ID: 981638803

View in Genome Browser
Species Human (GRCh38)
Location 4:146911933-146911955
Sequence ATGTCTGCAAAGATGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 481
Summary {0: 1, 1: 0, 2: 4, 3: 46, 4: 430}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981638795_981638803 24 Left 981638795 4:146911886-146911908 CCTGCCTGCTCTTGGGCATGTTG 0: 1
1: 0
2: 3
3: 23
4: 201
Right 981638803 4:146911933-146911955 ATGTCTGCAAAGATGGAGGAAGG 0: 1
1: 0
2: 4
3: 46
4: 430
981638799_981638803 -4 Left 981638799 4:146911914-146911936 CCCAAGCAAAACTAGAGCTATGT 0: 1
1: 0
2: 1
3: 12
4: 168
Right 981638803 4:146911933-146911955 ATGTCTGCAAAGATGGAGGAAGG 0: 1
1: 0
2: 4
3: 46
4: 430
981638800_981638803 -5 Left 981638800 4:146911915-146911937 CCAAGCAAAACTAGAGCTATGTC 0: 1
1: 0
2: 0
3: 10
4: 89
Right 981638803 4:146911933-146911955 ATGTCTGCAAAGATGGAGGAAGG 0: 1
1: 0
2: 4
3: 46
4: 430
981638796_981638803 20 Left 981638796 4:146911890-146911912 CCTGCTCTTGGGCATGTTGCTGC 0: 1
1: 1
2: 1
3: 18
4: 192
Right 981638803 4:146911933-146911955 ATGTCTGCAAAGATGGAGGAAGG 0: 1
1: 0
2: 4
3: 46
4: 430
981638794_981638803 25 Left 981638794 4:146911885-146911907 CCCTGCCTGCTCTTGGGCATGTT 0: 1
1: 0
2: 1
3: 29
4: 207
Right 981638803 4:146911933-146911955 ATGTCTGCAAAGATGGAGGAAGG 0: 1
1: 0
2: 4
3: 46
4: 430
981638798_981638803 -3 Left 981638798 4:146911913-146911935 CCCCAAGCAAAACTAGAGCTATG 0: 1
1: 0
2: 2
3: 7
4: 123
Right 981638803 4:146911933-146911955 ATGTCTGCAAAGATGGAGGAAGG 0: 1
1: 0
2: 4
3: 46
4: 430
981638797_981638803 -2 Left 981638797 4:146911912-146911934 CCCCCAAGCAAAACTAGAGCTAT 0: 1
1: 0
2: 2
3: 4
4: 125
Right 981638803 4:146911933-146911955 ATGTCTGCAAAGATGGAGGAAGG 0: 1
1: 0
2: 4
3: 46
4: 430

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981638803 Original CRISPR ATGTCTGCAAAGATGGAGGA AGG Intronic
900889977 1:5442522-5442544 CTGGCTTTAAAGATGGAGGAGGG + Intergenic
901348735 1:8572341-8572363 CTGTGTGCTAAAATGGAGGAAGG - Intronic
901425792 1:9181954-9181976 AAGTTTGCAAAGAAGGAGGCGGG - Intergenic
901723569 1:11220606-11220628 ATGTTTAATAAGATGGAGGAAGG + Intronic
902260988 1:15224747-15224769 ATGTCTGCAAGCATGGAGGGTGG + Intergenic
902263695 1:15246626-15246648 ATGTTTGCAGAGATAGAGAAAGG + Intergenic
902750573 1:18506728-18506750 TTGGCTTCAAAGATGGTGGAAGG - Intergenic
902780006 1:18698926-18698948 GTGTCTGCTGAGATGGGGGAGGG - Intronic
903677870 1:25076046-25076068 ATGGCTTTGAAGATGGAGGAAGG + Intergenic
905069510 1:35213000-35213022 ATGTCTGCAGAGTTGAATGAAGG + Intergenic
905545008 1:38790645-38790667 GTTTCTGCAATGAGGGAGGACGG + Intergenic
906045547 1:42828102-42828124 ATGTTAGAAGAGATGGAGGAAGG + Intronic
906669576 1:47644855-47644877 AGCTCGGCAAAGTTGGAGGATGG + Intergenic
907664346 1:56421248-56421270 ATAAATGCAAAGATGGTGGATGG - Intergenic
907932271 1:59011609-59011631 CTGGCTGTGAAGATGGAGGAAGG + Intergenic
909076890 1:71059894-71059916 ATATCTGTAAACATGGAGAAGGG + Intergenic
909573306 1:77142779-77142801 ATGTGTGGAGAGAAGGAGGAAGG - Intronic
910256342 1:85250955-85250977 ATATTTGCAAACCTGGAGGATGG + Intronic
911026034 1:93435969-93435991 CTGGCTTTAAAGATGGAGGATGG - Intergenic
911605967 1:99905524-99905546 ATTTCAGCAAAGAGGGAAGATGG - Intronic
911741428 1:101390160-101390182 ATGTTTGTACACATGGAGGAGGG + Intergenic
912731189 1:112107011-112107033 ATGTCAGGAAACAGGGAGGAAGG + Intergenic
913179222 1:116303476-116303498 ATGGCAACAAAGATAGAGGATGG + Intergenic
913300932 1:117367670-117367692 ACGTCTGCAAACAGGGAGGAAGG - Exonic
913496998 1:119437022-119437044 ATGTCTGCAATGTGGGAAGAGGG + Intergenic
916744300 1:167672539-167672561 CTGTCTTTGAAGATGGAGGAAGG - Intronic
918586916 1:186198788-186198810 ATGTCTGAAAAAATGGATGGTGG + Intergenic
919392314 1:197002620-197002642 TTGTATGTAAAGATGGACGATGG + Exonic
919482786 1:198109885-198109907 ATGGCTTTGAAGATGGAGGAAGG + Intergenic
920167799 1:204048028-204048050 CTGGCTGCAATGATGCAGGAGGG - Intergenic
921530982 1:216282741-216282763 ATGTCTGCAAAGAAGTAAGGTGG + Intronic
922242567 1:223765498-223765520 GTTTCTGCACAGATGGAGGGTGG + Intronic
1063164303 10:3446032-3446054 ATGGATGCAAAGAAAGAGGAGGG + Intergenic
1063328142 10:5126169-5126191 ATGTCTGCATTGATGGACAAGGG - Intronic
1063877603 10:10496549-10496571 ATGGATGAAAAGATGGAGGGTGG + Intergenic
1064801367 10:19076818-19076840 ATTTCTGCAAAAATGGTGGTTGG + Intronic
1064870538 10:19932116-19932138 ATGACTGCAACAATGCAGGAAGG - Intronic
1065464204 10:26001679-26001701 AGGTCTTAAAAGAAGGAGGAGGG + Intronic
