ID: 981653434

View in Genome Browser
Species Human (GRCh38)
Location 4:147085087-147085109
Sequence CCAGAAGTATGCTTGGAAAT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981653434_981653437 -1 Left 981653434 4:147085087-147085109 CCGATTTCCAAGCATACTTCTGG No data
Right 981653437 4:147085109-147085131 GTTCCATGAGCTTGACTCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981653434 Original CRISPR CCAGAAGTATGCTTGGAAAT CGG (reversed) Intergenic
No off target data available for this crispr