ID: 981658298

View in Genome Browser
Species Human (GRCh38)
Location 4:147137220-147137242
Sequence AGTCACTACCCTCTCTTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981658294_981658298 -10 Left 981658294 4:147137207-147137229 CCATCCTGATCCCAGTCACTACC No data
Right 981658298 4:147137220-147137242 AGTCACTACCCTCTCTTGCCTGG No data
981658291_981658298 1 Left 981658291 4:147137196-147137218 CCCCACTGTGGCCATCCTGATCC No data
Right 981658298 4:147137220-147137242 AGTCACTACCCTCTCTTGCCTGG No data
981658287_981658298 25 Left 981658287 4:147137172-147137194 CCTCATTTGCCTAGTTCTCTCCA No data
Right 981658298 4:147137220-147137242 AGTCACTACCCTCTCTTGCCTGG No data
981658288_981658298 16 Left 981658288 4:147137181-147137203 CCTAGTTCTCTCCATCCCCACTG No data
Right 981658298 4:147137220-147137242 AGTCACTACCCTCTCTTGCCTGG No data
981658292_981658298 0 Left 981658292 4:147137197-147137219 CCCACTGTGGCCATCCTGATCCC No data
Right 981658298 4:147137220-147137242 AGTCACTACCCTCTCTTGCCTGG No data
981658286_981658298 26 Left 981658286 4:147137171-147137193 CCCTCATTTGCCTAGTTCTCTCC No data
Right 981658298 4:147137220-147137242 AGTCACTACCCTCTCTTGCCTGG No data
981658293_981658298 -1 Left 981658293 4:147137198-147137220 CCACTGTGGCCATCCTGATCCCA No data
Right 981658298 4:147137220-147137242 AGTCACTACCCTCTCTTGCCTGG No data
981658290_981658298 5 Left 981658290 4:147137192-147137214 CCATCCCCACTGTGGCCATCCTG No data
Right 981658298 4:147137220-147137242 AGTCACTACCCTCTCTTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981658298 Original CRISPR AGTCACTACCCTCTCTTGCC TGG Intergenic
No off target data available for this crispr