ID: 981693290

View in Genome Browser
Species Human (GRCh38)
Location 4:147532751-147532773
Sequence CTCAAGATGGTGAAGTCTAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 129}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981693290_981693292 9 Left 981693290 4:147532751-147532773 CCGTTAGACTTCACCATCTTGAG 0: 1
1: 0
2: 0
3: 13
4: 129
Right 981693292 4:147532783-147532805 CATCGCCACAATGTCAAGTGTGG 0: 1
1: 0
2: 0
3: 0
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981693290 Original CRISPR CTCAAGATGGTGAAGTCTAA CGG (reversed) Intronic
902516731 1:16993633-16993655 TTGAAGATGGTGGAGTCTACTGG - Exonic
908537790 1:65094228-65094250 TTCTAGATGGTGAAGGATAAGGG + Intergenic
908887613 1:68808150-68808172 ATCAAGATGCAGAATTCTAAAGG + Intergenic
910091828 1:83473559-83473581 CTCAGGATGGTGAAGTGGAGTGG - Intergenic
914425242 1:147570016-147570038 ATCTTGATGGTGATGTCTAACGG + Intronic
918457128 1:184732739-184732761 CTCAAGCTGGTGAAGAACAATGG + Intronic
919068642 1:192726245-192726267 CTGAAGATGCTGAAGCTTAAAGG - Intergenic
920516624 1:206589294-206589316 CGTAAGATGGTGAAGTTCAAGGG - Intronic
923368763 1:233289410-233289432 GCCAAGATCGTGAAGCCTAATGG - Intronic
924081703 1:240405667-240405689 CTCAAGATGGACAATCCTAATGG - Intronic
1063143317 10:3274869-3274891 CTCAAGTTGATCAAGTCTAATGG + Intergenic
1063817702 10:9795140-9795162 CTCAAGAAGTTGATCTCTAAAGG + Intergenic
1064645666 10:17456161-17456183 CCCAAGATGGTGGAATCCAAGGG - Intergenic
1068344121 10:55748851-55748873 CAGAAGATGGTTAAGTATAAGGG - Intergenic
1070093338 10:73311384-73311406 ATTAGGATGGGGAAGTCTAAGGG - Intronic
1081195907 11:40160385-40160407 CTAAAGATGGTTAAATATAAGGG + Intronic
1081441327 11:43084872-43084894 CACAGGATGGTGAAGCCTCAGGG + Intergenic
1082666060 11:55977532-55977554 CTCATGAAGGTGGAGTATAAAGG - Intergenic
1082781491 11:57291305-57291327 TTCAAGATGGTGTAGACAAAGGG + Intergenic
1088023100 11:105143753-105143775 CTCAAGATAATGAAGTCAAGGGG + Intergenic
1089504988 11:118956876-118956898 CTTGAGATGTTGAAGTCTGATGG - Exonic
1093827158 12:23707382-23707404 CTCAGGATGGCCAAGACTAAGGG - Intronic
1094520234 12:31179188-31179210 CTCAGGATGGTTAATTCTATGGG - Intergenic
1099028786 12:77498948-77498970 TTCAAGATGGTGAAGCAAAAGGG - Intergenic
1099543763 12:83950320-83950342 CTCAAGAAGATGAAGGCAAATGG + Intergenic
1100245769 12:92755236-92755258 TTAAAGATGGTGAATTCTGAAGG + Intronic
1100449859 12:94695597-94695619 CTCAACTAGGTAAAGTCTAAAGG - Intergenic
1101326218 12:103718047-103718069 CTCAATATGGTGCAGCCAAAGGG - Intronic
1101347603 12:103900956-103900978 CTCAAGTTGGTGATGTGGAATGG - Intergenic
