG - Intronic
921640245 1:217544489-217544511 GTGGAGAGAAGAGCTGACAAAGG - Intronic
922347472 1:224708222-224708244 GAGGAGAGAGGCCCTGAGATGGG - Intronic
922515724 1:226206901-226206923 GAGGAGAGAAGGGCAGGTCATGG + Intergenic
922781505 1:228256570-228256592 GGGGAGAGAAGGCCTGGAAGGGG - Intronic
922781895 1:228259419-228259441 GGGGAGAGAAGGCCTGGAAGGGG - Intronic
922782467 1:228264034-228264056 GGGGAGAGAAGGCCTGGGCAGGG - Intronic
923443882 1:234049500-234049522 GAGGCTAGAAGTCCTGATCAAGG - Intronic
923981427 1:239328362-239328384 GAGGACAGCAGGCTTGAGAAAGG - Intergenic
924011251 1:239667440-239667462 GGGGAGAAAAGGCCTTGTAATGG - Intronic
1063870332 10:10409718-10409740 GAAGAGAGAAGGGCTGAACAAGG + Intergenic
1065299353 10:24307301-24307323 GAGCAGAGAAGGACTGATAGTGG + Intronic
1066310474 10:34191209-34191231 AAGGAGAAGAGGGCTGATAATGG + Intronic
1066701155 10:38130024-38130046 GAGGAGAGAAGGAAAGATTATGG - Intergenic
1067083821 10:43227906-43227928 GAGGAGGGAAGGACTGATTCTGG - Intronic
1068948626 10:62755212-62755234 GAGGAGAGAAGGAGGGAAAAGGG + Intergenic
1069615984 10:69806388-69806410 GAGGACAGGAGGCCTGAGAGGGG + Intronic
1071479302 10:86052464-86052486 GAGGAGACAAGGCGTGTTCAGGG - Intronic
1073041727 10:100612469-100612491 GAGGAGGGAAGGAATGAAAATGG - Intergenic
1075084790 10:119407341-119407363 AAGGAGAGGAGGCCTCAAAAGGG + Intronic
1075685877 10:124364787-124364809 GGGGAGGGAGGGCCTGAGAAAGG + Intergenic
1075704102 10:124488708-124488730 GAAGAGAGAAAGCATGAAAAAGG - Intronic
1076013533 10:127009600-127009622 TAGGGGAGAAGGCATGGTAAGGG + Intronic
1076846174 10:133070568-133070590 GAGGAGAGAAGTCGTGGGAAGGG - Intergenic
1080171898 11:29314022-29314044 GAGGACAGAAGACTTGGTAATGG - Intergenic
1082043333 11:47705252-47705274 GGGGAGAGAAGGCATGAGATGGG + Intronic
1083489029 11:63001180-63001202 GAGGAGAGAAGGCAAGGTCAAGG - Intronic
1083536068 11:63467662-63467684 CAGGAGATGAGGCCTGATAAGGG - Intronic
1085868734 11:80325604-80325626 GAGAAGAGAAGGCCTTACAAAGG - Intergenic
1087291165 11:96322269-96322291 GAGGGGAGGAAGCCTGAAAATGG + Intronic
1087686991 11:101276110-101276132 GAGGAGATAAGACCTGGAAAAGG + Intergenic
1088000643 11:104876182-104876204 GAGAAGAGAAGGGCTGCAAATGG + Intergenic
1090004470 11:122989461-122989483 GAGGACAGCAGGCCTTAGAAAGG - Intergenic
1090719095 11:129456306-129456328 GAGGAGGGAAGGCGTGCTAATGG - Intergenic
1091041242 11:132283945-132283967 GAGGAGAGGAGGCCAGGAAAAGG - Intronic
1091660095 12:2376947-2376969 CAGCAGAAAAGGCCTGATCATGG - Intronic
1092179136 12:6433153-6433175 GAGGAGGGAAGGTGTGATCAGGG - Intergenic
1092881662 12:12891754-12891776 GAGGAGAGAAATCCTGGTAATGG + Intronic
1094223310 12:28018135-28018157 GTGGAGAGAATGCCTGTTATGGG - Intergenic
1094455038 12:30622499-30622521 GAGGAGATAAGGCAGGGTAAAGG - Intergenic