1066374702 10:34847205-34847227 ATTTCTGTAAAGACTGAGGAAGG + Intergenic
1066433525 10:35375324-35375346 CTGGCTTTAAAGATGGAGGAAGG - Intronic
1067498671 10:46782178-46782200 ATCTCAGTAAAGCTGGAGGAAGG + Intergenic
1067595981 10:47558215-47558237 ATCTCAGTAAAGCTGGAGGAAGG - Intergenic
1067644840 10:48088249-48088271 ATGTCTGTACAGAGGGATGAGGG - Intergenic
1067661304 10:48237990-48238012 TTTTCTGCAAAGAAGGAGCAAGG - Exonic
1069629925 10:69891431-69891453 ATGTCTGCAGAACCGGAGGAAGG + Intronic
1070147577 10:73785888-73785910 ATGTTTGCAGAGTGGGAGGACGG + Exonic
1070415014 10:76181162-76181184 ATGTCTGCAAAAAGGGAGAAGGG - Intronic
1071481875 10:86070683-86070705 ATGTGTGCAGGGATGGATGAGGG - Intronic
1071617017 10:87084143-87084165 ATCTCAGTAAAGCTGGAGGAAGG + Intronic
1072686054 10:97537616-97537638 AGGTCTGAAAAGAGGGAGGAGGG + Intronic
1072751569 10:97984315-97984337 ATGACTGCTCAGATGGGGGAGGG - Intronic
1073527108 10:104193971-104193993 ACGGCTGCAGAGAGGGAGGATGG + Exonic
1073673368 10:105617320-105617342 TTGGCTTCAAAGATGGAGGAAGG + Intergenic
1073795056 10:106978299-106978321 ATGACTGAAAAGATAGAGGATGG + Intronic
1074052995 10:109896784-109896806 ATATCTACGAAGATGGACGAAGG + Intronic
1074473085 10:113744814-113744836 CTGTCTGCAGAGGTGGAGGCAGG - Intergenic
1074494038 10:113963434-113963456 ATGGCTTTGAAGATGGAGGAAGG - Intergenic
1074528824 10:114282832-114282854 ATGTCTGCAAAGCTGGTGCTCGG - Intronic
1074950516 10:118329810-118329832 ATGAATGCAAACATGGATGACGG - Intronic
1075189267 10:120291517-120291539 TTATCTGCAAAGTTGGGGGAAGG - Intergenic
1075403483 10:122177936-122177958 AAGTCTGCCAAGATCGAAGATGG + Intronic
1076825254 10:132963948-132963970 AGGCTTGCAAAGATGGAGGTGGG - Intergenic
1077280503 11:1742895-1742917 ATGGATGGACAGATGGAGGATGG + Intronic
1077280556 11:1743142-1743164 ATGGATGGACAGATGGAGGATGG + Intronic
1077280576 11:1743274-1743296 ATGGATGGACAGATGGAGGATGG + Intronic
1078018406 11:7635035-7635057 GAGTCTGGAAAGATGGAGGAGGG + Intronic
1078899252 11:15626227-15626249 CTGGCTTCAAAGTTGGAGGAAGG - Intergenic
1079635343 11:22731994-22732016 ATGTCAGGGAAGATGCAGGAGGG + Intronic
1082771427 11:57210796-57210818 CTGTCTGCACCGTTGGAGGATGG - Intergenic
1083476619 11:62919610-62919632 ATGCCTACAAGGATGGAGGAGGG - Intronic
1084040365 11:66539235-66539257 AACTATGCAAAGATGGAGGGAGG + Exonic
1084068621 11:66719728-66719750 ATGTGTGCAAACATGGTGGGTGG + Intronic
1084543837 11:69803818-69803840 ATGGATGAAAAGATGGAAGATGG + Intergenic
1084543875 11:69804053-69804075 ATGGATGAAAAGATGGAAGATGG + Intergenic
1084543893 11:69804184-69804206 ATGGTTGAAAAGATGGAAGATGG + Intergenic
1085023378 11:73222680-73222702 AGGTGGGCAAAGAGGGAGGAGGG - Intronic
1085278096 11:75312778-75312800 CTGGCTTCAAAGCTGGAGGATGG + Intronic
1086922262 11:92601035-92601057 ATGTCATCAGAGAAGGAGGAAGG + Intronic
1087399512 11:97647276-97647298 ATGAGTGCAAAGCTTGAGGATGG + Intergenic
1088924446 11:114286059-114286081 ATCTCTGCAAAAATGGGGCAAGG - Intronic
1089925358 11:122251415-122251437 AAGTCTGCAAAGATGAACCAAGG + Intergenic
1090695754 11:129239775-129239797 CTGTTTGCACAGATTGAGGATGG - Intronic
1092585764 12:9899574-9899596 AGGGATGCAAAGATGGAAGAGGG - Intronic
1093027461 12:14258053-14258075 CTGTCTGCAATGTTGGGGGAGGG + Intergenic
1093440447 12:19189354-19189376 GTGTCAGCAGAGATGGAGGAAGG + Intronic
1093669574 12:21857713-21857735 CTGGCTTCAAAGGTGGAGGAAGG + Intronic
1093702876 12:22242338-22242360 TTGTCAGAAAAGATGGACGATGG - Intronic
1094362849 12:29649017-29649039 ATGTGGGCAGAGGTGGAGGATGG - Intronic
1094585517 12:31774050-31774072 AGGTCTAGAAAGGTGGAGGAAGG + Intergenic
1094794411 12:33954283-33954305 ATACCTGCAAAGACGGAGGAGGG + Intergenic
1095106265 12:38236885-38236907 ATACCTACAAAGAGGGAGGAGGG + Intergenic
1098300278 12:69047326-69047348 ATTCTTGTAAAGATGGAGGATGG + Intergenic
1098562073 12:71885914-71885936 AGGTCTGCAAAGTATGAGGAGGG + Intronic
1098967112 12:76802686-76802708 ATGTCTTCAAAGACAGAAGAAGG - Intronic
1099640069 12:85275459-85275481 ATGTCTGCAGAGCTGTGGGAAGG + Intergenic
1099874369 12:88386418-88386440 TTGTCTTCAAATATGGAGAAAGG - Intergenic
1099885760 12:88528199-88528221 CTGGCTTCAAAGATGGAAGAGGG - Intronic
1103006201 12:117422360-117422382 ATGTATGAATAGATGGTGGATGG - Intronic
1103113327 12:118302140-118302162 ATTTCTGCACAGATCAAGGAAGG + Intronic
1104889568 12:132133807-132133829 ATGTCTGGAAAGGTGAAGGAGGG + Intergenic
1105800897 13:23902720-23902742 ATGTCTGCAAAATAGCAGGAAGG + Intergenic
