ID: 981670122

View in Genome Browser
Species Human (GRCh38)
Location 4:147277148-147277170
Sequence TATACCACATACAACCTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981670122_981670127 15 Left 981670122 4:147277148-147277170 CCTCCCAGGTTGTATGTGGTATA No data
Right 981670127 4:147277186-147277208 TTCAAAATATTCCCACCCAAGGG No data
981670122_981670128 16 Left 981670122 4:147277148-147277170 CCTCCCAGGTTGTATGTGGTATA No data
Right 981670128 4:147277187-147277209 TCAAAATATTCCCACCCAAGGGG No data
981670122_981670129 21 Left 981670122 4:147277148-147277170 CCTCCCAGGTTGTATGTGGTATA No data
Right 981670129 4:147277192-147277214 ATATTCCCACCCAAGGGGAAAGG No data
981670122_981670126 14 Left 981670122 4:147277148-147277170 CCTCCCAGGTTGTATGTGGTATA No data
Right 981670126 4:147277185-147277207 TTTCAAAATATTCCCACCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981670122 Original CRISPR TATACCACATACAACCTGGG AGG (reversed) Intergenic
No off target data available for this crispr