ID: 981702296

View in Genome Browser
Species Human (GRCh38)
Location 4:147619934-147619956
Sequence CAGATCATGTTGGACCTTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 741
Summary {0: 1, 1: 1, 2: 9, 3: 70, 4: 660}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981702296_981702306 27 Left 981702296 4:147619934-147619956 CCATCAAGGTCCAACATGATCTG 0: 1
1: 1
2: 9
3: 70
4: 660
Right 981702306 4:147619984-147620006 ACTTTTTCTCCTCAAGTCCTAGG 0: 1
1: 0
2: 3
3: 24
4: 304

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981702296 Original CRISPR CAGATCATGTTGGACCTTGA TGG (reversed) Intronic
900017317 1:161403-161425 GTGATCCTGTTGGACTTTGATGG - Intergenic
900047576 1:519999-520021 GTGATCCTGTTGGACTTTGATGG - Intergenic
900069789 1:761867-761889 GTGATCCTGTTGGACTTTGATGG - Intergenic
901886811 1:12229589-12229611 CAGATCCAGTGGGACCTTGGTGG + Intergenic
905017780 1:34789341-34789363 CAGATCTTGCGGGCCCTTGAAGG - Intronic
905433865 1:37943727-37943749 CAGCTCATCTTTGTCCTTGATGG - Intronic
905654396 1:39676783-39676805 CCGATCATGCAGGACCTGGAGGG + Intergenic
906706299 1:47897331-47897353 CTGATCATTTTGGGCCTTGTAGG + Intronic
906824068 1:48959864-48959886 CAGATCATGTAGGGCCTTGTAGG + Intronic
906872914 1:49503662-49503684 AAGATCATTTTGGAGCTTTAAGG + Intronic
907772947 1:57484221-57484243 CAGATCATCCTGGGCCTTGGGGG + Intronic
908379984 1:63588630-63588652 CTGATCATATTGGGCCTTGTAGG - Intronic
908715814 1:67068178-67068200 GAGATCATTTTGGAACTTTAAGG + Intergenic
909129278 1:71714664-71714686 GAGATCATTTTGGAACTTTAAGG - Intronic
909266041 1:73559016-73559038 GAGATCATTTTGGAACTTTAAGG + Intergenic
909574628 1:77159654-77159676 GAGATCATTTTGGAACTTTAAGG + Intronic
909813335 1:79959268-79959290 GAGATCATTTTGGAACTTTAAGG - Intergenic
910322641 1:85965902-85965924 CAGGTCATGTAGGGCCTTGCAGG + Intronic
911511143 1:98808986-98809008 GAGATCATTTTGGAACTTTAAGG - Intergenic
911596301 1:99802124-99802146 AAGATCATGTAGGAACCTGAAGG - Intergenic
911674088 1:100639157-100639179 CAGATCATCTGAGACCTTGAAGG + Intergenic
911838169 1:102647552-102647574 CATATCATATTGAGCCTTGAAGG - Intergenic
912051994 1:105541508-105541530 GAGATCATTTTGGAACTTTAAGG - Intergenic
912084089 1:105977313-105977335 GAGATCATTTTGGAACTTCAAGG + Intergenic
912096470 1:106150390-106150412 GAGATCATTTTGGATCTTTAAGG + Intergenic
912153069 1:106882831-106882853 GAGATCATTTTGGAACTTCAAGG - Intergenic
912652425 1:111451180-111451202 CAATTCATGTTGGACCTTCTGGG - Intronic
913208378 1:116563174-116563196 GAGATCATTTTGGAACTTTAAGG - Intronic
913286902 1:117234880-117234902 TAGATCATGTAGGGCCTTGTGGG + Intergenic
913289383 1:117258396-117258418 GAGATCATTTTGGAACTTTAAGG - Intergenic
914695077 1:150069922-150069944 CAGACCATGCTGCACCTTGAAGG - Intronic
915520226 1:156437485-156437507 CAGAACATTTTGGACCTCGTAGG + Intergenic
915787038 1:158624445-158624467 GAGATCATTTTGGAACTTTAAGG + Intronic
916516873 1:165526670-165526692 CAGCGAGTGTTGGACCTTGAAGG + Intergenic
916784163 1:168071786-168071808 TATGTCATGTAGGACCTTGAAGG - Intronic
916987593 1:170208028-170208050 GAGATCATTTTGGAACTTTAAGG + Intergenic
917140064 1:171826832-171826854 GAGATCATTTTGGAACTTTAAGG - Intergenic
917228815 1:172814027-172814049 GAGATCATTTTGGAACTTTAAGG - Intergenic
918126160 1:181585855-181585877 CAGATCATGTGGAGCCCTGAAGG + Intronic
918166113 1:181949156-181949178 GAGATCATTTTGGAACTTTAAGG + Intergenic
918641755 1:186849495-186849517 CAGATCATGTTGAACCTCTTAGG - Intronic
919119012 1:193315637-193315659 CAGCTCTTGTTGGTCCTGGAAGG + Intergenic
919124444 1:193378448-193378470 GAGATCATTTTGGAACTTAAAGG + Intergenic
919690683 1:200526069-200526091 TAGATCAATTTGGACCTTGTTGG - Intergenic
919754315 1:201057158-201057180 CAGATCATCTAGGCCCTTGAAGG - Intronic
920900662 1:210107086-210107108 CAGATCATTTTGGAATTTTAAGG - Intronic
921282265 1:213578606-213578628 GAGATCATTTTGGAACTTTAAGG + Intergenic
921515651 1:216087985-216088007 CAGATTATATGGGACCTTGTGGG - Intronic
921763243 1:218940972-218940994 GAGATCATTTTGGAGCTTTAAGG + Intergenic
921880573 1:220250271-220250293 GAGATCATTTTGGAACTTTAAGG + Intronic
921936451 1:220801131-220801153 CAGGTCATGTTGGGCCTTCCAGG - Intronic
922105162 1:222507336-222507358 GTGATCCTGTTGGACTTTGATGG - Intergenic
922265476 1:223979855-223979877 GTGATCCTGTTGGACTTTGATGG - Intergenic
922429080 1:225529220-225529242 CAGATCATGCAGGACCTTGCAGG - Intronic
922639776 1:227217662-227217684 CAGAACATGTTGGCCCTATAAGG - Intronic
923179107 1:231498998-231499020 GAGATCATTTTGGAACTTTAAGG - Intergenic
923403237 1:233636139-233636161 CAGATCATGTAGGACCTTATGGG + Intronic
923719578 1:236455428-236455450 CAGATCTTGTTGGAGCTTGAAGG - Intronic
924347334 1:243084857-243084879 GTGATCCTGTTGGACTTTGATGG - Intergenic
924394830 1:243607398-243607420 GAGATCATTTTGGAACTTTAAGG + Intronic
924721502 1:246627274-246627296 AAGATCATGTAGGGCCTTGTAGG - Intronic
1063044692 10:2379949-2379971 CATATCATGTTGTACTTTCACGG - Intergenic
1065299009 10:24303691-24303713 AAGTTCCTGTTGGACGTTGAAGG + Intronic
1065373386 10:25012552-25012574 GAGATCATTTTGGAACTTTAAGG + Intronic