1094837000 12:34326744-34326766 GAGAAGATAAGGCCTGAAATGGG - Intergenic
1097313078 12:58142366-58142388 GAGGAGAGAAGGAGGGAAAAGGG + Intergenic
1097486264 12:60205657-60205679 CAGGAGAGAAGGCAAGAGAATGG - Intergenic
1100661827 12:96707884-96707906 GAGGAGAGAAGGGCGCAAAATGG + Intronic
1101376349 12:104174450-104174472 GAGGAGAGAACCACTGAAAAAGG - Intergenic
1104882960 12:132084746-132084768 GAGGAGGGAAGGCGGGAAAACGG - Intronic
1104941122 12:132395845-132395867 GAGCAGAGGAAGCCTGAGAAGGG + Intergenic
1108885403 13:55175193-55175215 TAGGAGAGAATCCCTGAAAATGG + Intergenic
1109432151 13:62250167-62250189 GAGGAAAGAAGGGGGGATAAAGG - Intergenic
1110230601 13:73163545-73163567 GAGGAGAGAAATGCTGGTAATGG + Intergenic
1110508298 13:76315769-76315791 GAGGAGAGAAGGCATGGTGATGG + Intergenic
1110737688 13:78957001-78957023 GGGGAGAGAAGGTCTGAGGAAGG + Intergenic
1112636343 13:101221975-101221997 GATGAGAAAAAGCATGATAAAGG - Intronic
1112836067 13:103515677-103515699 GGGGGGAGAAAGACTGATAATGG - Intergenic
1113353977 13:109560400-109560422 CAGGAGTGGAGGCCAGATAAGGG - Intergenic
1114296804 14:21337245-21337267 AAGGAGACAAGGCCTAATAGAGG - Intronic
1115275619 14:31605896-31605918 GAGGAGAGAAGGAAGGAGAAGGG - Intronic
1118779631 14:68998579-68998601 GTGGAGAGAAGGTATGAGAAAGG + Intergenic
1119689205 14:76657671-76657693 GAGGAGCCCAGGCCTGATCAAGG + Intergenic
1122257978 14:100493430-100493452 AAGGAGTGAAGTCCTGATATAGG - Intronic
1122804724 14:104250591-104250613 GAGGTGAGAATGCCTGGTAAAGG + Intergenic
1123002160 14:105301338-105301360 GTGGAGAGACGGCCTGCGAAGGG + Exonic
1125305979 15:38314820-38314842 GAGGAGAGAAGGAAAGAAAATGG - Intronic
1125602093 15:40921067-40921089 GAGAAGAGAAGGCATGCAAAAGG - Intergenic
1125699249 15:41666755-41666777 GAAGAGAGAAGTCCTTAAAATGG - Intronic
1125959429 15:43816792-43816814 TAGGAGAAAAGACCTTATAAAGG - Intronic
1128241053 15:66101237-66101259 GAGAAGTGAGGGCCTGATGAAGG - Intronic
1128255717 15:66195233-66195255 TTGGAGAGAAGGCCTTAAAAAGG - Intronic
1128474362 15:67984481-67984503 GGGTAGAGAGGGCATGATAATGG - Intergenic
1129255320 15:74330945-74330967 GAGGAGAGAAGGGGAGAGAATGG - Intronic
1129674180 15:77623432-77623454 GAGGTGTGAATGGCTGATAATGG + Intronic
1131286592 15:91064198-91064220 GAGGAGGGCAGGCTTGATGAAGG - Intergenic
1133500191 16:6358383-6358405 GATGAGACAAGGCCTGACAATGG - Intronic
1133520695 16:6553722-6553744 GAGGAGAGAAGGACAGCAAAAGG + Intronic
1135195050 16:20387375-20387397 CAGGAGAGAATTCCTGGTAAAGG + Intronic
1135859674 16:26044361-26044383 GAGGGGAGAAGGGCTGGTAGTGG + Intronic
1137001757 16:35235283-35235305 CAGGAGATAATGCCTGAAAAGGG - Intergenic
1137067959 16:35869320-35869342 GAGTGGAGGAGGCCTCATAAAGG - Intergenic
1137709937 16:50559627-50559649 AAGGAGACAAGGCCTCATGACGG - Intronic
1138141868 16:54575717-54575739 GAGGAGAGAAGACTTTATAGGGG + Intergenic
