ID: 981678909

View in Genome Browser
Species Human (GRCh38)
Location 4:147371859-147371881
Sequence CAGAACAGGAAGAAGCAGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981678909_981678915 26 Left 981678909 4:147371859-147371881 CCTAACTGCTTCTTCCTGTTCTG No data
Right 981678915 4:147371908-147371930 TTGAATCATCATGTCCCTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981678909 Original CRISPR CAGAACAGGAAGAAGCAGTT AGG (reversed) Intergenic
No off target data available for this crispr