1066253642 10:33657410-33657432 CAGATTATAATGGACTTTGATGG - Intergenic
1066729021 10:38420019-38420041 GGGATCCTGTTGGACTTTGATGG + Intergenic
1068148168 10:53097903-53097925 GAGATCATTTTGGAGCTTTAAGG + Intergenic
1068482659 10:57613040-57613062 CAGATTAATTTGGATCTTGAAGG + Intergenic
1068805704 10:61192166-61192188 AAGATCATTTTGGAACTTTAAGG - Intergenic
1069239577 10:66123301-66123323 GAGATCATTTTGGAGCTTTAAGG - Intronic
1069914760 10:71780614-71780636 CAGATGTTGTCGGGCCTTGAGGG + Intronic
1070831807 10:79422397-79422419 CAGAGCAGGCTGGTCCTTGAAGG - Intronic
1070849216 10:79550058-79550080 CAGACCATGTGGGACCCTGATGG + Intergenic
1070924636 10:80211032-80211054 CAGACCATGTGGGACCATGATGG - Intergenic
1071986950 10:91061535-91061557 CAGATCATGGGGGACCTTGTAGG - Intergenic
1072185410 10:93033061-93033083 CAAATCATGTAAGGCCTTGAGGG + Intronic
1073628057 10:105119665-105119687 GAGATCATTTTGGAACTTTAAGG + Intronic
1073922053 10:108470590-108470612 GAGATCATTTTGGAGCTTTACGG - Intergenic
1074622265 10:115138069-115138091 GAGATCATTTTGGAGCTTTAAGG - Intronic
1076973918 11:156631-156653 GTGATCCTGTTGGACTTTGATGG - Intergenic
1077126775 11:942997-943019 CAGAACGTGCTGGGCCTTGAAGG + Intronic
1077649366 11:3956078-3956100 CAGATCATTCTGGGCCTTGCAGG + Intronic
1077979489 11:7285849-7285871 AAGATCATTTTGGAACTTTAAGG - Intronic
1078515039 11:12014647-12014669 GAGATCATTTTGGAACTTTAAGG + Intergenic
1079004823 11:16784130-16784152 CAGATCACTTAGGGCCTTGACGG - Intronic
1079281499 11:19090900-19090922 CAGGCCATGAAGGACCTTGAAGG - Intergenic
1079439001 11:20490005-20490027 TAGATCATGTTGGTGTTTGAGGG + Intronic
1079466286 11:20734245-20734267 CAGATCATATTGGGCCTTAGAGG + Intronic
1079719021 11:23787307-23787329 GAGATCATTTTGGAACTTTAAGG - Intergenic
1079835056 11:25323549-25323571 GAGATCATTTTGGAACTTTAAGG + Intergenic
1080215259 11:29832555-29832577 AAGATCATTTTGGAACTTTAAGG + Intergenic
1080245695 11:30177226-30177248 GAGATCATTTTGGAACTTTAAGG - Intergenic
1080715738 11:34798037-34798059 GAGATCATTTTGGAACTTTAAGG + Intergenic
1080978896 11:37376909-37376931 TAGATCATTTTGGAACTTTAAGG - Intergenic
1081349051 11:42026574-42026596 GAGATCATTTTGGAACTTTAAGG - Intergenic
1081925050 11:46819387-46819409 CAGATCATGCAGGACTATGAAGG + Intronic
1082265406 11:50112388-50112410 GTGATCTTGTTGGACTTTGATGG - Intergenic
1082773124 11:57224242-57224264 CAGGTCATGTAGGACCTTGAAGG - Intergenic
1082947927 11:58780170-58780192 GAGATCATTTTGGAACTTGAAGG - Intergenic
1083085112 11:60134671-60134693 GAGATCATTTTGGAACTTTAAGG + Intergenic
1083968257 11:66056462-66056484 CAGATTGTGCTGGATCTTGAGGG + Intronic
1084977538 11:72810860-72810882 CAGATCAAGCAGGGCCTTGAAGG + Intergenic
1085851453 11:80124836-80124858 GAGATTATGTTGGATCTTTAAGG + Intergenic
1085861889 11:80244644-80244666 GAGATCATTTTGGAACTTTAAGG + Intergenic
1086509630 11:87542867-87542889 GAGATCATTTTGGAACTTTAAGG - Intergenic
1087385575 11:97464409-97464431 GAGATCATTTTGGAACTTTAAGG + Intergenic
1087493775 11:98863643-98863665 GAGATCATTTTGGAACTTGAAGG - Intergenic
1087670863 11:101105155-101105177 CAGATGCTGTAGGGCCTTGAAGG + Intronic
1087675693 11:101158645-101158667 GAGATCATTTTGGAACTTTAAGG + Intergenic
1087908206 11:103724143-103724165 GAGATCATTTTGGAACTTTAAGG - Intergenic
1088673685 11:112168971-112168993 CAGATAATACAGGACCTTGAAGG + Intronic
1088762761 11:112948140-112948162 GAGATCATTTTGGAACTTTAAGG - Intergenic
1088851004 11:113703243-113703265 GAGATCATTTTGGAACTTTAAGG + Intronic
1090179732 11:124685751-124685773 AAGATCATTTTGGAACTTTAAGG + Intronic
1091427790 12:406502-406524 CAGATCATACAGGACCTTGTCGG + Intronic
1091461808 12:648731-648753 CAGATCATGATGGACCCTGAAGG - Intronic
1091811795 12:3405681-3405703 GAGATCATTTTGGAACTTTAAGG - Intronic
1092310249 12:7344399-7344421 CAGATTATTTTGGACATTTAAGG - Intergenic
1093037984 12:14351386-14351408 GAGATCATTTTGGAACTTTAAGG - Intergenic
1093192514 12:16091586-16091608 AAGATCATTTTGGAACTTTAAGG - Intergenic
1093318405 12:17680485-17680507 CAGATTGTGTGGGGCCTTGAAGG + Intergenic
1093624316 12:21327606-21327628 GAGATCATTTTGGAGCTTTAAGG + Intronic
1093681700 12:22010072-22010094 GAGATCATTTTGGAACTTTATGG + Intergenic
1094055506 12:26265432-26265454 TAGATCATGAAGGACCTTGCAGG + Intronic
1095345812 12:41147852-41147874 GAGATCATTTTGGAACTTTAAGG - Intergenic
1095700504 12:45186220-45186242 CAGATCATGTAGGGCCTTACAGG + Intergenic
1095765104 12:45886257-45886279 GAGATCATTTTGGAACTTTAAGG - Intronic
1095836729 12:46647764-46647786 GAGATCATTTTGGAACTTTAAGG - Intergenic
1095868691 12:47002061-47002083 CAGATCATGTTGAACTTTGTAGG + Intergenic
1095909270 12:47409372-47409394 CAGATCATGGAGGGCCTGGAAGG - Intergenic
1095926404 12:47583850-47583872 CAGACCATGTAGGGCCTTGGGGG + Intergenic
1096201734 12:49688410-49688432 CAGATTATGTGGGACCTTGTTGG - Intronic
1096558942 12:52422365-52422387 CAGCTCATGATGGACCTGGCTGG - Intergenic
1097159035 12:57032753-57032775 CAGATCATGATGGGCCTTGTAGG + Intronic
1097377894 12:58860424-58860446 CAGATCATTCTGGAGCTTTAAGG - Intergenic