1138254159 16:55538312-55538334 GAAGAGAGATGGTTTGATAATGG + Intronic
1140151925 16:72376195-72376217 GAGGAGAAAGGGCCTGAACAGGG + Intergenic
1140317248 16:73911021-73911043 GAGGAGAGAAGAAATGAGAATGG + Intergenic
1141254348 16:82386643-82386665 GTGGAGAGAAGGCTAGATTAGGG + Intergenic
1141943733 16:87296100-87296122 AAGGAGAGAAGGTAGGATAAAGG + Intronic
1144290734 17:13823679-13823701 GTGGAGAGGAGGGCTTATAAGGG + Intergenic
1147426334 17:40347600-40347622 GGGGAGAGATGGCATGACAAAGG - Intronic
1147616262 17:41830054-41830076 GAGGAAAGAAATCCTCATAAAGG - Intronic
1147668545 17:42163759-42163781 GAGGAGACAAGGGCTGAGAATGG + Exonic
1149029939 17:52071303-52071325 GAGGAAAGCAGGCATGGTAAGGG - Intronic
1149651707 17:58280029-58280051 GAGGAGTGAGGGCCAGAGAAGGG + Intronic
1152964183 18:99152-99174 AAGGTGAGAAGGCCAGATAGGGG - Intergenic
1153027659 18:686338-686360 GAGGAGAGCGGGGCTGAAAAGGG + Intronic
1155829464 18:30494355-30494377 GAGAAGAGAAGGCCCTGTAAAGG - Intergenic
1156909490 18:42394037-42394059 GAGGAGAGAAGGGCAGCTAAGGG - Intergenic
1157231412 18:45919958-45919980 GAAAAGAGGAGACCTGATAAGGG - Intronic
1157348096 18:46858801-46858823 GATGTGAGAAGGCAGGATAAGGG + Intronic
1159856713 18:73598029-73598051 GAGGAGTGAAAGCTTGGTAAGGG + Intergenic
1161415859 19:4145920-4145942 GAGGACAGAGGAGCTGATAAGGG - Intergenic
1162612681 19:11768191-11768213 GAGGAGAGAAAGCCTGAGGAAGG - Intronic
1162969173 19:14169830-14169852 GAGGAGAGAGGGCAGGAAAAAGG + Intronic
1164462975 19:28464343-28464365 GAGGAGAGAATGCCTTCCAAAGG - Intergenic
1164842214 19:31401065-31401087 TAGGAGAGAAGGACAGATAGAGG - Intergenic
1165793878 19:38507435-38507457 GAGGAGAGAAGGGCTGAGAAGGG + Intronic
1166679814 19:44759418-44759440 GCGGAGAGAAGACCTGAGGAAGG - Exonic
1167211913 19:48138966-48138988 GAGGACAGAGGGACTGAGAAAGG - Intronic
1167555086 19:50189492-50189514 GAGGAGAGAGGGACTGATTCTGG + Intronic
1167665494 19:50820976-50820998 GAGGAGGGGAGGCCTGAGAGCGG + Intronic
925212743 2:2064121-2064143 GAGGGGAGAAGCCCAGAGAAAGG + Intronic
925829429 2:7879524-7879546 GAGAAGAGCAGCCCAGATAAAGG - Intergenic
927027037 2:19079140-19079162 GGGGAGAAAAGGCCTCATATAGG - Intergenic
927099948 2:19780446-19780468 GAGGAGGGAAGCCCAGGTAAGGG - Intergenic
928337314 2:30408788-30408810 GAGGAGAGAAGACCAGAAATGGG - Intergenic
929925176 2:46201703-46201725 AAGGAGGGAAGGCTTGATGAGGG - Intergenic
929943265 2:46351445-46351467 GAGGAGCCCAGGCCTGCTAATGG + Intronic
930354656 2:50302528-50302550 GAGGGCAGAAGTCATGATAATGG - Intronic
932090246 2:68799879-68799901 GAGGAGGGAAGGCCTGAGGCTGG + Intronic
932440670 2:71732618-71732640 GAAGAGAGTAGGCCTGAAACAGG - Intergenic
932907218 2:75767182-75767204 GAGAAGAGAAGGGCAGAGAAAGG + Intergenic
933785525 2:85838220-85838242 GATGGGAGCAGGCCTGAGAATGG + Intergenic
933787957 2:85858814-85858836 AAGGAGAGAAGACCTGGTACAGG - Intronic
