ID: 981679695

View in Genome Browser
Species Human (GRCh38)
Location 4:147382192-147382214
Sequence CCGTCTACAGAGATGGAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981679692_981679695 -1 Left 981679692 4:147382170-147382192 CCTAGCATTTTCTATAGTCACAC No data
Right 981679695 4:147382192-147382214 CCGTCTACAGAGATGGAGAAAGG No data
981679690_981679695 4 Left 981679690 4:147382165-147382187 CCCTACCTAGCATTTTCTATAGT No data
Right 981679695 4:147382192-147382214 CCGTCTACAGAGATGGAGAAAGG No data
981679689_981679695 12 Left 981679689 4:147382157-147382179 CCAAAAGACCCTACCTAGCATTT No data
Right 981679695 4:147382192-147382214 CCGTCTACAGAGATGGAGAAAGG No data
981679691_981679695 3 Left 981679691 4:147382166-147382188 CCTACCTAGCATTTTCTATAGTC No data
Right 981679695 4:147382192-147382214 CCGTCTACAGAGATGGAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981679695 Original CRISPR CCGTCTACAGAGATGGAGAA AGG Intergenic
No off target data available for this crispr