1105848003 13:24309491-24309513 ATGTCTGCAAAATAGCAGGAAGG - Intronic
1106487930 13:30189184-30189206 AGGTCTGAAAAGAAGGAAGATGG + Intergenic
1107897983 13:44985069-44985091 TTTTCTGCAAAGTTGGAGAATGG + Intronic
1109349114 13:61154085-61154107 TTGTCTTAGAAGATGGAGGAAGG + Intergenic
1110522562 13:76498102-76498124 ATGTGTGCAGAAATAGAGGAAGG + Intergenic
1110941076 13:81349344-81349366 ATGTCAGTAAATATGAAGGATGG - Intergenic
1112257927 13:97851662-97851684 CTGGCTGTGAAGATGGAGGAGGG + Intergenic
1112537399 13:100273690-100273712 ATCTTTGGAAGGATGGAGGAAGG + Intronic
1113224736 13:108147356-108147378 ATGGCTGAATAGATGGAGGATGG - Intergenic
1113224762 13:108147503-108147525 ATGACTGAATAGATGGAGGATGG - Intergenic
1113224791 13:108147699-108147721 ATGACTGAATAGATGGAGGATGG - Intergenic
1113224811 13:108147797-108147819 ATGGCTGAATAGATGGAGGATGG - Intergenic
1113224821 13:108147845-108147867 ATGATTGAATAGATGGAGGATGG - Intergenic
1113224832 13:108147894-108147916 ATGGCTGAATAGATGGAAGATGG - Intergenic
1113224840 13:108147943-108147965 ATGGCTGAATAGATGGAGGATGG - Intergenic
1113224862 13:108148040-108148062 ATGACTGAATAGATGGAGGATGG - Intergenic
1113224873 13:108148089-108148111 ATGACTGAATAGATGGAGGATGG - Intergenic
1113573930 13:111381667-111381689 AGCTCTGCAGAGATGGTGGAAGG + Intergenic
1113573945 13:111381725-111381747 GGGTCTGCAGAGATGGTGGAGGG + Intergenic
1113573961 13:111381782-111381804 GGGTCTGCAGAGATGGTGGAGGG + Intergenic
1113573976 13:111381840-111381862 GGGTCTGCAGAGATGGTGGAGGG + Intergenic
1114768412 14:25401021-25401043 ATCCCTGGAAAGATGGAGAAAGG - Intergenic
1115746275 14:36441006-36441028 ATATTTGCAATGATGGAGGGTGG - Intergenic
1116350713 14:43859127-43859149 ATATCTACAAAGATGTAGTATGG - Intergenic
1117009495 14:51455859-51455881 ATAGATGCAAAGATGGGGGAAGG + Intergenic
1117319705 14:54609268-54609290 CTGACTTCAAAGATGGAGAAAGG + Intronic
1117836207 14:59808870-59808892 AAGTCTGCAATCATTGAGGAAGG - Intronic
1118070692 14:62244035-62244057 CTGGCTTTAAAGATGGAGGAAGG + Intergenic
1118590404 14:67396670-67396692 ATGTGGGCAAAGATGGAACAAGG - Intronic
1119505759 14:75171579-75171601 CTGGCTTTAAAGATGGAGGAAGG + Intronic
1119571630 14:75679312-75679334 TTGACTTCAAAGATAGAGGAAGG + Intronic
1119694470 14:76701716-76701738 ATCCCTTCAAAGATGGAGGTTGG + Intergenic
1119852536 14:77876262-77876284 CTGGCTGTAAAGATGAAGGAAGG - Intronic
1119895970 14:78220336-78220358 AGGTGTGCAGAGAGGGAGGAGGG + Intergenic
1120023249 14:79553630-79553652 GTATCTGCACAGAAGGAGGAAGG + Intronic
1120252087 14:82070175-82070197 CTGGCTTCGAAGATGGAGGAAGG + Intergenic
1120513037 14:85438482-85438504 GTGTCTGAGAAGAAGGAGGAGGG + Intergenic
1120858782 14:89235760-89235782 TTGTCTGTGAAGATGGAGGATGG + Intronic
1121423210 14:93830168-93830190 ATGGATGGATAGATGGAGGAAGG + Intergenic
1121739969 14:96244806-96244828 ATGGATGCATGGATGGAGGAGGG - Intronic
1121952004 14:98179412-98179434 ATGTCTTCAAAGATGGGGGCTGG - Intergenic
1121990847 14:98555723-98555745 ATGTCTGTAAAAATAGAAGAAGG + Intergenic
1122020785 14:98836357-98836379 CTGGCTGCGAAGATGGAGGAAGG - Intergenic
1123690232 15:22832648-22832670 CTGGCTTCAAAGATGGAGGAAGG - Intergenic
1123704583 15:22941724-22941746 CTGTGTGCAAAGCTGGGGGAAGG - Intronic
1123779873 15:23615608-23615630 ATATCTACAAAAAAGGAGGAAGG - Intronic
1124205239 15:27712932-27712954 CTGGCTATAAAGATGGAGGAGGG + Intergenic
1125349316 15:38751287-38751309 ATGTATGCAAAGGTCAAGGATGG + Intergenic
1126904471 15:53349520-53349542 ATCTTTCAAAAGATGGAGGAAGG + Intergenic
1127261080 15:57326719-57326741 ATGTCTGTAAAGATTAAGAAAGG + Intergenic
1127324630 15:57883327-57883349 ATGACTGCAAAGAAGGAGCATGG - Intergenic
1127531584 15:59848631-59848653 ATGACTCCATAGATGTAGGAAGG + Intergenic
1127535151 15:59883273-59883295 AGGTCAGGAGAGATGGAGGAGGG + Intergenic
1128949954 15:71868291-71868313 ATGTCTCTGAAGATGGAGAAAGG - Intronic
1129918798 15:79300251-79300273 AAGGCTGCAAAGATAGAGGGTGG - Intergenic
1130847130 15:87758078-87758100 CTGTCTTAAAAGATGAAGGAAGG + Intergenic
1131071707 15:89470300-89470322 ACGTCGGCAAAGATGGAAGCCGG - Intergenic
1131360795 15:91788910-91788932 ATTTCTCCAAAGATGGAGTGAGG + Intergenic
1133266561 16:4588117-4588139 ATGGCTGCTGGGATGGAGGAAGG - Intronic
1133609041 16:7415992-7416014 ATCTCTGCAAAGATGAAGTTCGG - Intronic
1136392204 16:29972866-29972888 ATGTGTGCAGAAATTGAGGAAGG - Intronic
1138234437 16:55369867-55369889 ATGTCTGCAAAAAAGGCGGGGGG + Intergenic