1101940391 12:109095527-109095549 GACAAGAAGCTGAAGTCTAAGGG - Intergenic
1106484770 13:30162350-30162372 CTCAAGAAGCTGAAGTCTGTTGG + Intergenic
1106484955 13:30163795-30163817 CTCAAGAAGCTGAAGTCTGTTGG + Intergenic
1106526236 13:30543445-30543467 CTCAAGATGGTGACCTCTCTGGG - Intronic
1110255095 13:73425122-73425144 ATCAAGATGGGGAAGACTAGAGG - Intergenic
1110470850 13:75858169-75858191 CTCAAGATGCTGAATTCAACAGG - Exonic
1113884198 13:113649369-113649391 CTCAAGATTGAGAAGTGAAACGG - Exonic
1118589027 14:67387095-67387117 GTCAAGATGCTGACGCCTAATGG + Exonic
1119919287 14:78431324-78431346 CTCAAGAAGCTTAAATCTAATGG + Intronic
1124714188 15:32043829-32043851 CTCAAGAAAGAGAAGTCTAAAGG - Intronic
1124894723 15:33765726-33765748 CCCAAGATGGTGATATTTAATGG - Intronic
1125461030 15:39906938-39906960 CTCAAGGTGCTGCATTCTAATGG + Intronic
1127114580 15:55712257-55712279 GTCAAGATGGTGAAATGAAATGG + Intronic
1131443460 15:92476272-92476294 CTCAGGAAGCTCAAGTCTAAGGG + Intronic
1140880414 16:79193114-79193136 CACAAGAGAATGAAGTCTAATGG - Intronic
1143924128 17:10354738-10354760 CTCACGAAGGGGAAGTCGAAGGG + Exonic
1144836265 17:18158180-18158202 CGCCAGTTGGTGAAGTCTACTGG + Intronic
1149851757 17:60040878-60040900 CTCATAATGCTGTAGTCTAATGG + Intergenic
1150500327 17:65644323-65644345 GCCAAGATGGTGAAGCCCAATGG + Intronic
1150934873 17:69624283-69624305 ATAAAGATGATGAGGTCTAAGGG + Intergenic
1152089142 17:78237372-78237394 CTCAAGCTGGGAAACTCTAAAGG - Intronic
1158684706 18:59602831-59602853 CTAAAGATGGCGCAGCCTAATGG + Intronic
1163424621 19:17234745-17234767 CTCAAGAGGCTGAAGTGTGAGGG + Intronic
1167066493 19:47190132-47190154 CTCAGGATGCTGAAGTCTGGGGG - Intronic
928236878 2:29550298-29550320 CTCAAGATGGTGTAGACTGAGGG + Intronic
930573543 2:53117000-53117022 ATCAAGAGTGTGAAGTCTACGGG + Intergenic
939702749 2:145414044-145414066 CTCAAGATTATTAAGTCTATTGG - Intergenic
939839346 2:147168582-147168604 CTCTATGTTGTGAAGTCTAATGG + Intergenic
942015257 2:171806868-171806890 CTCAGGATGATGAAGACTCAGGG + Intronic
942129782 2:172866673-172866695 CCCAAAATGGTGCAGTCTGAGGG + Intronic
942833498 2:180264588-180264610 CTGAAGGTGGTCAAGTCCAATGG - Intergenic
943385283 2:187196089-187196111 TCCAAGATGGTGATGTCAAAAGG + Intergenic
1170896156 20:20416323-20416345 CTCATGAGGGTGTAGCCTAAAGG - Intronic
1177474483 21:21602027-21602049 CTCAAGTGAGTAAAGTCTAAAGG + Intergenic
1177732661 21:25048430-25048452 CTCAACATGGTTAAGCCTAGTGG + Intergenic
949219292 3:1610412-1610434 CTCAACATAGTGAAATCAAATGG - Intergenic
949288199 3:2430958-2430980 CACAAGATGATCAAGTCTAAAGG - Intronic
950495636 3:13332777-13332799 CTCATGTTTGTGTAGTCTAATGG + Intronic