1097476161 12:60058374-60058396 GAGATCATTTTGGAGCTTTAAGG + Intergenic
1097526223 12:60739754-60739776 GAGATCATTTTGGAACTTTAAGG - Intergenic
1097682111 12:62658572-62658594 CAAATCATGTAGGATCTTTAGGG + Intronic
1097970727 12:65630194-65630216 CAGATGCTGCGGGACCTTGAGGG + Intergenic
1098021015 12:66156668-66156690 TACATCATGTGGGACCTTGTAGG - Intronic
1098944326 12:76573428-76573450 GAGATCATTTTGGAACTTTAAGG - Intergenic
1098953138 12:76662520-76662542 CAGAAGCTGTTGGACCCTGAAGG - Intergenic
1099318679 12:81117621-81117643 CAGATCATATAGAACCTTGCAGG + Intronic
1099496889 12:83359310-83359332 CAGATCATGTAGGATGTTGTAGG + Intergenic
1099565943 12:84246472-84246494 GAGATCATTTTGGAACTTTAAGG + Intergenic
1099607992 12:84829244-84829266 GAGATCATTTTGGAACTTTAAGG + Intergenic
1099811485 12:87587860-87587882 TAAATCATGTTGAAACTTGATGG - Intergenic
1100051938 12:90459904-90459926 GAGATCATTTTGGAACTTCAAGG + Intergenic
1100505001 12:95211042-95211064 AAAATCATGTTGAACCTGGAAGG - Exonic
1100674808 12:96855591-96855613 GAGATCATTTTGGAACTTTAAGG - Intronic
1101259596 12:103014575-103014597 CGGATCATGTTGGCCCTGCATGG + Intergenic
1101692829 12:107097260-107097282 GAGATCATTTTGGAACTTTAAGG + Intergenic
1101701289 12:107176672-107176694 CAGATCATGTGAGGCTTTGAAGG + Intergenic
1101712527 12:107281841-107281863 GAGATCATTTTGGAACTTTAAGG - Intergenic
1101761126 12:107660034-107660056 CAGCTCATGCTGGCCCTTGGTGG - Intergenic
1101798769 12:108002320-108002342 CTGATCCTGTAGGACCTTGAGGG - Intergenic
1102819346 12:115894735-115894757 CAGATCCTGTAGAACCTTGGAGG + Intergenic
1102826240 12:115950036-115950058 CAGATCATGGTGAACCTCGTTGG + Intergenic
1103085020 12:118056165-118056187 CAGATTATGCTGGATTTTGAGGG - Intronic
1103215873 12:119201066-119201088 CAGATCATGTGGGACTTTGAAGG - Intronic
1103387847 12:120547753-120547775 CAGATCATGTGGGGCTTTGAAGG + Intronic
1104243941 12:127018728-127018750 CAGCTCACGTTGGGCCTTGTGGG - Intergenic
1105016532 12:132789079-132789101 CAGCACATGGCGGACCTTGAAGG - Exonic
1105644495 13:22302889-22302911 GAGATCATTTTGGAACTTTAAGG - Intergenic
1106446374 13:29835923-29835945 TAGATCATGCAGGACCCTGAAGG + Intronic
1106929243 13:34646089-34646111 CAGATTATGGAGAACCTTGACGG + Intergenic
1107175219 13:37391953-37391975 CAGATCATGTAGGGCTTTGCAGG + Intergenic
1107644462 13:42479512-42479534 CAGATCACATGGGACCTTGTGGG + Intergenic
1107975423 13:45683828-45683850 GAGGTCATGTAGGGCCTTGAGGG - Intergenic
1108126939 13:47254853-47254875 CAGATCATGTTGGGCCTTGAAGG + Intergenic
1108219337 13:48217003-48217025 AAGATCATTTTGGAACTTTAAGG + Intergenic
1108994973 13:56718723-56718745 CAGATCATATATGACCTTGTAGG + Intergenic
1109189467 13:59307725-59307747 GAGATCATTTTGGAACTTTAAGG - Intergenic
1109588644 13:64445109-64445131 CAATTCACATTGGACCTTGAAGG + Intergenic
1110007818 13:70294255-70294277 AAGATCATTTTGGAACTTTAAGG + Intergenic
1110064765 13:71089386-71089408 CAGATCATGTAGAACCTGGTGGG + Intergenic
1110496436 13:76173793-76173815 GAGATCATTTTGGAACTTAAAGG - Intergenic
1110639217 13:77802530-77802552 AAGATCATGTAGGAGCTTGTAGG + Intergenic
1111218751 13:85178316-85178338 GAGATCATTTTGGACCTTTAAGG - Intergenic
1111536256 13:89606384-89606406 GAGATCATTTTGGAGCTTTAAGG - Intergenic
1112220955 13:97489158-97489180 CAAGTCATGTTGGAACTTAATGG - Intergenic
1112789464 13:102987478-102987500 GAGATCATTTTGGAACTTTAAGG - Intergenic
1112954502 13:105041735-105041757 GAGATCATTTTGGAACTTTAAGG - Intergenic
1112996003 13:105575675-105575697 AAGATCATTTTGGAACTTTAAGG + Intergenic
1113204571 13:107901378-107901400 AAGTTCATGTTGGACTGTGAAGG - Intergenic
1114680414 14:24479552-24479574 GAGATCATTTTGGAACTTTAAGG - Intergenic
1114991932 14:28298446-28298468 AAGATCATTTTGGAACTTTAAGG + Intergenic
1115122518 14:29954443-29954465 CAGATCAAGTGGGACCTTAATGG - Intronic
1115340811 14:32291433-32291455 GAGATCATTTTGGAACTTTAAGG + Intergenic
1115732666 14:36287994-36288016 CAGATCATGTAGGGCCCTGTAGG + Intergenic
1115775164 14:36706993-36707015 CAGATCATACTGGCCCTTGTAGG - Intronic
1115929826 14:38478443-38478465 GAGATCATTTTGGAACTTTAAGG + Intergenic
1116024354 14:39497346-39497368 GAGATCATTTTGGATCTTTAAGG + Intergenic
1116303455 14:43217179-43217201 GAGATCATTTTGGAGCTTTAAGG - Intergenic
1116714097 14:48406634-48406656 GAGATCATTTTGGAACTTTAAGG - Intergenic
1116784199 14:49269405-49269427 GAGATCATTTTGGAACTTTAAGG + Intergenic
1117085557 14:52196800-52196822 GAGATCATTTTGGAACTTGAAGG + Intergenic
1117396110 14:55312225-55312247 GAGATCATTTTGGAACTTTAAGG - Intronic
1117499049 14:56333646-56333668 CAGAACATATTGTCCCTTGAAGG + Intergenic
1117632793 14:57710693-57710715 GAGATCATTTTGGAACTTTAAGG + Intronic
1117769480 14:59118636-59118658 CAGATCATTTGGGGCCTTGTAGG - Intergenic
1117908144 14:60611601-60611623 GAGATCATCTTGGAACTTTAAGG - Intergenic
1119718926 14:76878135-76878157 CAGGTCAGGTGGGGCCTTGAGGG + Intergenic
1119955881 14:78798345-78798367 GAGATCATTTTGGAACTTTAAGG - Intronic
1120074060 14:80135720-80135742 CAGATCATTTTTGAACTAGATGG - Intergenic
1120091057 14:80333911-80333933 GAGATCATTTTGGAGCTTTAAGG - Intronic