1138344462 16:56311622-56311644 ATGTCAGCAGGGAGGGAGGAGGG - Intronic
1138748133 16:59387292-59387314 GTGCATGCAAGGATGGAGGATGG + Intergenic
1138784434 16:59829591-59829613 ATGTTTGCCAAGATGTAGTAAGG - Intergenic
1138797610 16:59988911-59988933 ATGTCAGCAAAAATGGTGAATGG + Intergenic
1140305559 16:73799476-73799498 TCATCTGCAAAGATGGAGAAGGG + Intergenic
1140558445 16:75948259-75948281 CTGTCTTTAGAGATGGAGGAAGG + Intergenic
1140676585 16:77338197-77338219 ATGTATGAAAAGATGGAGCCAGG - Intronic
1141235656 16:82213565-82213587 CTGGCTTCAAAGATGGAGGAGGG + Intergenic
1141283390 16:82649300-82649322 ATGAATGCATAGATGGAGGATGG + Intronic
1141517594 16:84556420-84556442 AAGTCTGCAAAAAGAGAGGAGGG + Intergenic
1141789324 16:86223696-86223718 ACCTCTGCAAAGATGGAGCCAGG - Intergenic
1142548058 17:719325-719347 TTATCTGCAAAGAGGGAGAAGGG - Intronic
1143893592 17:10120255-10120277 ATTTCTGCAAGAATGGAGGGAGG - Intronic
1144835817 17:18156184-18156206 ATATCTGCAAAGCTGGAGGATGG - Exonic
1146521019 17:33525595-33525617 ATGTCTGCAAGGCAGGAGGTAGG - Intronic
1146663315 17:34679756-34679778 ATGTCTGCATGGCAGGAGGATGG + Intergenic
1148972259 17:51493914-51493936 ACTTCTGGAAAGATGGAGGAAGG - Intergenic
1149554768 17:57565514-57565536 CTGTCTGCAAGAATGCAGGAAGG - Intronic
1151022397 17:70632456-70632478 ATGTCATAAAAGAGGGAGGAGGG + Intergenic
1151129650 17:71883186-71883208 AAGGCTTGAAAGATGGAGGAGGG + Intergenic
1151582304 17:74987537-74987559 ATGTATGCAAAGCTGGAGGCGGG - Intergenic
1152006601 17:77686084-77686106 ATGGATGGATAGATGGAGGAAGG - Intergenic
1152281268 17:79386137-79386159 ATGTCTGCAATGGAGGATGATGG - Intronic
1153519074 18:5934935-5934957 GTGTCAGCAATGATGGAGGCTGG + Intergenic
1156036229 18:32770623-32770645 CTGTCTGCCAGGTTGGAGGAGGG - Exonic
1156181455 18:34609997-34610019 ATCTCGGCAAAAATGGAGGGAGG - Intronic
1156200061 18:34820772-34820794 ATTTCTGGAAAGAAGAAGGAAGG - Exonic
1156366050 18:36428392-36428414 CTTCCTCCAAAGATGGAGGAAGG - Intronic
1156837075 18:41567264-41567286 AGGCCTGAAGAGATGGAGGAAGG + Intergenic
1158110044 18:53930823-53930845 ATGGCTTTAAAGATAGAGGAAGG - Intergenic
1158731188 18:60024346-60024368 ATGAATGTAAAGATGCAGGATGG + Intergenic
1161117211 19:2504382-2504404 CTGGCTGCGAAGGTGGAGGAAGG + Intergenic
1161468378 19:4444525-4444547 ATGGCTGTGAAGGTGGAGGAAGG - Intronic
1161510521 19:4668369-4668391 ATGTCTGGACAGAAGGAGGGAGG - Intronic
1161761940 19:6180064-6180086 CTGGCTGTGAAGATGGAGGAAGG - Intronic
1161996801 19:7718070-7718092 CTGGCTTTAAAGATGGAGGAAGG - Intergenic
1162203318 19:9037031-9037053 ATGGCTGCATGGATGGAAGAAGG + Intergenic
1162315905 19:9937699-9937721 ATGTAGGCAGAGGTGGAGGAGGG + Intergenic
1162960939 19:14126234-14126256 AGGTCTGCAAAGATATAGGAGGG + Exonic
1166207604 19:41282136-41282158 ATGTGTACAAATATGAAGGAAGG - Intronic
1166681194 19:44768177-44768199 CAGACTCCAAAGATGGAGGAAGG + Intergenic
1167144159 19:47672101-47672123 ATGGATGGAAGGATGGAGGATGG + Intronic
1167144174 19:47672163-47672185 ATGGATGGAAGGATGGAGGATGG + Intronic
1167144182 19:47672194-47672216 ATGGATGGAAGGATGGAGGATGG + Intronic
1167144213 19:47672316-47672338 ATGGATGGAAGGATGGAGGATGG + Intronic
1167144221 19:47672347-47672369 ATGGATGGAAGGATGGAGGATGG + Intronic
1167144229 19:47672378-47672400 ATGGATGGAAGGATGGAGGATGG + Intronic
1167810115 19:51822336-51822358 ATGCCCGCAAAGATGGAGGAGGG + Intronic
1167945680 19:52986701-52986723 TTGAATGCAAAGATGGAGCAAGG - Intergenic
1168508273 19:56954608-56954630 ATGGGTGGATAGATGGAGGATGG - Intergenic
926445639 2:12938398-12938420 ATGCCTGGAAAGATGCAAGAGGG - Intergenic
927479691 2:23442485-23442507 TTGTCTTTGAAGATGGAGGAAGG + Intronic
927521389 2:23700804-23700826 AGGGCTTCAAGGATGGAGGATGG - Intronic
928130462 2:28645344-28645366 AGCTCTGAAAAGATGGAGAATGG + Intergenic
928340613 2:30440077-30440099 CTGACTTCAAAGGTGGAGGAAGG + Intergenic
928535122 2:32232666-32232688 ATGTTTGCAGGGATGGAAGATGG + Intronic
929560924 2:42955873-42955895 ATGTAGACAAAGATGAAGGAGGG - Intergenic
929827900 2:45324013-45324035 ATGACTTTGAAGATGGAGGAGGG - Intergenic
930289868 2:49480663-49480685 ACGTATGCAAAGATGGAATATGG + Intergenic
930798465 2:55418952-55418974 GTGGCTGCAGAGATGGAGGTGGG - Intronic
930979802 2:57510100-57510122 ATATGTGTAAAGAAGGAGGATGG + Intergenic
931629839 2:64288831-64288853 ATGTGCCCCAAGATGGAGGAAGG + Intergenic
931812296 2:65866571-65866593 ATGTCTGCAAGGATAGAGATGGG - Intergenic
932560303 2:72862208-72862230 ATGTCTGCAAAGTTTGTGGAAGG - Intergenic