933947734 2:87301382-87301404 GAAGAGATAAGGCCTGAATAAGG + Intergenic
933997512 2:87680488-87680510 GAGGAGAAAAGGACAGATACTGG + Intergenic
936296340 2:111270424-111270446 GAGGAGAAAAGGACAGATACTGG - Intergenic
936332468 2:111560191-111560213 GAGGAGATAAGGCCTGAATAAGG - Intergenic
936895246 2:117420419-117420441 TAAGAGAGAAGGTGTGATAATGG - Intergenic
937237059 2:120437369-120437391 GAGGAGAGAGGGCCTTAAAGGGG + Intergenic
938029930 2:127983419-127983441 GAGGAGAAATGGTCTGAAAATGG + Intronic
939490796 2:142874148-142874170 GAGGAGAGAAGGCAAGAAGAGGG + Intergenic
941387166 2:164867693-164867715 GAGGAGAGAGTGCCTCATGATGG + Intergenic
944821896 2:203440435-203440457 GAGGAGGGAAGTCCGGAGAAGGG + Exonic
944933414 2:204544058-204544080 GAAGAGAGCTGGCCTGAGAATGG + Intergenic
945166485 2:206952722-206952744 GATTAGAGAAGACCTGATTATGG - Intronic
946143332 2:217710350-217710372 GATGTGAGATGGCCTGAGAAAGG - Intronic
946505274 2:220293726-220293748 AAGGAGAGAGGGAGTGATAAAGG - Intergenic
946664085 2:222031257-222031279 CAGGTGAGAAAGCCTGAGAAAGG + Intergenic
946685972 2:222270322-222270344 GGGGAGAGAAGCCCTGACAATGG - Intronic
946809845 2:223512204-223512226 GAGGAGTGGAGGGCTGAGAAAGG - Intergenic
947031889 2:225805618-225805640 GAGGAGAGAAGCACATATAATGG + Intergenic
947310841 2:228800022-228800044 GAGGACATAAAGCCTGAGAAGGG + Intergenic
947400830 2:229730085-229730107 GAGGAGAGAAGAGCTCATAATGG + Intergenic
948173943 2:235928590-235928612 GAGGAGAGCAGGGCGGAGAAGGG + Intronic
948468796 2:238164518-238164540 GTGAAGGGAAGGCCTGATAGGGG - Intronic
948542468 2:238700412-238700434 GAGGGGGGAAAGCCTGATGAGGG + Intergenic
1169775527 20:9248761-9248783 GATGAGAGAAAACCTCATAAAGG - Intronic
1169781419 20:9314519-9314541 GTGGAGAGAATGCCAGAGAAGGG + Intronic
1173500224 20:43547952-43547974 GAGGAGAGAAGGGGAGAGAAAGG - Intronic
1175133449 20:56806425-56806447 GAGGAAGGAGGGCCAGATAAGGG - Intergenic
1175192767 20:57222601-57222623 GAGGAGAGCAGCCCTCATCAAGG - Intronic
1175877486 20:62237212-62237234 GGGGAGACAAGGCCTGAGGAGGG + Intronic
1176107685 20:63397238-63397260 GAGGAGAGAAATCCTGACACAGG - Intergenic
1176310203 21:5145279-5145301 GCGGAGAGGAGGCCTCACAAGGG + Intronic
1177371706 21:20213072-20213094 GTGGACAGAAGGCCTGAAAGAGG + Intergenic
1179183731 21:39067259-39067281 GAGAGGAAAAGGCCTGATGATGG - Intergenic
1179846853 21:44116757-44116779 GCGGAGAGGAGGCCTCACAAGGG - Intronic
1179937491 21:44614506-44614528 GAGGAGAGAAGGGCAGACCAGGG - Intronic
1180175408 21:46084758-46084780 GAGGAGAGAAGTCCTGTGATTGG - Intergenic
1181937477 22:26449174-26449196 GCAGAGAGGAGGCCAGATAATGG - Intronic
1182550883 22:31100197-31100219 GAGGAGAGCAGGACAGAGAAAGG - Intronic
1184549701 22:45197952-45197974 GAGGAAAGAAGGCCAGGTCAAGG + Intronic