1120159631 14:81131481-81131503 CAGATCATGTGTGGCCTTGTAGG - Intronic
1120231276 14:81844023-81844045 GAGATTATTTTGGACCTTTAAGG - Intergenic
1120270729 14:82309999-82310021 AAGATCATTTTGGAACTTTAAGG + Intergenic
1120658968 14:87230356-87230378 GAGATCATTTTGGAACTTTAAGG - Intergenic
1121805929 14:96822832-96822854 GAGATCAAGTAGGGCCTTGAAGG - Intronic
1123629036 15:22248085-22248107 GAGATCATTTTGGAACTTTAAGG + Intergenic
1124556011 15:30726709-30726731 GAGATCATTTTGGAACTTTAAGG - Intronic
1124675263 15:31679062-31679084 GAGATCATTTTGGAACTTTAAGG + Intronic
1124695296 15:31859257-31859279 CACATCATGTTGTACATGGAAGG + Intronic
1125189382 15:36972449-36972471 CAGATCATTGGGTACCTTGAAGG - Intronic
1125428084 15:39569751-39569773 CATATCATGTTGGAACTAGAAGG + Intergenic
1125900629 15:43343337-43343359 CAGATCATGTGGGACCTTGTAGG - Intronic
1126256154 15:46627731-46627753 GAGATCATTTTGGAACTTTAAGG + Intergenic
1126824999 15:52540043-52540065 GAGATCATTTTGGAACTTTAAGG - Intergenic
1126942379 15:53780822-53780844 GAGATCATTTTGGAACTTTAAGG - Intergenic
1127425041 15:58847657-58847679 CAGATCATATTGAACTGTGAAGG + Intronic
1127580752 15:60337473-60337495 CAGCTGATGTTGGAGCTTGATGG - Intergenic
1127897765 15:63317586-63317608 TAGATCATGTTGGAATTGGAGGG - Intergenic
1128194895 15:65743872-65743894 CAGATCATGTGGGTCCTTTTAGG + Intronic
1128586702 15:68858790-68858812 GACATCATGTTGGTCTTTGATGG - Intronic
1130358684 15:83159852-83159874 CAGATTATTTAGGGCCTTGAAGG + Intronic
1130791532 15:87160729-87160751 GAGATCATTTTGGAACTTTAAGG + Intergenic
1131466790 15:92662129-92662151 CAGATATTGGTGAACCTTGAAGG - Intronic
1131801245 15:96071575-96071597 CAGCTCCTGTTGGACTTTAACGG + Intergenic
1134036155 16:11032830-11032852 CAGGTCATGAAGGGCCTTGAAGG + Intronic
1136478157 16:30526070-30526092 CAGATCGTGTGAGACCTGGAAGG + Intronic
1137358118 16:47786427-47786449 CAGATCATGTGGGGCCTTGCAGG - Intergenic
1137435075 16:48448249-48448271 CAGGTAATGGTGGACCTTGAGGG - Intronic
1137936457 16:52639466-52639488 CTGATCATGTTTCACCTTCATGG + Intergenic
1137993773 16:53186279-53186301 GAGATCATTTTGGAACTTTAAGG + Intronic
1138044357 16:53705312-53705334 CAGATCATGCAGGATCTTGTAGG - Intronic
1138369742 16:56517290-56517312 CAGATCATATAGGAACTTGTAGG - Intronic
1138679525 16:58674955-58674977 CAGATCCTGTTGGGCCTCGAGGG - Intronic
1138874389 16:60931529-60931551 GAGATTGTGTAGGACCTTGAAGG + Intergenic
1139608211 16:68035310-68035332 CAGATCATGTAGAGCCTTGTAGG - Intronic
1140146834 16:72319560-72319582 GAGATCATTTTGGAACTTTAAGG - Intergenic
1140621594 16:76740675-76740697 CAGGTAGTGTTTGACCTTGAGGG + Intergenic
1141273128 16:82558705-82558727 GAGATCATTTTGGAACTTCAAGG + Intergenic
1142446345 16:90141054-90141076 GTGATCCTGTTGGACTTTGATGG + Intergenic
1142461160 17:94409-94431 GTGATCCTGTTGGACTTTGATGG - Intergenic
1142501702 17:336713-336735 CAGATCATGGACGGCCTTGAGGG - Intronic
1143092964 17:4460201-4460223 CAGATCATGTAGGATGTTGTGGG + Intronic
1144538455 17:16114669-16114691 GAGATCATTTTGGAGCTTTAAGG - Intronic
1145728198 17:27153312-27153334 CAGATCTTTTTGGACCCTTAGGG + Intergenic
1145842042 17:28003400-28003422 CAGATCATGTAGGGCCCTAAAGG + Intergenic
1146571628 17:33958045-33958067 TAGATCATTTTGGAACTTTAAGG - Intronic
1146962900 17:36999962-36999984 CAGGTCCTGTGGGACCTTGTAGG + Intronic
1147348837 17:39824184-39824206 GAGATCATTTTGGAACTTTAAGG + Intronic
1147620507 17:41863605-41863627 CAGATCCCGTAGGGCCTTGATGG - Intronic
1148064298 17:44857565-44857587 CAGACCATGTTGGGGCTTCAGGG - Intronic
1148317255 17:46712959-46712981 GAGATCATTTGTGACCTTGATGG + Intronic
1149163862 17:53726602-53726624 GAGATCATTTTGGAACTTTAAGG - Intergenic
1149216138 17:54357128-54357150 GAGATCATTTTGAAACTTGAAGG - Intergenic
1149265552 17:54924020-54924042 CAGATCGTGTTGTTCCTTGCTGG + Intronic
1150162939 17:62914699-62914721 CTGATCATGTAGAACCCTGAAGG - Intergenic
1151054822 17:71019025-71019047 CAGACCATGTTGGAAATTCAGGG + Intergenic
1151080324 17:71322226-71322248 CAGATCATGTCGAATCTTGAAGG - Intergenic
1153110742 18:1583442-1583464 TAGAGCATGTTGAACCTTCAAGG - Intergenic
1153174579 18:2356730-2356752 CAGATCATGATGGACCCCAAAGG - Intergenic
1153348284 18:4051937-4051959 AAGATCATTTTGGAACTTTAAGG - Intronic
1155134869 18:22980599-22980621 CAGGTCATGTAGGATCTTCATGG + Intronic
1155413464 18:25571242-25571264 GAGATCATTTTGGAACTTCAAGG - Intergenic
1155442937 18:25880976-25880998 CAGATCATGTAGGGTCTAGAGGG + Intergenic
1155966317 18:32038652-32038674 CAGATCATGTGAGGTCTTGAAGG + Intronic
1156614945 18:38772274-38772296 GAGATCATTTTGGAACTTTAAGG - Intergenic
1156809684 18:41232408-41232430 CAGATTATGTAGGGCCTTGTGGG - Intergenic
1158903538 18:61988352-61988374 CAGGTCATGTGGGGCCTTGCAGG + Intergenic
1158943304 18:62426096-62426118 AAGCTCATTTTGTACCTTGAGGG - Intergenic
1159342598 18:67155486-67155508 CAGATCCTCTTGGGCCTTGTTGG - Intergenic
1159461129 18:68723611-68723633 GAGATCATTTTGGAACTTTAAGG - Intronic
1159464973 18:68769812-68769834 CAGATTATGTTGATCCTTAAAGG + Intronic
1159652649 18:70996117-70996139 GAGATCATTTTGGAACTTTAAGG + Intergenic