932599566 2:73113932-73113954 ATGTCAGCTCAGATGGGGGAGGG + Intronic
932675371 2:73775990-73776012 ATGTCTACATATATGAAGGATGG + Intronic
932987412 2:76742954-76742976 CTGTCTGCAAACAAGGAAGAAGG + Intergenic
933349689 2:81137531-81137553 GTGTCTGCAGTGATGGATGAGGG - Intergenic
937231674 2:120401527-120401549 AGGTCTGGAAAGAAGCAGGAAGG + Intergenic
937596009 2:123674298-123674320 CAGTCTGCAAACATGGAGAAAGG + Intergenic
937639660 2:124197225-124197247 CGATCTGCAAAGGTGGAGGAAGG - Intronic
942180600 2:173376973-173376995 ATTTCTGCAAACATGGAAGTTGG + Intergenic
943070433 2:183134991-183135013 CTGACTGTGAAGATGGAGGAAGG - Intronic
943560563 2:189456628-189456650 ATGACTGTAAAGAGGGAGGAGGG + Intronic
943646186 2:190409096-190409118 ATGTCTGCTAGGATGGTGGCTGG - Intronic
944515913 2:200511441-200511463 CCTTCTGCAGAGATGGAGGAAGG + Intronic
946942473 2:224784114-224784136 AAGTCTCCAGAGATGGAGAAAGG - Intronic
946952364 2:224891056-224891078 ATGTCTAGAAGGATGGATGATGG + Intronic
947430606 2:230024438-230024460 ATCTCTGCAAAGTGGGAGGTCGG - Intergenic
947829714 2:233130355-233130377 ATGTTTGCAAACCTGGACGAAGG - Intronic
948510516 2:238461226-238461248 CTGGCTGTGAAGATGGAGGAGGG - Intergenic
948874580 2:240819923-240819945 TTCTCTGCGGAGATGGAGGAAGG + Intronic
949055171 2:241924078-241924100 AGGTCTGCAAACAGGGAGGGTGG - Intergenic
1170436289 20:16333087-16333109 ATGTGGGCAAAGAGGTAGGAAGG - Intronic
1170491960 20:16886365-16886387 AGGTATGCAAAGAGGGAGGAAGG + Intergenic
1172261699 20:33572181-33572203 ATATCTGTAAAGATGGTGGTAGG + Intronic
1172318899 20:33980592-33980614 ATGTCAGCAAAGCAGAAGGAGGG + Intergenic
1173488017 20:43455917-43455939 ATGGCTTTGAAGATGGAGGAAGG - Intergenic
1173697935 20:45037300-45037322 ATGTGTGCAAAAGGGGAGGAAGG + Intronic
1174091435 20:48051815-48051837 ATGTCTACCAAGAAGGAGAATGG + Intergenic
1174556711 20:51400738-51400760 ATGTCTGTGAGGATGAAGGAAGG - Intronic
1174577279 20:51545515-51545537 ATGTGTGGATAAATGGAGGATGG + Intronic
1175132487 20:56800035-56800057 ATATCTGGAAATATGGTGGAAGG - Intergenic
1175484657 20:59337312-59337334 ATGTCTGCCTAGCTGGAGGGAGG - Intergenic
1178183496 21:30191944-30191966 ATGAATGCGAAGATGGAAGAAGG - Intergenic
1179234216 21:39530768-39530790 ACGTCTGCAAAGACTGAGCATGG - Intergenic
1180651079 22:17377693-17377715 AAATATGCAAATATGGAGGAAGG - Intronic
1182428619 22:30287700-30287722 ATGTGTGCAAAGACTGAGAAAGG + Intronic
1183209834 22:36444074-36444096 AAGGTTTCAAAGATGGAGGATGG + Intergenic
1183700069 22:39446138-39446160 ATGTCTGCCAAGATGGCTGCAGG - Intergenic
1184159584 22:42690073-42690095 ATGTCTTCAAGGATGCAGTATGG + Intergenic
1184473629 22:44709408-44709430 CTGGCTGTGAAGATGGAGGAAGG + Intronic
1185008868 22:48301954-48301976 AATTCTACAAAGATAGAGGATGG - Intergenic
949777224 3:7646722-7646744 ATGTATGAGAAGTTGGAGGATGG + Intronic
951757343 3:26105478-26105500 ATTTCTGCAGAGTCGGAGGATGG + Intergenic
952022742 3:29042259-29042281 ATGTCAGCAAAGATGGAGCAGGG - Intergenic
952683796 3:36126091-36126113 ATGACTGAAAAGATGGAAAAAGG + Intergenic
953516889 3:43602176-43602198 ATTTGTGGAAAGAAGGAGGAGGG - Intronic
954652076 3:52171162-52171184 ATGCCTGCCATGATAGAGGAGGG + Intergenic
955237989 3:57156795-57156817 ATGTGGGCAAAGCTGGAGAAGGG - Intronic
955485015 3:59426427-59426449 CTGTCTTCAAAGATGGAGAAAGG - Intergenic
956517348 3:70063639-70063661 AAGTCAGCAAAGATGGAGACAGG - Intergenic
956661364 3:71601577-71601599 CTGACTGCAATGAGGGAGGAAGG + Intergenic
957594001 3:82236992-82237014 AAGGATGCAAAGATGGAGAAAGG + Intergenic
958128169 3:89384054-89384076 ATGGCTCCAAAGATCGAGGAGGG - Intronic
958667065 3:97154624-97154646 ATGTTTTTAAAGGTGGAGGAAGG - Intronic
959007978 3:101042205-101042227 ATGGCTACAGAGAAGGAGGAAGG - Intergenic
960379391 3:116940383-116940405 ATGTCTGCAGTGGTGGATGAGGG - Intronic
960729491 3:120710535-120710557 ATGTGGGCACAGATGGAGAAAGG - Intronic
961770732 3:129248273-129248295 GTGACCGCAAAGCTGGAGGAAGG - Intergenic
962669778 3:137693221-137693243 ATGTTTTAAAAGATGGAGGCAGG + Intergenic
963485194 3:145927090-145927112 ATGTCTACAGAGATGGATGAGGG + Intergenic
964601825 3:158510085-158510107 ATGTCTGGAAAGATCAAGCATGG - Intronic
964635874 3:158858408-158858430 ATGTCTGCAGTGGTGGATGAGGG + Intergenic
964668442 3:159199335-159199357 TTGTCTTTAAAGTTGGAGGAAGG + Intronic
965810352 3:172585372-172585394 ATGTTAGCAAAGAAGGAGAAAGG - Intergenic
966482058 3:180421408-180421430 CTGGCTTCAAAGATGGAGTAAGG + Intergenic
967000231 3:185327177-185327199 CTGGCTTCGAAGATGGAGGAAGG - Intronic
