ID: 981652993

View in Genome Browser
Species Human (GRCh38)
Location 4:147080020-147080042
Sequence GCACCTCACCAGCAGCTGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981652992_981652993 8 Left 981652992 4:147079989-147080011 CCTTAAAACAATTGTAGAAATTA No data
Right 981652993 4:147080020-147080042 GCACCTCACCAGCAGCTGACAGG No data
981652991_981652993 26 Left 981652991 4:147079971-147079993 CCAGGTGGAAATTTTTCTCCTTA No data
Right 981652993 4:147080020-147080042 GCACCTCACCAGCAGCTGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981652993 Original CRISPR GCACCTCACCAGCAGCTGAC AGG Intergenic
No off target data available for this crispr