950898623 3:16476190-16476212 CTCAAGATGGAGAAGGCAGAGGG + Intronic
955905833 3:63806748-63806770 CTGAAGAAAGTGATGTCTAAGGG - Intergenic
956246874 3:67193239-67193261 CACAAGATGTTAAAGACTAATGG + Intergenic
956483942 3:69701533-69701555 ATAAAGATAGTGAAGTATAATGG + Intergenic
958005761 3:87809701-87809723 CATAAGATGGTTAAGTCCAATGG - Intergenic
959245493 3:103862711-103862733 CTCAAGATGGTGCAGGGCAATGG - Intergenic
959340536 3:105124421-105124443 CTCAAGTGGGTGAAGTCATATGG + Intergenic
959611363 3:108298500-108298522 CTGAAGATGGTGCAGTAAAAGGG - Intronic
960485802 3:118251480-118251502 CTCAAGATGGTGAAGCCAGCTGG + Intergenic
960856103 3:122103728-122103750 CTGAAGATTGTGAAGTCTCAGGG - Exonic
960938928 3:122921107-122921129 CTCAAGATTGGGAAGACAAATGG - Intronic
961259644 3:125591217-125591239 CTCAAGATTGTAAAGACTAGAGG - Intronic
963016031 3:140824745-140824767 CACTAGATGGTAAACTCTAAAGG + Intergenic
965190622 3:165523556-165523578 CTCAAGAAGGAGAAGTCAGAGGG - Intergenic
969122567 4:4920821-4920843 CTCAAGGTGTTGAAGGCTGAGGG - Intergenic
971488612 4:27187945-27187967 CTCAAGATGTTTATGGCTAAGGG - Intergenic
971682643 4:29720895-29720917 CTCAAGATGGAAAGGTCAAAAGG - Intergenic
973291265 4:48473152-48473174 CTCAGGATGGTGAAATCCTAGGG - Intergenic
973960624 4:56106256-56106278 CTCATGCAGGGGAAGTCTAAAGG - Intergenic
974207620 4:58726657-58726679 CTTAAGAGGGTGAAGCCTGAAGG - Intergenic
974492675 4:62587851-62587873 CTCATGATAGTGAATTCTCATGG - Intergenic
976572227 4:86625634-86625656 CTCATGGTCCTGAAGTCTAAAGG + Intronic
978765104 4:112397105-112397127 ATGAAAATGTTGAAGTCTAAAGG + Intronic
979038934 4:115762412-115762434 CTAAAAAAGGTGAAGTCAAATGG + Intergenic
981693290 4:147532751-147532773 CTCAAGATGGTGAAGTCTAACGG - Intronic
983868644 4:172798381-172798403 CTCATGATGGTGAGATCTCATGG + Intronic
984132514 4:175896181-175896203 TTCAGGATGATGAAGTCTCAGGG + Intronic
984429579 4:179631260-179631282 CTCAAGATGGAAAAGTAAAATGG - Intergenic
987762886 5:22188304-22188326 CACAACATGGTGAAGGCCAAAGG - Intronic
989545622 5:42669443-42669465 CTGAAGCTAATGAAGTCTAAGGG - Intronic
990450791 5:55929991-55930013 CTCATCAGGGTGAAGTCTGAAGG - Intergenic
991533232 5:67638063-67638085 TTCAAGATGGTGCAGTTTAATGG - Intergenic
991897673 5:71421702-71421724 CACAACATGGTGAAGGCCAAAGG - Intergenic
992459016 5:76943118-76943140 CTCATGATGGTGCAGTCAGATGG + Intergenic
994069439 5:95583123-95583145 CAGAAGATGGTGAAGGGTAAGGG - Exonic
994626504 5:102226608-102226630 CCCAATATGTTGAAGTGTAAAGG - Intergenic
995750414 5:115448231-115448253 ATCAAGATGATGAAGTCAGAGGG - Intergenic
999658034 5:153829771-153829793 TTCAAGATAGTGAAGTGTTACGG - Intergenic
