ID: 981642159

View in Genome Browser
Species Human (GRCh38)
Location 4:146957204-146957226
Sequence GGTAGAGCCTAGTCCTCCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981642153_981642159 30 Left 981642153 4:146957151-146957173 CCTAAATTCTCTTCAACATTTAT No data
Right 981642159 4:146957204-146957226 GGTAGAGCCTAGTCCTCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981642159 Original CRISPR GGTAGAGCCTAGTCCTCCTG GGG Intergenic
No off target data available for this crispr