950011685 3:9728737-9728759 GGGGGGAGAGGGGCTGATAAGGG - Intronic
950321468 3:12058804-12058826 GAGGAAAGAGGGAATGATAAAGG - Intronic
950416814 3:12873507-12873529 GTGGGGAGCAGGCCTGAGAAGGG + Intergenic
950836858 3:15928603-15928625 GAGAAGAGAAGGCAGGAGAATGG + Intergenic
952407296 3:33015859-33015881 GAGGAGAGAATGCCTTATCAAGG - Intronic
952615067 3:35261044-35261066 GAGGAGATGAGGCCTGAATAGGG + Intergenic
953170980 3:40506982-40507004 TAGAAGAGAATGCCTGATAAAGG - Intronic
953758068 3:45664997-45665019 GAGATGAGAGGGACTGATAAAGG + Intronic
954202685 3:49033659-49033681 GATGAGAGAAGACTTGGTAAGGG - Intronic
955012018 3:55026722-55026744 GAGGGGACAAGGGCTGATCAAGG + Intronic
956025179 3:64975761-64975783 GAGGAGAGAAAACTTGCTAAAGG - Intergenic
958164493 3:89862283-89862305 GAGGAAAGAAAGCCTGTGAAGGG - Intergenic
958652724 3:96958616-96958638 GAGGAATGAAGGACTGTTAATGG - Intronic
961710452 3:128824220-128824242 AACCAGAGAAGGCCTGAGAAGGG + Intergenic
961884086 3:130084343-130084365 CAGCAAAGAAGGCCTCATAAAGG + Intronic
961901144 3:130213114-130213136 GAGGAAAGGAGGCCTGAAAAGGG + Intergenic
966583583 3:181596261-181596283 GAGGATAGAAGGCCTTGTATGGG - Intergenic
966676913 3:182599572-182599594 GAGGAGAGAAGGCCTGGAGAAGG - Intergenic
966862223 3:184236854-184236876 GTGGGGAGAAGGCCTGGTGAGGG - Intronic
966957417 3:184897258-184897280 GAAGAGAGATGGCCTGATTTTGG + Intronic
967074837 3:185992712-185992734 GAAGAGAGAAGGCATGATTCTGG - Intergenic
968160225 3:196420689-196420711 ATGGAGAGAAGGACAGATAAAGG - Intronic
969932658 4:10646449-10646471 AAAGAGAAATGGCCTGATAACGG + Intronic
970272487 4:14362150-14362172 GAGGAGAGAGACCCTGCTAAAGG - Intergenic
971749721 4:30631808-30631830 GAGGAGAGATGGCTTGATTTTGG + Intergenic
973573892 4:52266569-52266591 GAGGAGAGGAGACCAGAAAAAGG + Intergenic
976751836 4:88457214-88457236 GAGGAGAGAACGCCTGGTCCCGG - Exonic
977402282 4:96547603-96547625 GAGCAACCAAGGCCTGATAATGG - Intergenic
979305527 4:119138682-119138704 AAGGAGAGAAGGCAGGAGAAGGG - Intronic
980630891 4:135431693-135431715 GAAGAGAGAAAGCCAGAGAATGG + Intergenic
981636474 4:146886565-146886587 GAGGAGAGAAGGCCTGATAAAGG + Intronic
984520298 4:180794529-180794551 GATGAGAGAAGGCCCCATAAAGG - Intergenic
984740509 4:183157081-183157103 GGGGAAAGAAGGCCCTATAAAGG - Intronic
986760408 5:10875154-10875176 GAGGAGAGAAAGATTGATAAGGG - Intergenic
987313060 5:16699131-16699153 CAGGGGAGAAGGACTGATACTGG + Intronic
987660205 5:20862845-20862867 GAGGAGTGAAGGTCTGGTAGCGG + Intergenic
987908241 5:24106725-24106747 TAGGAAAAAAGGCCTGAAAATGG - Intronic
988763442 5:34342823-34342845 GAGGAGTGAAGGTCTGGTAGCGG - Intergenic
989487977 5:42013903-42013925 GAGGAGACAAGATCTGAGAATGG + Intergenic
990360954 5:55019669-55019691 GAGGATGGGAGGCCTTATAATGG - Intronic
992837240 5:80653688-80653710 GAAGAGATAAGGCCTGAACAAGG - Intronic
