ID: 981648722

View in Genome Browser
Species Human (GRCh38)
Location 4:147030415-147030437
Sequence TAGTATGTTATATCACCTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981648719_981648722 9 Left 981648719 4:147030383-147030405 CCTCTAAGGGTCTCACCTCACCA No data
Right 981648722 4:147030415-147030437 TAGTATGTTATATCACCTAAAGG No data
981648720_981648722 -6 Left 981648720 4:147030398-147030420 CCTCACCATGTGTAATATAGTAT No data
Right 981648722 4:147030415-147030437 TAGTATGTTATATCACCTAAAGG No data
981648718_981648722 10 Left 981648718 4:147030382-147030404 CCCTCTAAGGGTCTCACCTCACC No data
Right 981648722 4:147030415-147030437 TAGTATGTTATATCACCTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981648722 Original CRISPR TAGTATGTTATATCACCTAA AGG Intergenic
No off target data available for this crispr