ID: 981663431

View in Genome Browser
Species Human (GRCh38)
Location 4:147194537-147194559
Sequence ATTGAAAAAGAGAGAGGAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981663427_981663431 15 Left 981663427 4:147194499-147194521 CCATCCACGTTCAGCAAATAAGA No data
Right 981663431 4:147194537-147194559 ATTGAAAAAGAGAGAGGAAAGGG No data
981663428_981663431 11 Left 981663428 4:147194503-147194525 CCACGTTCAGCAAATAAGACTTG No data
Right 981663431 4:147194537-147194559 ATTGAAAAAGAGAGAGGAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981663431 Original CRISPR ATTGAAAAAGAGAGAGGAAA GGG Intergenic
No off target data available for this crispr