967406832 3:189125719-189125741 AATTCTGCAAAGGAGGAGGATGG - Intronic
968935816 4:3609864-3609886 ATGTATGCATGGATGGATGATGG - Intergenic
969426994 4:7130280-7130302 ATGCCTGCAAAGGTGCAGGCCGG - Intergenic
969453975 4:7290658-7290680 ATGTGTGCATACATGGATGAGGG - Intronic
970250554 4:14111017-14111039 TTTTATGCAAAGATTGAGGAGGG + Intergenic
970573029 4:17401241-17401263 CTGGCTTCAAAGATGGAGGAAGG - Intergenic
971576320 4:28280002-28280024 AAGCCTGGAAAAATGGAGGACGG + Intergenic
971663820 4:29456341-29456363 CTGTCTTTAAAGATGGAGGAAGG - Intergenic
971703891 4:30014440-30014462 ACGTCTGCAAAGAGTGAGAAAGG - Intergenic
971829277 4:31670115-31670137 ATGTCTGCAAAGCTGAGTGAAGG + Intergenic
972018682 4:34280681-34280703 GTGTCTGCAGTGATGGATGAAGG + Intergenic
972577339 4:40364129-40364151 GTGTCTGCAAAGGTGTAGGCAGG + Intergenic
973137942 4:46730274-46730296 ATGTCAGCAGAAATGGAGGTTGG + Intergenic
974844862 4:67340060-67340082 ATGTCCCCACAGATGGAAGAAGG + Intergenic
975349199 4:73327373-73327395 ATGGATGCACATATGGAGGATGG - Intergenic
975528437 4:75376254-75376276 ATGTCTGCAAGGCAGGAAGAGGG - Intergenic
975969490 4:80016365-80016387 ATGTCAGCAAAGAAAGGGGATGG - Intronic
976048239 4:80978744-80978766 ATTTCTGCAAAGAAGGTAGAAGG - Intergenic
976303077 4:83534025-83534047 ATCTTTGCAGTGATGGAGGAGGG - Intergenic
976359170 4:84157490-84157512 ATGCCTCCAAAGATGACGGAGGG - Intergenic
977155665 4:93569662-93569684 ATGTCAGTAAAGACGGAGGTAGG - Intronic
978989336 4:115059332-115059354 ATGTCTACAAATATGGAGATGGG - Intronic
981538601 4:145825267-145825289 AAGCCTGCAGAGCTGGAGGAAGG + Intronic
981638803 4:146911933-146911955 ATGTCTGCAAAGATGGAGGAAGG + Intronic
982322134 4:154088167-154088189 ATGTCCCCTAAGAGGGAGGAAGG - Intergenic
982492620 4:156047814-156047836 ATATCTGCAAATATGAGGGAAGG + Intergenic
982788741 4:159566055-159566077 ATGTGTGGATAGCTGGAGGATGG - Intergenic
985149572 4:186932615-186932637 ATGTGTCTAAAAATGGAGGAAGG - Intergenic
985814619 5:2117392-2117414 CTGTCTGCAAACCTGGGGGAAGG - Intergenic
986226298 5:5817580-5817602 ATGTCTGCTAGCATGGAGGAAGG + Intergenic
988873996 5:35423562-35423584 ATGTTTGATAAGATGAAGGAAGG + Intergenic
988999119 5:36742842-36742864 CTGACTTCAAAGATGGAGGAAGG + Intergenic
989725948 5:44586982-44587004 ATGTGTGCAGGGATGGATGAGGG - Intergenic
992078517 5:73213782-73213804 AGGTCTGCGAGGGTGGAGGATGG + Intergenic
992810027 5:80377389-80377411 CTGTCTGGAAAGAGGAAGGAAGG + Intergenic
993124882 5:83821667-83821689 ATACATGCAAAGAAGGAGGAGGG - Intergenic
993433494 5:87861922-87861944 CTGGCTTCAAAAATGGAGGAAGG - Intergenic
993881439 5:93366485-93366507 AGGAATGCAAAGATGGTGGAAGG - Intergenic
994207200 5:97048365-97048387 CTGTCTTGGAAGATGGAGGAAGG + Intergenic
994964396 5:106649703-106649725 ATGTCTGCACAACTGAAGGAAGG + Intergenic
995288413 5:110419193-110419215 AAGAAAGCAAAGATGGAGGAAGG + Intronic
996058069 5:119001982-119002004 CTGGCTTCACAGATGGAGGATGG - Intergenic
996343686 5:122467033-122467055 ATGACAGCAAAGAGGGAGGGAGG - Intergenic
996351825 5:122552211-122552233 CTGTCTTTGAAGATGGAGGAAGG + Intergenic
996455234 5:123674209-123674231 ATCTTTGCAATTATGGAGGATGG - Intergenic
997712043 5:136014035-136014057 AGCCCTGCAAAGAGGGAGGATGG - Intergenic
998923402 5:147095972-147095994 GTGGCTGCAAAGAGGCAGGAGGG + Intergenic
999125094 5:149240563-149240585 ATGACAGCAGAGATGGGGGATGG - Intronic
999213547 5:149912389-149912411 ATGTCTGTAAACATGCAGAATGG - Intronic
999939659 5:156528088-156528110 ATGACAGCAGAGATGGAGAAAGG + Intronic
1000078668 5:157822021-157822043 ATGTGTGCAAAACTTGAGGATGG - Intronic
1000303656 5:159976819-159976841 GTGTCAGAAGAGATGGAGGAGGG + Intergenic
1001345375 5:170891783-170891805 ATGTCCCCAATGTTGGAGGAGGG - Intronic
1001544350 5:172561185-172561207 ATGTCTGCAAATATAAAGAAGGG - Intergenic
1001728008 5:173924086-173924108 ATGTTTCTACAGATGGAGGAAGG - Intronic
1001770756 5:174294161-174294183 CTGGCTTTAAAGATGGAGGAAGG + Intergenic
1002341632 5:178520069-178520091 ATGGATGGATAGATGGAGGATGG + Intronic
1003617804 6:7671026-7671048 ATGACAGAAGAGATGGAGGAGGG - Intergenic
1004176905 6:13347982-13348004 ATGTCTGTGAACATGGAGGGTGG + Intergenic
1004331804 6:14728697-14728719 ATGTGGGCAGAGAAGGAGGAGGG + Intergenic
1005030240 6:21501481-21501503 CTGTATGCAAAGAAGGAAGATGG - Intergenic
1005348119 6:24910173-24910195 GTGTCTGGAAAGATGGGGGGAGG - Intronic
1005728060 6:28669105-28669127 CTGTCTTTGAAGATGGAGGAAGG + Intergenic