999816484 5:155181995-155182017 CTCAATATGGTTAAATCAAAAGG - Intergenic
1000311887 5:160052892-160052914 CTTAAGTTGGTTAAGTCTAATGG - Intronic
1001845529 5:174917892-174917914 ATCAGGATGGTGAAGCCAAAAGG - Intergenic
1007852943 6:44823218-44823240 CTTAATCTGGTGCAGTCTAAAGG + Intronic
1008366647 6:50688567-50688589 CTCCAGATGATGGAGTCTATTGG - Intergenic
1008658803 6:53644330-53644352 CTGAAGATGGTGAGGTGTAATGG - Intergenic
1009629815 6:66181457-66181479 GTGAAGATGGTGAAGTCTCCTGG - Intergenic
1011906373 6:92374128-92374150 CTAAAGATGATAAAGTCTAAGGG + Intergenic
1012588805 6:100953820-100953842 CACAAAATGGTGAAGACCAATGG - Intergenic
1013933806 6:115569367-115569389 CTTAAGATAGTGCAATCTAATGG - Intergenic
1014592340 6:123289760-123289782 CTCAAGATGGGTAACTCTGAGGG - Intronic
1016289216 6:142509606-142509628 GTCATGATGGTGAAGTAAAAAGG - Intergenic
1016979040 6:149837511-149837533 CTCAAGATGGGGATGACAAAGGG + Intronic
1017852726 6:158319044-158319066 CTCACGATTGTTAAATCTAAGGG + Intronic
1018524589 6:164694719-164694741 CAGAAGATGGTGCAGTCTCATGG - Intergenic
1020535525 7:9391449-9391471 CTCTAGATGTTTACGTCTAAGGG + Intergenic
1021040985 7:15862075-15862097 TTCAAGATGATGAAGTTTAATGG + Intergenic
1022725966 7:32981968-32981990 ATAAAGATGGTTAACTCTAAGGG - Intronic
1024345682 7:48310742-48310764 CTAAAGATGATGAAGTCTGCAGG + Intronic
1025047632 7:55705685-55705707 ATAAAGATGGTTAACTCTAAGGG + Intergenic
1027308685 7:76930047-76930069 CTCAGGATGGTGAAGTGGAGTGG - Intergenic
1027805832 7:82821132-82821154 CTCAGGAAGGTGATGTCTGATGG - Intronic
1030872587 7:114775230-114775252 CTAAAGATGGTGAAGCAGAAAGG + Intergenic
1031692359 7:124804694-124804716 CTGAAGACAGTGAAGTATAATGG - Intergenic
1033321939 7:140347472-140347494 CAGAATATGGTGAGGTCTAACGG + Intronic
1036447315 8:8833125-8833147 GTCACGATGGTGAATTCTCATGG - Intronic
1037528070 8:19747144-19747166 CTCAAGATGATGAATTTTACTGG - Intronic
1037745906 8:21643918-21643940 CTCAAGATAGAGAAGCCAAAAGG + Intergenic
1038125782 8:24671372-24671394 CTCAACATGGTGCAGTCTCAGGG - Intergenic
1038692425 8:29775330-29775352 CTCAAGATGGGAAAGTCAAAGGG + Intergenic
1048188928 8:132270784-132270806 ATCAAAACGGTGCAGTCTAAGGG - Intronic
1053148135 9:35725782-35725804 CCCCAGATGGTGGAGTCCAAGGG + Intronic
1059353858 9:113684888-113684910 CTCAAGAGGGTGAAGTGGGAGGG - Intergenic
1060424851 9:123495571-123495593 CTCAAGATGTAGAAGTATCATGG - Intronic
1185833902 X:3327838-3327860 CTCAAGATTGTAAAGTATTAAGG - Intronic
1186622466 X:11256075-11256097 TTTAAGATGGTGAAGTCTTATGG - Intronic
1188661390 X:32763290-32763312 CTCAGGATCTTGAAGTCTATTGG + Intronic
1198331951 X:135630401-135630423 CTCAAGACGGAGGAGGCTAAGGG - Intergenic