993554965 5:89325266-89325288 GAAAACAGAAGACCTGATAAAGG - Intergenic
994135465 5:96281674-96281696 GAGGAGAGAAGTAATGATGAAGG + Intergenic
994721808 5:103389249-103389271 GAGGAAAGCAGGGCTGATCAGGG + Intergenic
994722934 5:103401464-103401486 GAAGAGAGAAGGGCTGGAAATGG + Intergenic
994816601 5:104594163-104594185 GGTGAGAGAAAGCATGATAAAGG - Intergenic
994858576 5:105158498-105158520 GAGGAGAGCAGGCATGTCAATGG + Intergenic
995755879 5:115503343-115503365 ATGGAGAGAAGGGCTGGTAATGG + Intergenic
997464008 5:134074634-134074656 GAGGAGAAGAGGCCTGGGAAGGG - Intergenic
998017668 5:138745548-138745570 GAGAAGTGAGGGCCTTATAAGGG - Intronic
998082648 5:139289765-139289787 GAGGAGAGAAAGCAGGATTAAGG - Intronic
998623877 5:143823847-143823869 GAGTAGAAAAGGCCTGACATGGG + Intergenic
998983416 5:147729101-147729123 GAGGAGAGAAGGCAGGAAAGAGG + Intronic
1000380208 5:160622304-160622326 GAGGGGAGAAGTTCTGATCAGGG - Intronic
1000496069 5:161987033-161987055 TAGGAGAGAAGGATTGATACTGG + Intergenic
1001913317 5:175539056-175539078 GAGGACAGAGGGCCAGAGAAAGG - Intergenic
1002327126 5:178416936-178416958 GAGGAGAGGAGGCCAGATCTCGG - Intronic
1002567366 5:180119496-180119518 GAGGGGAGCGGGCCTGATCAGGG - Intronic
1003370668 6:5522922-5522944 AAGGAGACAAGGCCAGATATGGG + Intronic
1004260668 6:14104780-14104802 GAGGAGAGCAGGCATAACAAGGG - Intergenic
1004332368 6:14733554-14733576 GAGGAGAGACTGCCTTCTAATGG + Intergenic
1004601034 6:17150186-17150208 GAGGGGAGAAGGGCTGGAAATGG - Intergenic
1004668462 6:17772000-17772022 GAGGAGAGAATGCTTTAAAAGGG + Exonic
1005688240 6:28276197-28276219 GAGGAGACAAGGATTGAGAATGG + Exonic
1006927502 6:37665285-37665307 GAAGGTAGAAGGCCTGATACTGG + Intronic
1007266013 6:40596454-40596476 GAGATTAGAAGGCCTGAAAAAGG + Intergenic
1007340713 6:41189797-41189819 GTGGAGAGGAGGCCTGAAAGAGG + Intergenic
1007736728 6:43986657-43986679 GAGGAGGGACGTGCTGATAAAGG + Intergenic
1010248966 6:73688664-73688686 GAGGGGAGAAGGGCTGGAAATGG + Intergenic
1012520738 6:100118341-100118363 GAAGAGAGAAGGGATGTTAAGGG - Intergenic
1012827361 6:104163038-104163060 CAGGAGAGAAGGCCTGAAACTGG - Intergenic
1013105014 6:107019722-107019744 GGGGAGAAAAGGACTGATACGGG - Intergenic
1013274998 6:108576113-108576135 GGAGAGAGAAGGGCTGATCAAGG - Intronic
1013588391 6:111599363-111599385 GAGTAGAGAAGCCCAGAGAAAGG - Intronic
1013866435 6:114702578-114702600 CAGGATAGAATTCCTGATAAAGG + Intergenic
1014005079 6:116408764-116408786 GAGGAGAGAAGGCCAGGTGCAGG - Intronic
1014429594 6:121352153-121352175 GAGGAGGGAAGGTCTGATTTTGG + Intergenic
1014615659 6:123595842-123595864 GAGTAGAGATGGCCAGTTAATGG - Intronic
1016936832 6:149454152-149454174 GAGGAGAGAAGGGCAGATCAGGG - Intronic
1018160558 6:161038055-161038077 GAGGAGAGAAAGCGTGAGAAAGG - Intronic
1018511604 6:164529959-164529981 GAAGAGAGAAGGCAGGACAATGG + Intergenic
