ID: 981658417

View in Genome Browser
Species Human (GRCh38)
Location 4:147138394-147138416
Sequence CTGGGGAGAAGATGTCCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981658409_981658417 28 Left 981658409 4:147138343-147138365 CCAGGATTAACAACGGAAAGCAT No data
Right 981658417 4:147138394-147138416 CTGGGGAGAAGATGTCCCCAGGG No data
981658412_981658417 3 Left 981658412 4:147138368-147138390 CCAGAATGGAATGTGAGGTTTGA No data
Right 981658417 4:147138394-147138416 CTGGGGAGAAGATGTCCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981658417 Original CRISPR CTGGGGAGAAGATGTCCCCA GGG Intergenic
No off target data available for this crispr