ID: 981663427

View in Genome Browser
Species Human (GRCh38)
Location 4:147194499-147194521
Sequence TCTTATTTGCTGAACGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981663427_981663430 14 Left 981663427 4:147194499-147194521 CCATCCACGTTCAGCAAATAAGA No data
Right 981663430 4:147194536-147194558 CATTGAAAAAGAGAGAGGAAAGG No data
981663427_981663431 15 Left 981663427 4:147194499-147194521 CCATCCACGTTCAGCAAATAAGA No data
Right 981663431 4:147194537-147194559 ATTGAAAAAGAGAGAGGAAAGGG No data
981663427_981663429 9 Left 981663427 4:147194499-147194521 CCATCCACGTTCAGCAAATAAGA No data
Right 981663429 4:147194531-147194553 AAAAACATTGAAAAAGAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981663427 Original CRISPR TCTTATTTGCTGAACGTGGA TGG (reversed) Intergenic
No off target data available for this crispr