1018588602 6:165390538-165390560 GAGGGGTGAAAGCATGATAATGG + Intronic
1019730720 7:2627919-2627941 AAGGAGAGAAGGCCAGAGAGAGG - Intergenic
1022171960 7:27839481-27839503 GAGGAGGGAAGGGCTGCTCAGGG - Intronic
1023625515 7:42111594-42111616 CAGGAGAGCAGGCCTGAGGAAGG + Intronic
1024170254 7:46777837-46777859 CAGGAGCTAAGGCCTGAAAAGGG - Intergenic
1026493204 7:70880979-70881001 GAGGACAGAAGGTCTGACAGAGG + Intergenic
1026536266 7:71241202-71241224 GAGGAGAGAAAGAGTGAGAAAGG - Intronic
1027026575 7:74856564-74856586 GAGAGGAGAAGGACTAATAAGGG + Intergenic
1027061180 7:75087550-75087572 GAGAGGAGAAGGACTAATAAGGG - Intergenic
1027866814 7:83658747-83658769 GAGGCGACAAGACCTGATACTGG + Intergenic
1028068486 7:86418615-86418637 GAGGAAAGAAGGAAGGATAAAGG + Intergenic
1028117017 7:87009695-87009717 GAGGTGAGAAAGCCAGAGAAAGG - Intronic
1029266755 7:99348365-99348387 GAGTGGAGAAGGCCTGTTCATGG + Intronic
1031961513 7:127994265-127994287 CAGGAGAGAAGTCAAGATAATGG - Intronic
1032663802 7:134015161-134015183 CAGGAGAGAAGGCCTTAATAAGG - Intronic
1033366795 7:140678240-140678262 GAAGAGAGAAGGCATGATCTGGG + Intronic
1033664930 7:143431384-143431406 CGGGAGAGTAGGCATGATAAAGG - Intergenic
1033975816 7:147099226-147099248 GAAGAGAGAAAGCTGGATAAAGG + Intronic
1034816363 7:154175396-154175418 GGGAGGAGAAGGCCTGAGAAGGG + Intronic
1035783545 8:2246901-2246923 CAGGAGAGAAGGCCAAATATGGG - Intergenic
1035808579 8:2472685-2472707 CAGGAGAGAAGGCCAAATATGGG + Intergenic
1036062717 8:5342279-5342301 GAGGAGAGAAGGACTGGAGAGGG - Intergenic
1037434154 8:18845428-18845450 GACGAGTGAAGGACTGATGAGGG - Intronic
1038088248 8:24223948-24223970 GAGCTGAGAAGGCATAATAAAGG - Intergenic
1039084724 8:33768574-33768596 AAGGTGAGCACGCCTGATAAAGG - Intergenic
1039377617 8:37051971-37051993 GAGGAGGGCATGTCTGATAAGGG + Intergenic
1040860982 8:51999151-51999173 CAGGAGAGAAACCCTGAGAAGGG + Intergenic
1041542028 8:58995989-58996011 GGGGAGAGCAGGCCTGGAAACGG - Intronic
1042477560 8:69266272-69266294 GGTGAGAGAAGGCCTGAGGAGGG + Intergenic
1045695796 8:104807467-104807489 AGGGAGAGAAGGTCTGACAATGG - Intronic
1045769708 8:105721706-105721728 ATGGATAGAAGGCCTGATGAAGG - Intronic
1046249634 8:111612539-111612561 GAGGAAAGGAGACCTGATATGGG + Intergenic
1047681490 8:127258372-127258394 GAGGTGAGGAGGTCTGAGAAGGG + Intergenic
1047826549 8:128582216-128582238 GAGGAGAGAAGGGGAGAAAAGGG - Intergenic
1048437853 8:134434235-134434257 GAGGACAGAAGGCCTGACTCGGG + Intergenic
1048618418 8:136104876-136104898 GAGGACAGGATGCCTGAGAAGGG + Intergenic
1050236574 9:3587385-3587407 CAGGAGAGAAAGCGAGATAAGGG - Intergenic
1050606378 9:7305656-7305678 GTGGAGAGAGGGCCTGTGAATGG - Intergenic
1051730831 9:20140998-20141020 GAGGAGAGGAGAGATGATAAAGG - Intergenic
1052829609 9:33204121-33204143 GAGGAGAGAATTTCTGAAAATGG - Intergenic