1005925981 6:30446089-30446111 ATGAATCCAAAGATGGAAGAGGG - Intergenic
1005937362 6:30533550-30533572 ATATCAGCAAAGATGGATGGAGG - Intergenic
1006888279 6:37400475-37400497 AAGTCTGAAAATATGGAAGAGGG + Intergenic
1006902667 6:37513116-37513138 GTCTCTACAAAGATGGAGGCAGG - Intergenic
1008000873 6:46358402-46358424 ATATCTCCAAAGGTGGTGGAAGG + Intronic
1008469794 6:51871531-51871553 GTGGCTACAAAGATGGAGCAAGG + Intronic
1008505767 6:52228279-52228301 GTGGCTTCGAAGATGGAGGAAGG - Intergenic
1008565246 6:52761776-52761798 ATATCTGCAGAGAGGGAGGGGGG + Intronic
1009443912 6:63716737-63716759 CTGGCTTCAAATATGGAGGAAGG - Intronic
1010373749 6:75141846-75141868 ATGGATGCAAAGATAGAAGATGG + Intronic
1011477524 6:87762640-87762662 ATGCCTGAAAAGATGGAGAAAGG - Intergenic
1012103772 6:95126392-95126414 ATGTCTGCAAAGAATGGGCATGG + Intergenic
1012708609 6:102567840-102567862 ATGTATGCAAAGTTGGCAGATGG - Intergenic
1013488346 6:110619463-110619485 TTGTCTGCAAAGAGGCTGGAGGG + Intronic
1013943419 6:115693255-115693277 ATGGCTTCAAAGATGGAGGAAGG - Intergenic
1014260148 6:119207184-119207206 ATGTGTACAAAGAGGAAGGAAGG - Intronic
1015829933 6:137357925-137357947 TTGTCTGCAAAGGTGGAGAGAGG - Intergenic
1015896354 6:138020678-138020700 CTGGCTTTAAAGATGGAGGAAGG - Intergenic
1017120762 6:151021929-151021951 ATGTTTGCAAGGCTAGAGGAAGG - Intronic
1017631181 6:156397545-156397567 ATGTCTGCAGAGCTTGAGGTTGG + Intergenic
1018176141 6:161180986-161181008 CTATCTGTAAAGATGGAGGAGGG + Intronic
1018702150 6:166435830-166435852 AGGGCTGGAAAGGTGGAGGAAGG + Intronic
1018853129 6:167655425-167655447 ATGACTGCATTGATGGATGATGG + Intergenic
1021550808 7:21869134-21869156 ATGCCTGCAAAGATGGTGAGGGG + Intronic
1022225749 7:28361281-28361303 AGGACTGCAAATATGTAGGAAGG - Intronic
1022464858 7:30646822-30646844 AAGTCTGCAATGAAGGGGGAGGG + Intergenic
1022514927 7:30969438-30969460 CTGGCTGCAAGGGTGGAGGAGGG + Intronic
1022792201 7:33700165-33700187 AGGTCAGGAAAGATGGAGGAAGG - Intergenic
1025832973 7:65070288-65070310 ATGTGTGCAAAGAGAGAAGAGGG - Intergenic
1025902739 7:65759802-65759824 ATGTGTGCAAAGAGAGAAGAGGG - Intergenic
1028016176 7:85716359-85716381 ATGTTTGCAAAGATAGTTGAAGG + Intergenic
1028032657 7:85935549-85935571 CTGACTTCAAAGATGGAAGAAGG - Intergenic
1028818221 7:95174369-95174391 TTGTCTGCAAACAAGAAGGAAGG + Intronic
1028953585 7:96664430-96664452 CTGTCTTTGAAGATGGAGGAGGG - Intronic
1029932333 7:104385472-104385494 AAGTCTGCAAAGCTGAAGGCTGG + Intronic
1030311071 7:108069716-108069738 ATGTCTGCCAAGCTGCATGATGG - Exonic
1030519211 7:110576525-110576547 AGGTATGCAAAGATTGAGGAGGG - Intergenic
1031936600 7:127741618-127741640 ATGTTAGCAAAGAGTGAGGAAGG - Intronic
1032263989 7:130357713-130357735 ATGCCTGCTAAGATAGAAGAAGG - Intronic
1033781470 7:144675326-144675348 ATGACTGCAAAGCGGGAGGTAGG + Intronic
1033858922 7:145600369-145600391 ATGGCTTTGAAGATGGAGGAAGG + Intergenic
1034150070 7:148908385-148908407 ATGTCTCCAAAGAGGTAGGCTGG + Intergenic
1034969625 7:155410943-155410965 CTGCCTGTGAAGATGGAGGAAGG - Intergenic
1036493113 8:9246014-9246036 CTGGCTGTGAAGATGGAGGAAGG - Intergenic
1036777486 8:11623620-11623642 ATGTCTGTGATGATGGAGGCAGG - Intergenic
1037141237 8:15522658-15522680 ATTTCTGTAGAGATGGAGTAGGG - Intronic
1037150466 8:15628918-15628940 ATGGTTGCAAAGTTGGATGAGGG + Intronic
1037234932 8:16708648-16708670 ATGGCAGCAAAGATGGATGAGGG + Intergenic
1037500507 8:19481148-19481170 GTGACTGGAAAGATGAAGGATGG - Intronic
1037644375 8:20777567-20777589 TTGGCTTCAAAAATGGAGGAAGG + Intergenic
1037995446 8:23349038-23349060 AGGTCTGCAAAGCTAGAGGCAGG - Intronic
1038030855 8:23638024-23638046 CTGGCTTTAAAGATGGAGGAAGG + Intergenic
1038136989 8:24796969-24796991 ATGTTTGCAGAGATGGAGTGTGG - Intergenic
1039170273 8:34737488-34737510 ATGTTTGCAAAGATGGATTGAGG - Intergenic
1039719606 8:40149241-40149263 TTGTCTTTGAAGATGGAGGAAGG - Intergenic
1041790150 8:61686336-61686358 ATGTCTGCAATGTTGGTAGAGGG + Intronic
1042125197 8:65531218-65531240 ATGTCAGAATAGATAGAGGAGGG - Intergenic
1044270004 8:90230699-90230721 ATGTGTGCAAAAGTGTAGGAGGG - Intergenic
1044774342 8:95672398-95672420 ATGTCTGTAAAAATGCAAGAAGG - Intergenic
1044879442 8:96708097-96708119 ATGGCTTGGAAGATGGAGGAAGG - Intronic
1045043318 8:98248298-98248320 ATGCCTCCAAAGATGGCTGATGG - Intronic
1045425159 8:102058911-102058933 CTGTCTTTGAAGATGGAGGAGGG + Intronic
1045475492 8:102548978-102549000 ATGTCAGCAAAGATTGAAGCAGG - Intergenic
1045750854 8:105482556-105482578 ATGTCTGCTAAGTTGGTAGAGGG - Intronic
