ID: 981640070 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 4:146931975-146931997 |
| Sequence | AAGAAAAAGCAGAAAGAAGA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 5697 | |||
| Summary | {0: 1, 1: 4, 2: 60, 3: 666, 4: 4966} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 981640070_981640074 | 30 | Left | 981640070 | 4:146931975-146931997 | CCTTCTTCTTTCTGCTTTTTCTT | 0: 1 1: 4 2: 60 3: 666 4: 4966 |
||
| Right | 981640074 | 4:146932028-146932050 | CTTCCTTTTCCTTTAAATCATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 981640070 | Original CRISPR | AAGAAAAAGCAGAAAGAAGA AGG (reversed) | Intronic | ||
| Too many off-targets to display for this crispr | |||||