1053305610 9:36982451-36982473 AAGGAGAGAAGGCCTGGAGATGG + Intronic
1053617917 9:39788580-39788602 CAGGTGTGAAGGCCTGAGAAGGG - Intergenic
1054266242 9:62918849-62918871 CAGGTGTGAAGGCCTGAGAAGGG + Intergenic
1055076549 9:72221095-72221117 CAGGAGAGAAGGACTCATAGAGG - Intronic
1056263460 9:84872813-84872835 GAGGAAAGAAGACATTATAAAGG + Intronic
1057031840 9:91782040-91782062 GAAGAGAGAAGGTCTGTGAAAGG - Intronic
1057208529 9:93187011-93187033 GAGAAGAGAGGGCCTGAAAGGGG + Intronic
1057557484 9:96099442-96099464 GAGGAGAGAAGGACAGAAATTGG + Intergenic
1057695519 9:97320363-97320385 GAGGAGGGGAGGCCTTAGAAGGG - Intronic
1058630716 9:106983804-106983826 GAGGAAGGAAGGCATGCTAATGG + Intronic
1059073232 9:111162091-111162113 GAGAAGAGAAGTGCTAATAAGGG - Intergenic
1059700659 9:116772689-116772711 GAGGAGGGAAGTCCTGGGAATGG - Intronic
1060875053 9:127077218-127077240 GAGGAGTGAAGGCCAGTTAGGGG + Intronic
1062242659 9:135548504-135548526 GGGGAGAGGAGGCCTGAGAATGG - Intronic
1186305038 X:8247261-8247283 GGGGAGAGAAGTCCTGATTCAGG - Intergenic
1186818322 X:13259999-13260021 GAGGAGAGAAGGCTTCCTACAGG - Intergenic
1187142961 X:16611814-16611836 CAGGTAAGAAAGCCTGATAAGGG + Intronic
1188662156 X:32774125-32774147 TAGGAGAAATGGCCTGCTAAAGG + Intronic
1188966922 X:36565416-36565438 CAGGTGAGAAGGGATGATAAGGG - Intergenic
1189177444 X:38971998-38972020 GAGGAGAGAATGGGTGATAAGGG + Intergenic
1189614067 X:42766401-42766423 GGTGAGAGAAAGCATGATAAAGG - Intergenic
1190072381 X:47290011-47290033 GGTGAGAGAAAGCATGATAAAGG + Intergenic
1190215584 X:48477630-48477652 GAGCAGAGAAGGGTTGATAGTGG + Intronic
1190304187 X:49073028-49073050 GAAGACAGAAGGCCTGAAAGAGG - Intronic
1190343594 X:49317267-49317289 GAGGTGAAAAGGCCTGAAGAAGG + Exonic
1190879310 X:54481653-54481675 GAGGAGAGAAGACTTCCTAAAGG + Intronic
1192270292 X:69573279-69573301 GAGTAGAGAGGCCATGATAAAGG - Intergenic
1192573622 X:72225719-72225741 GGTGAGAGAAAGCATGATAAAGG - Intronic
1193331579 X:80240591-80240613 GAGGAGAGGAAGACAGATAAGGG - Intergenic
1195502047 X:105613176-105613198 CAGGAGAGATGGCCTGGAAATGG - Intronic
1196061079 X:111409020-111409042 GAGGAGAGAGGGCTGGATAATGG + Intronic
1196123187 X:112071904-112071926 GAGGAGAGAATGCCCAAAAAGGG - Intronic
1197429402 X:126342238-126342260 GAGGAGATAGGGCCTGGAAAGGG - Intergenic
1197827241 X:130602809-130602831 GAGGAGAGAAGGAGGGAGAAAGG + Intergenic
1198320265 X:135513150-135513172 GATGAGAGAAGGGCTGATGAGGG - Intergenic
1200154976 X:153970469-153970491 GAGGGGAGAAGGACGGGTAAGGG + Intronic
1201717102 Y:17057265-17057287 GAGGAGAGCAGAGCAGATAAAGG + Intergenic
1201798914 Y:17932652-17932674 GAGGAGAAAAAGCCTGTAAAAGG - Intergenic
1201802639 Y:17973305-17973327 GAGGAGAAAAAGCCTGTAAAAGG + Intergenic
1201928964 Y:19320299-19320321 GAGGAGAGAAGGCCTAGAATGGG - Intergenic