ID: 981659407

View in Genome Browser
Species Human (GRCh38)
Location 4:147148236-147148258
Sequence CACACCTAACACTCACATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981659407_981659409 20 Left 981659407 4:147148236-147148258 CCAAGATGTGAGTGTTAGGTGTG No data
Right 981659409 4:147148279-147148301 ACTGCTCCCACCTCTCTCAGTGG No data
981659407_981659408 -9 Left 981659407 4:147148236-147148258 CCAAGATGTGAGTGTTAGGTGTG No data
Right 981659408 4:147148250-147148272 TTAGGTGTGTTCATTGCTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981659407 Original CRISPR CACACCTAACACTCACATCT TGG (reversed) Intergenic
No off target data available for this crispr