1159717709 18:71847420-71847442 GAGATCATTTTGGAACTTTAAGG + Intergenic
1159756400 18:72371116-72371138 GAGATCATTTTGGAACTTTAAGG + Intergenic
1159811882 18:73026206-73026228 GAGATCATTTTGGAACTTTAAGG + Intergenic
1159896055 18:73996944-73996966 TAGATCATTTTGGAACTTTAAGG + Intergenic
1159942998 18:74422880-74422902 CAGCTCATGCTGGACCTAAAAGG + Intergenic
1160071360 18:75631285-75631307 CAGGTCATGTTGGTCCTTTTTGG + Intergenic
1160650861 19:226776-226798 GTGATCCTGTTGGACTTTGATGG - Intergenic
1163177284 19:15573319-15573341 CAGAACATGTTGGACCATGTAGG + Intergenic
1163183344 19:15619218-15619240 CAGAACATGTTGGACCATGTAGG + Intronic
1163187124 19:15646766-15646788 CAGAACATGTTGGATCATGTAGG + Intronic
1163221904 19:15927719-15927741 CAGAACATGTTGGACCTTGTAGG - Intronic
1165322674 19:35095980-35096002 CAGATCCTGTAGGGCCTTGTGGG + Intergenic
1165661326 19:37582989-37583011 CAAATCATGTAGGACCTTGTTGG - Intronic
1166039839 19:40195157-40195179 CAGATCACATAGGACCTTGGGGG + Intronic
1166082390 19:40452162-40452184 CATATCAGGTGGGGCCTTGAGGG - Intronic
1166563672 19:43750164-43750186 CAAATCATGTAGGACCTGGTAGG - Intronic
1166564513 19:43755343-43755365 CGGGTCCGGTTGGACCTTGAAGG + Intergenic
1167204765 19:48093583-48093605 CAGATCATATGGGACCCTGAAGG - Intronic
1167325087 19:48819479-48819501 CAGATCAGGCAGGGCCTTGAAGG - Intronic
1167850140 19:52195019-52195041 CAGATTGTGTTGGGCCTTGTAGG + Intronic
924993709 2:338377-338399 GAGATCATTTTGGAACTTTAAGG + Intergenic
925021512 2:573259-573281 CATCACAAGTTGGACCTTGAAGG + Intergenic
925245663 2:2380187-2380209 AAGATCATTTTGGAACTTTAAGG + Intergenic
925354477 2:3228279-3228301 GAGATCATTTTGGAACTTTAAGG + Intronic
925473948 2:4192253-4192275 AAGATCATTTTGGAACTTTAAGG - Intergenic
926280514 2:11442288-11442310 GAGATCATTTTGGAACTTTAAGG - Intergenic
926363612 2:12113175-12113197 CAGATCGTGCTGGGCCTTGTGGG + Intergenic
926836646 2:17031120-17031142 AAGATCATTTTGGAACTTTAAGG - Intergenic
926840231 2:17071603-17071625 AAGATCATTTTGGAACTTTAAGG + Intergenic
927170805 2:20367801-20367823 GAGATCATTTTGGAACTTTAAGG - Intergenic
927242086 2:20928218-20928240 GAGATCATTTTGGAACTTTAAGG - Intergenic
927601805 2:24449298-24449320 CAGATCATGTAGATCCTTGTAGG - Intergenic
927660828 2:24991393-24991415 GAGATCATTTTGGAACTTTAAGG + Intergenic
928255996 2:29723133-29723155 CAGATCCTGTGGGGCCTTTAGGG - Intronic
928609990 2:32983188-32983210 GAGATCATTTTGGAACTTCAAGG + Intronic
929293441 2:40219256-40219278 CAGCTCTTGTTTGACCTTGGAGG + Intronic
929382445 2:41368669-41368691 GAGATCATTTTGGAGCTTTATGG - Intergenic
929642355 2:43594631-43594653 CAGATTATTTAGGGCCTTGAAGG - Intronic
929982254 2:46692464-46692486 CAGATCATGCAGAACTTTGAAGG - Intergenic
930230195 2:48835410-48835432 GAGATCATTTTGGAACTTGAAGG + Intergenic
930282340 2:49385436-49385458 TAGATCATATAGGATCTTGAGGG - Intergenic
930480664 2:51944264-51944286 GAGATCATTTTGGAACTTTAAGG + Intergenic
930939693 2:56998682-56998704 GAGATCATTTTGGAACTTTAAGG - Intergenic
930960076 2:57251090-57251112 GAGATCATTTTGGAACTTTAAGG - Intergenic
931065191 2:58578264-58578286 CAGATCATGCTGGACCTTGTGGG + Intergenic
931361292 2:61580023-61580045 CAGAACATTTAGGCCCTTGAGGG + Intergenic
931494042 2:62783110-62783132 GAGATCATTTTGGAACTTTAAGG - Intronic
931967056 2:67546018-67546040 GAGATCATTTTGGAACTTTAAGG - Intergenic
932066112 2:68562778-68562800 GAGATTATGAAGGACCTTGAAGG + Intronic
932760893 2:74438589-74438611 CAGATCATGCAGGGCCTTGAAGG - Intronic
933445792 2:82378153-82378175 GAGATCATTTTGGAACTTGAAGG + Intergenic
933548079 2:83740281-83740303 AAGATCATTTTGGAACTTTAAGG - Intergenic
933583810 2:84158470-84158492 CAGATCATGTAGGTCACTGAAGG + Intergenic
934055057 2:88244406-88244428 GAGATCATTTTGGAGCTTTAAGG + Intergenic
936728875 2:115357400-115357422 GAGATCATTTTGGAACTTTAAGG - Intronic
936753778 2:115678880-115678902 CAGATCATTTTGGAACTTTAAGG + Intronic
936890632 2:117366020-117366042 GAGATCATTTTGGAGCTTTAAGG - Intergenic
937103182 2:119287254-119287276 CAGAGCTTGCTGGACCTTGCTGG + Intergenic
937527580 2:122789293-122789315 GAGATTATGTTGGAGCTTTAAGG + Intergenic
937889550 2:126926772-126926794 GAGATCATTTTGGAACTTTAAGG + Intergenic
937940791 2:127284321-127284343 CAGGTCTTGTAGGACCTTGTAGG - Intronic
940143813 2:150524025-150524047 GAGATCATTTTGGAACTTTAAGG + Intronic
940224612 2:151388755-151388777 CAGATCATGATGGGCCTTCTAGG - Intergenic
940415683 2:153417298-153417320 CAGATGATGTAGGGCCTTGCAGG + Intergenic
940444870 2:153765367-153765389 TAGATCATTTTGGAACTTTAAGG + Intergenic
940533044 2:154904496-154904518 GAGATCATTTTGGAACTTTAAGG - Intergenic
940578731 2:155549605-155549627 GAGATCATTTTGGAGCTTTAAGG - Intergenic
940736042 2:157453633-157453655 TAGAACATGCAGGACCTTGAAGG - Intronic
940877633 2:158914071-158914093 TTGATCAAGTGGGACCTTGATGG + Intergenic
941307705 2:163891924-163891946 GAGATCATTTTGGAACTTTAAGG - Intergenic
941346313 2:164372966-164372988 GAGATCATTTTGGAACTTTAAGG + Intergenic
941445290 2:165592150-165592172 GAGATCATTTTGGAACTTTAAGG + Intronic
941513089 2:166437740-166437762 GAGATCATTTTGGAACTTTAAGG + Intronic