1046111606 8:109732317-109732339 ATGTCTGCCAAGAGGCAGGCAGG + Intergenic
1046903498 8:119547109-119547131 CTGTCTTCCAAGAAGGAGGAAGG - Intergenic
1047451264 8:124967027-124967049 ATGTCTGAAAAGATGGGGTGGGG - Intergenic
1047590511 8:126321981-126322003 AAGCCTGGAAAGATGGTGGAAGG - Intergenic
1047756432 8:127922567-127922589 ATGAATGCAAGGATGGAGGTAGG - Intergenic
1048054789 8:130853051-130853073 ATCTCTCCAAGGAAGGAGGAAGG + Intronic
1048648411 8:136448209-136448231 CTGTCTGCAAATAAGGAAGAGGG - Intergenic
1048687517 8:136920267-136920289 TTGTCTTTGAAGATGGAGGAAGG + Intergenic
1049359831 8:142207190-142207212 ATGGATGCATAGATGGGGGATGG + Intergenic
1049474756 8:142791674-142791696 ATGACTGGATGGATGGAGGATGG - Intergenic
1049474813 8:142791975-142791997 ATGACTGGATGGATGGAGGATGG - Intergenic
1050118238 9:2282313-2282335 TTTTCTACAAAGTTGGAGGAAGG + Intergenic
1051741747 9:20259084-20259106 CTGGCTTCCAAGATGGAGGAAGG + Intergenic
1052016930 9:23479612-23479634 ATGGCTTTGAAGATGGAGGAAGG - Intergenic
1052224053 9:26062626-26062648 ATGTGCACAAAGATGGAAGAGGG + Intergenic
1052943842 9:34151495-34151517 ATGTCTGCAGATAAGGAGGTGGG - Intergenic
1053106829 9:35416608-35416630 GTGTCTGCAATGGTGGATGAGGG - Intergenic
1053594810 9:39548973-39548995 CTGACTGTGAAGATGGAGGAAGG + Intergenic
1053852595 9:42304006-42304028 CTGACTGTGAAGATGGAGGAAGG + Intergenic
1054454367 9:65422002-65422024 ATGTATGCATGGATGGATGATGG + Intergenic
1054571443 9:66815994-66816016 CTGACTGTGAAGATGGAGGAAGG - Intergenic
1054907426 9:70423075-70423097 ATGTCTGCATACAAGGAAGATGG - Intergenic
1054931596 9:70641050-70641072 ATGTCTGGAAGGATGGGGGTGGG - Intronic
1054955447 9:70904485-70904507 AAGAGTGCAAAGAAGGAGGAGGG + Intronic
1055673905 9:78635389-78635411 ATGTCTTCAAAGAAGGTGGGAGG + Intergenic
1057806338 9:98222434-98222456 ATGCCTGCAAAGCTGGTGGAAGG + Intronic
1057907959 9:98996976-98996998 ATGTCTTCAAAGGGGGAGGATGG - Exonic
1058595627 9:106612368-106612390 GAGCCTGCAAAGATGGAGAATGG - Intergenic
1058836183 9:108860266-108860288 GAGTCTTCCAAGATGGAGGAAGG + Intergenic
1059740791 9:117147566-117147588 ATGTCTGAAAAAATTGAAGAGGG - Intronic
1059768638 9:117407354-117407376 TTGTCTGCAAGTACGGAGGATGG + Intronic
1060827031 9:126693423-126693445 ATGTGCGGAGAGATGGAGGATGG - Intronic
1061036808 9:128118768-128118790 AGGGATGCAGAGATGGAGGATGG + Intergenic
1061090638 9:128424126-128424148 GTGTCTGCAAACTTTGAGGAGGG - Exonic
1061244988 9:129397005-129397027 ATGGATGGAAGGATGGAGGATGG + Intergenic
1061906680 9:133702713-133702735 ATCTCGGCACAGAGGGAGGAGGG + Intronic
1062274546 9:135724499-135724521 ATGCCTGCATACGTGGAGGAAGG - Intronic
1185540167 X:897020-897042 CTGGCTTCGAAGATGGAGGAAGG - Intergenic
1186437649 X:9556871-9556893 CTGGCTTTAAAGATGGAGGAAGG - Intronic
1186611539 X:11142720-11142742 TTGGCTTAAAAGATGGAGGAAGG + Intronic
1187468232 X:19544576-19544598 AGGTCCGCAAGGATGCAGGATGG - Intronic
1187470049 X:19561566-19561588 ACATCTGCAAAGATGGAAGGTGG - Intronic
1187716776 X:22110601-22110623 ATGGCTGCATAGAGGGAGGGGGG - Intronic
1189097672 X:38157435-38157457 CTGTCTTTGAAGATGGAGGAAGG - Intronic
1189378079 X:40481213-40481235 ATTTGTGGGAAGATGGAGGAAGG - Intergenic
1190551184 X:51582704-51582726 TTGACTGCAATGATGGGGGAGGG - Intergenic
1190576380 X:51843462-51843484 ATGGCTTTGAAGATGGAGGAAGG + Intronic
1190834912 X:54091697-54091719 ATGACTGTAAAGATGAAAGATGG + Intronic
1191801942 X:65091243-65091265 ATGGCTTTGAAGATGGAGGAAGG + Intergenic
1191936695 X:66434633-66434655 ATGACTGAGAAGGTGGAGGAGGG + Intergenic
1192577134 X:72252046-72252068 ATGTCTGCAAACCAGGAAGAGGG - Intronic
1194131221 X:90084515-90084537 AGGTATGCAAGGATGGAAGAGGG - Intergenic
1194516460 X:94861588-94861610 ATGTTTGATAAGATGGATGAGGG - Intergenic
1195785988 X:108523621-108523643 ATTTCTGCAAAGAGGGCGGTTGG + Intronic
1196745616 X:119069586-119069608 CTGGCTTTAAAGATGGAGGAAGG - Intergenic
1196800793 X:119541549-119541571 ATTACTGAAAAGATGGAGAATGG - Intronic
1197467511 X:126822182-126822204 AAGTCAGGAAAGAAGGAGGAGGG + Intergenic
1198057336 X:133008057-133008079 CTGGCTTCAAATATGGAGGATGG - Intergenic
1198485710 X:137085552-137085574 AAGTCTCCAAAACTGGAGGAAGG - Intergenic
1199030793 X:142996814-142996836 ATGTCTATAAAGATAGAGGAGGG + Intergenic
1199065886 X:143417820-143417842 GTGTCTGCAATGGTGGATGAGGG + Intergenic
1199829916 X:151539099-151539121 GTGTCAGCCAAGATGGAAGATGG + Intergenic
1200291330 X:154877406-154877428 CTGGCTTCGAAGATGGAGGAAGG + Intronic