ID: 981640070

View in Genome Browser
Species Human (GRCh38)
Location 4:146931975-146931997
Sequence AAGAAAAAGCAGAAAGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 5697
Summary {0: 1, 1: 4, 2: 60, 3: 666, 4: 4966}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981640070_981640074 30 Left 981640070 4:146931975-146931997 CCTTCTTCTTTCTGCTTTTTCTT 0: 1
1: 4
2: 60
3: 666
4: 4966
Right 981640074 4:146932028-146932050 CTTCCTTTTCCTTTAAATCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981640070 Original CRISPR AAGAAAAAGCAGAAAGAAGA AGG (reversed) Intronic
Too many off-targets to display for this crispr