941525026 2:166596797-166596819 GAGATCATTTTGGAACTTTAAGG - Intergenic
941682563 2:168414737-168414759 GAGATCATTTTGGAACTTTAAGG - Intergenic
941977809 2:171424544-171424566 GAGATCATTTTGGAACTTTAAGG + Intronic
942177710 2:173350471-173350493 CAGATCATGTGGGACCTTCTTGG - Intergenic
942380588 2:175386449-175386471 GAGATCATTTTGGAACTTTAAGG + Intergenic
942428134 2:175880757-175880779 TAGATCATGCAGGACCTTCACGG + Intergenic
942805728 2:179929580-179929602 GAGATCATTTTGGAGCTTAAAGG - Intergenic
943880615 2:193140090-193140112 AAGATCATTTTGGAACTTTAAGG - Intergenic
944011386 2:194979157-194979179 GAGATCATTTTGGAACTTTAAGG - Intergenic
944325777 2:198401825-198401847 CAGATCATGCAGGACCTTGTAGG - Intronic
944395529 2:199262213-199262235 CAGATCATGTAGGGCCTTGCAGG + Intergenic
944458121 2:199916692-199916714 GAGATCATTTTGGAACTTTAAGG - Intronic
944668573 2:201976528-201976550 AAGCTCATGTAGGACCTTGTAGG + Intergenic
945132326 2:206586174-206586196 CAGATCATGTTGAGCTTGGAAGG + Intronic
945931068 2:215855104-215855126 GAGATCATTTTGGAACTTTAAGG + Intergenic
946272934 2:218609161-218609183 CACAGAATGTTGGAGCTTGAAGG - Intronic
946460688 2:219865894-219865916 TAGATCTTGCAGGACCTTGAAGG - Intergenic
946626034 2:221613180-221613202 CAGACCATGTTGGGCCTTTGGGG + Intergenic
947396765 2:229694589-229694611 GAGATCATTTTGGAACTTTAAGG + Intronic
948202820 2:236142203-236142225 CAGATCACGTAGGACCTTGCAGG - Intergenic
948308280 2:236966305-236966327 CAGATCCTGAGGGACCTTGGGGG + Intergenic
948791421 2:240379368-240379390 CAGAACATGTGGGGCCTTGCAGG - Intergenic
1169477469 20:5945229-5945251 CAGATCATTTATGACCTTGCAGG - Intronic
1170301539 20:14889730-14889752 CAGATTATGTAGGGCCTTGGAGG + Intronic
1172180002 20:32997103-32997125 CGGACCTTGATGGACCTTGATGG + Intronic
1173029075 20:39337940-39337962 CAGATCATGGAGGACCTTCCAGG - Intergenic
1173323354 20:42009742-42009764 AAGATCATTTTGGAACTTTAAGG - Intergenic
1173749401 20:45465037-45465059 AAGATCATGAAGGACCCTGAAGG - Intergenic
1176883829 21:14230178-14230200 CAGATCATTTTGGAACTTTAAGG + Intergenic
1176958184 21:15129999-15130021 TAGATCATGCAGGATCTTGAAGG + Intergenic
1177359604 21:20050511-20050533 GAGATCATTTTGGAACTTTAAGG + Intergenic
1177529096 21:22337308-22337330 GAGATCATGTTGGAACTTTAAGG + Intergenic
1177922371 21:27168712-27168734 CAGATCATATAGTACCTTGTGGG - Intergenic
1177952127 21:27551885-27551907 GAGATCATTTTGGAACTTTAGGG - Intergenic
1178681924 21:34679757-34679779 GAGATCATTTTGGAACTTGAAGG - Intronic
1178942419 21:36917163-36917185 CAGATCATGTAGGAGCTGGCAGG - Intronic
1178948802 21:36969040-36969062 CAGCTCATGTTGAACCATGGTGG - Intronic
1179057969 21:37953525-37953547 CAGATGATGTTTAGCCTTGAGGG - Intronic
1180174161 21:46079410-46079432 CAGTCCATGTTGGACCAGGAGGG - Intergenic
1181888521 22:26040848-26040870 CAGATGATGTAGGGCCTTGTAGG + Intergenic
1182190381 22:28453908-28453930 TAGATCATGTATGACCTTGTAGG - Intronic
1182815717 22:33161636-33161658 AAGATCATTTTGGAACTTTAAGG - Intergenic
1182819359 22:33201728-33201750 CAGATCCTGTTGGGTCTTGTAGG + Intronic
1184157691 22:42679142-42679164 AAGATCATTTTGGAACTTAAAGG + Intergenic
1184338949 22:43874956-43874978 AAGATCATTTTGGAACTTTAAGG + Intergenic
949292526 3:2483195-2483217 GAGATCATTTTGGAGCTTTAAGG + Intronic
949875279 3:8622645-8622667 CGGATCATCTTGGAGCTGGAAGG - Intronic
951097444 3:18648548-18648570 CAGACCATGTTGAAGCTGGAAGG + Intergenic
951738572 3:25895462-25895484 TGGATCATGTAGGACCTTGTAGG - Intergenic
952401283 3:32966328-32966350 GAGATCATTTTGGAACTTTAAGG + Intergenic
952467574 3:33606148-33606170 TAGATAATGTTGTCCCTTGAGGG + Intronic
952504458 3:33995462-33995484 GAGATCATTTTGGAACTTTAAGG - Intergenic
952589421 3:34932709-34932731 GAGATCATTTTGGATCTTTAAGG + Intergenic
952624819 3:35391786-35391808 GAGATCATTTTGGAACTTTAAGG - Intergenic
952671482 3:35974445-35974467 GAGATCATTTTGGAACTTTAAGG - Intergenic
953839130 3:46374691-46374713 TAGATCATGAAGAACCTTGACGG + Exonic
954911885 3:54117496-54117518 GAGATCATTTTGGAACTTTAAGG + Intergenic
955075163 3:55606847-55606869 CAGGTAATGTTGGATCTCGAAGG + Intronic
955632687 3:60991346-60991368 CAGATCAGGTGGGGCCTTGCAGG + Intronic
956947017 3:74234659-74234681 GAGATCATTTTGGAACTTTAAGG - Intergenic
957012866 3:75028071-75028093 GAGATCATTTTGGAACTTTAAGG - Intergenic
957403733 3:79750143-79750165 GAGATCATTTTGGAGCTTTAAGG + Intronic
957956644 3:87196450-87196472 GAGATCATATTGGAACTTTAAGG + Intergenic
957978270 3:87474712-87474734 GAGATCATTTTGGAACTTTAAGG + Intergenic
958463323 3:94426744-94426766 GAGATCATTTTGGAACTTTAAGG + Intergenic
959208945 3:103351063-103351085 CAGATCATGTAGGATCTTTTAGG + Intergenic
959248617 3:103908721-103908743 CAGATTATGGTGGTCCCTGAAGG - Intergenic
959479221 3:106850944-106850966 CAGATCTAGTTGGACCTTTTAGG - Intergenic
959606364 3:108245476-108245498 GAGATCATTTTGGAACTTTAAGG + Intergenic
959689431 3:109182632-109182654 CAGATCATGCAGGGCCTTGAAGG - Intergenic
959818471 3:110703896-110703918 GAGATCATTTTGGAACTTTAAGG - Intergenic
960255448 3:115506294-115506316 GAGATCATTTTGGAACTTTAAGG + Intergenic
