ID: 981658288

View in Genome Browser
Species Human (GRCh38)
Location 4:147137181-147137203
Sequence CAGTGGGGATGGAGAGAACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981658288_981658298 16 Left 981658288 4:147137181-147137203 CCTAGTTCTCTCCATCCCCACTG No data
Right 981658298 4:147137220-147137242 AGTCACTACCCTCTCTTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981658288 Original CRISPR CAGTGGGGATGGAGAGAACT AGG (reversed) Intergenic
No off target data available for this crispr