ID: 981667712

View in Genome Browser
Species Human (GRCh38)
Location 4:147248336-147248358
Sequence AGCAAACAGAAGTGGATGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981667712_981667716 1 Left 981667712 4:147248336-147248358 CCCTCCATCCACTTCTGTTTGCT No data
Right 981667716 4:147248360-147248382 TCACTGCCACCAGCCTCATGTGG No data
981667712_981667719 8 Left 981667712 4:147248336-147248358 CCCTCCATCCACTTCTGTTTGCT No data
Right 981667719 4:147248367-147248389 CACCAGCCTCATGTGGGCTACGG No data
981667712_981667717 2 Left 981667712 4:147248336-147248358 CCCTCCATCCACTTCTGTTTGCT No data
Right 981667717 4:147248361-147248383 CACTGCCACCAGCCTCATGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981667712 Original CRISPR AGCAAACAGAAGTGGATGGA GGG (reversed) Intergenic
No off target data available for this crispr