960406160 3:117262409-117262431 CAGGTCATGGTGGGCCTTGTAGG - Intergenic
960486954 3:118264949-118264971 CAGATCATGTAGGGCCTTTCAGG + Intergenic
961317357 3:126049679-126049701 CAGATCATGTGGAGCCTTGTGGG - Intronic
961503749 3:127356435-127356457 AAGATCATTTTGGAACTTTAAGG - Intergenic
961836892 3:129669328-129669350 CAGGTCAAGTTAGGCCTTGAAGG - Intronic
962509559 3:136084773-136084795 GAGATCATTTTGGAACTTTAAGG + Intronic
962646349 3:137444706-137444728 AAGATCATTTTGGAACTTTAAGG - Intergenic
963297154 3:143558552-143558574 GAGATCATTTTGGAACTTTAAGG + Intronic
963386155 3:144597882-144597904 AAGATCATTTTGGACCTTTAAGG - Intergenic
964529466 3:157651592-157651614 CACATCATGTGGGACCTTCCTGG + Intronic
965065346 3:163840873-163840895 GAGATCATTTTGGAACTTTAAGG - Intergenic
965108351 3:164387832-164387854 AAGATCATTTTGGAACTTTAGGG - Intergenic
965305476 3:167058921-167058943 GAGATCATTTTGGAACTTTAAGG - Intergenic
965690112 3:171346851-171346873 CAGATCATCCTGGGCCTTGTAGG + Intronic
965824264 3:172714707-172714729 CAGATCATTTAGGACCATGTAGG + Intergenic
966045206 3:175540436-175540458 CAGATTTTGTAGGACCTTGGAGG + Intronic
966160495 3:176962491-176962513 CAGGTCATGCAGGACCTTGCAGG + Intergenic
966320282 3:178694667-178694689 GAGATCATTTTGGAACTTTAAGG - Intronic
966351327 3:179035229-179035251 CAGATCATGTAGGGCCTTATAGG - Intronic
967772278 3:193347089-193347111 CATATCATTTTAGAGCTTGAAGG - Intronic
967830081 3:193911216-193911238 CAGATAAAGTTGGAACTGGAAGG + Intergenic
967866413 3:194193680-194193702 CAGGTCATGAAGGACCTAGACGG + Intergenic
968366970 3:198193211-198193233 GTGATCCTGTTGGACTTTGATGG + Intergenic
968590376 4:1455993-1456015 GAGATCATTTTGGAACTTTAAGG - Intergenic
969152031 4:5177785-5177807 GAGATCATTTTGGAACTTAAAGG - Intronic
970217560 4:13776052-13776074 GAGATCACTTTGGAACTTGAAGG - Intergenic
970275180 4:14391972-14391994 CAGAGCATGCTGGGCCTTGAAGG - Intergenic
970498984 4:16657569-16657591 CAGATAATGTAGGGCCTTGTAGG - Intronic
970678195 4:18476949-18476971 GAGATCATTTTGGAACTTTAAGG - Intergenic
971069897 4:23079750-23079772 GAGATCATTTTGGAACTTTAAGG - Intergenic
971545402 4:27879642-27879664 GAGATTATTTTGGAGCTTGAAGG - Intergenic
972748930 4:41969339-41969361 GAGATCATTTTGGAACTTTAAGG + Intergenic
972799849 4:42462885-42462907 GAGATCATTTTGGAGCTTTAAGG + Intronic
972839532 4:42914373-42914395 AAGATCATTTTGGAACTTTAAGG + Intronic
972890803 4:43553960-43553982 GAGATCATTTTGGAACTTTAAGG + Intergenic
972932744 4:44093539-44093561 TAGATCATGTGAGGCCTTGAAGG + Intergenic
973113865 4:46429923-46429945 CTGATATTGTGGGACCTTGATGG - Intronic
973167651 4:47097187-47097209 TAGGCCATGTTGGACCTTGGAGG - Intronic
974003843 4:56536202-56536224 CAGATCAAGTGGGGCCTTGTAGG - Intronic
974010092 4:56598733-56598755 CAGATCATGTAGGGCCTTGTAGG + Intronic
974319981 4:60334463-60334485 GAGATCATTTTGGAGCTTTAAGG + Intergenic
974422807 4:61699485-61699507 CAGATCTTGTGGGGCCTTGTGGG + Intronic
974763463 4:66308466-66308488 GAGATCATTTTGGAACTTTAAGG + Intergenic
974843471 4:67323806-67323828 AAGATCATTTTGGAGCTTTAAGG + Intergenic
975040377 4:69738954-69738976 GAGATCATTTTGGAACTTTAAGG - Intronic
975361243 4:73474740-73474762 AAGATCATTTTGGAACTTTAGGG - Intergenic
975854451 4:78608409-78608431 CAGATCATGCAGGACCTTTTTGG + Intronic
976259818 4:83135127-83135149 GAGATCATTTTGGAGCTTTAAGG - Intronic
976952538 4:90850545-90850567 GAGATCATTTTGGAACTTTAAGG + Intronic
977702437 4:100035771-100035793 GAGATCATTTTGGAACTTTAAGG - Intergenic
978043635 4:104099781-104099803 GAGATCATTTTGGAGCTTTAAGG + Intergenic
978145493 4:105366590-105366612 GAGATCATTTTGGAACTTTAAGG + Intergenic
978234862 4:106446402-106446424 GAGATCATTTTGGAACTTTAAGG - Intergenic
979255380 4:118602819-118602841 GTGATCCTGTTGGACTTTGATGG + Intergenic
979332958 4:119437694-119437716 GTGATCCTGTTGGACTTTGATGG - Intergenic
979412470 4:120395815-120395837 GAGATCATTTTGGAACTTTAAGG - Intergenic
980006924 4:127552824-127552846 GAGATCATTTTGGAACTTTAAGG + Intergenic
980091441 4:128447306-128447328 CAGATCATGTTGGACCTTCTAGG + Intergenic
980267217 4:130532777-130532799 CAGATTATATTCCACCTTGATGG - Intergenic
981184013 4:141779997-141780019 GAGATCATTTTGGAACTTTAAGG + Intergenic
981610323 4:146587157-146587179 CAGATCATATAGGATCTTAAAGG - Intergenic
981702296 4:147619934-147619956 CAGATCATGTTGGACCTTGATGG - Intronic
982763871 4:159321147-159321169 AAGATCATGCTGGACTTTAAAGG - Intronic
983006456 4:162490834-162490856 AAGATCATGTGGGAACTTTAAGG + Intergenic
983437472 4:167733244-167733266 CAGAACATCTATGACCTTGAAGG + Intergenic
983824612 4:172243044-172243066 TAGATCATGTTGGGCCTTATGGG - Intronic
983889563 4:173016499-173016521 GAGATCATTTTGGAACTTTAAGG + Intronic
984823268 4:183903187-183903209 CAGATCATGCCGGAACTTGCAGG - Intronic
985954697 5:3255179-3255201 CATATCATGATTAACCTTGAAGG - Intergenic
986194694 5:5527244-5527266 TAGATCATTTTGGAGCTTTAAGG + Intergenic
986314409 5:6576652-6576674 CAGGGCATGCTGGCCCTTGAAGG - Intergenic
986798171 5:11232468-11232490 GAGATCATTTTGGAACTTTAAGG + Intronic
986903228 5:12462877-12462899 CAGTTCATGTTGGAAACTGAAGG - Intergenic
987150211 5:15031204-15031226 CAGACTATGGAGGACCTTGAAGG - Intergenic
987215276 5:15730458-15730480 AAGATATTGTGGGACCTTGAAGG - Intronic
987246943 5:16058749-16058771 TAGATCACGTAGGACCTTGTGGG + Intergenic
988168703 5:27627532-27627554 CAGACATTGTAGGACCTTGAAGG - Intergenic
989032744 5:37136307-37136329 AAGATCATTTTGGAACTTTAAGG - Intronic
989132721 5:38123894-38123916 GAGATCATTTTGGAACTTCAAGG - Intergenic
989218238 5:38927027-38927049 GAGATCATTTTGGAACTTTAAGG - Intronic
989224628 5:39011682-39011704 GAGATCATTTTGGAACTTGAAGG + Intronic
989726781 5:44596972-44596994 AAGATCATTTTGGAACTTTAAGG - Intergenic
990083459 5:51945258-51945280 GAGATCATTTTGGAACTTCAAGG + Intergenic
990701004 5:58475034-58475056 GAGATCATTTTGGAACTTTAAGG - Intergenic
991279807 5:64899787-64899809 GAGAACATGTTGGGCCTTGAAGG - Intronic
991515149 5:67427034-67427056 CAGATCTTGTAGGGCCTTGAAGG - Intergenic
992763148 5:79969652-79969674 CAGACCAGGTAGGAGCTTGAAGG - Intergenic
992816812 5:80449623-80449645 CAGATCATTTTGCTTCTTGAAGG + Exonic
993066994 5:83113240-83113262 GAGATCATTTTGGAACTTTAAGG - Intronic
993164178 5:84330987-84331009 AAGATCATTTTGGAACTTTAAGG + Intronic
993711495 5:91229979-91230001 GAGATCATTTTGGAACTTTAAGG - Intergenic
993761236 5:91799897-91799919 GAGATCATTTTGGAACTTTAAGG - Intergenic
993792482 5:92224187-92224209 GAGATCATTTTGGAACTTTAAGG - Intergenic
995009454 5:107240917-107240939 GAGATCATTTTGGAACTTTAAGG + Intergenic
995389818 5:111627557-111627579 GAGATCATTTTGGAACTTTAAGG + Intergenic
995391051 5:111640435-111640457 GAGATCATTTTGGAACTTTAGGG + Intergenic
995393093 5:111660776-111660798 GAGATCATTTTGGAACTTTAAGG - Intergenic
995590914 5:113698996-113699018 GAGATCATTTTGGAACTTTAAGG - Intergenic
995630459 5:114126948-114126970 GAGATCATTTTGGAACTTTAAGG - Intergenic
995925612 5:117369794-117369816 GAGATCATTTTGGAACTTTAAGG + Intergenic
996122833 5:119691056-119691078 AAGATCATTTTGGAACTTTAAGG - Intergenic
996682259 5:126240198-126240220 GAGATCATGTTGGACTATTAGGG + Intergenic
996703643 5:126475008-126475030 CAGCTCATATTGGACCATGTTGG - Intronic
996774674 5:127120789-127120811 GAGATCATTTTGGAACTTTAAGG - Intergenic
997088259 5:130826614-130826636 GAGATCATTTTGGAACTTTAAGG - Intergenic
997102007 5:130980134-130980156 GAGATCATTTTGGAACTTTAAGG - Intergenic
997448797 5:133965038-133965060 CAGATCATGTAGGATCTTGAAGG - Intronic
997624001 5:135319406-135319428 CTGATCATGTTGGGTCTTGTGGG + Intronic
997958890 5:138303413-138303435 CAGATCGTGTAGGGCCTTGTAGG - Intronic
998012354 5:138705383-138705405 CAGATCATCATGAACCTTCAGGG - Intronic
998692627 5:144604021-144604043 CAGATCAAGTAGGACCTTGCAGG + Intergenic
998753586 5:145351893-145351915 GAGATCATTTTGGAACTTTAAGG - Intergenic
999559162 5:152781166-152781188 CAGATCATGTAGGGCCTTGCAGG - Intergenic
999861393 5:155650687-155650709 CAGATCATGTAAGAACTTGTGGG + Intergenic
1000357817 5:160417868-160417890 CAGACCATGGTGGACCGTGTAGG - Intronic
1000470843 5:161640119-161640141 AAGATCATTTTGGAACTTTAAGG + Intronic
1000526784 5:162368704-162368726 GAGATCATTTTGGAACTTTAAGG - Intergenic
1001349556 5:170945963-170945985 AAGATACTGTTGGATCTTGAAGG + Intronic
1001836511 5:174837069-174837091 GAGATCATTTTGGAACTTGAAGG + Intergenic
1002536053 5:179876125-179876147 AAGATCATGTGGGCCCTTGCAGG - Intronic
1002726195 5:181298409-181298431 GTGATCCTGTTGGACTTTGATGG + Intergenic
1003654825 6:7996875-7996897 CTAATTATGTAGGACCTTGAAGG - Intronic
1006554991 6:34858454-34858476 CAGATCTCCTTGGACTTTGAGGG + Exonic
1007707614 6:43800355-43800377 GGAATCATGTAGGACCTTGAAGG - Intergenic
1008775764 6:55035719-55035741 CAGATCATGTAGGACCCCGTAGG - Intergenic
1008875418 6:56320495-56320517 CAGATTGTGTAGGACCTTGGGGG - Intronic
1009242513 6:61199201-61199223 GAGATCATTTTGGAACTTTAAGG + Intergenic
1009554694 6:65148397-65148419 GAGATCATTTTGGAACTTTAAGG - Intronic
1010498549 6:76566684-76566706 GAGATCATTTTGGAGCTTTAAGG - Intergenic
1011031809 6:82931584-82931606 GAGATCATTTTGGAACTTTAAGG + Intronic
1011041228 6:83032332-83032354 GAGATCATTTTGGAGCTTTAAGG + Intronic
1011784280 6:90826670-90826692 GAGATCATTTTGGAACTTTAAGG + Intergenic
1011870528 6:91886689-91886711 GAGATCATTTTGGAACTTTAAGG + Intergenic
1011981633 6:93386400-93386422 GAGATCATTTTGGAACTTTAAGG - Intronic
1012188126 6:96247298-96247320 CAGATCATGTAGGACTTTGTAGG + Intergenic
1012239999 6:96860606-96860628 GAGATCATTTTGGAGCTTTAGGG + Intergenic
1012254505 6:97016392-97016414 GAGATCATTTTGGAACTTTAAGG + Intronic
1012547188 6:100433234-100433256 CAGATCGCCTTGGATCTTGAAGG - Intronic
1012783456 6:103592231-103592253 CAGATCATGTATGGCCTTGTAGG - Intergenic
1012969422 6:105711714-105711736 CAGAGCATGTAAGACCTTGCAGG - Intergenic
1013439512 6:110148605-110148627 CAGATTAGGTAGGACCTTGAAGG + Intronic
1014049422 6:116934973-116934995 CTGGGCATGTTAGACCTTGAGGG - Intergenic
1014143543 6:117971230-117971252 GAGATTATTTTGGAACTTGAAGG - Intronic
1014470059 6:121802259-121802281 GAGATCATTTTGGAACTTTAAGG + Intergenic
1014951272 6:127558649-127558671 GAGATCATTTTGGAACTTTAAGG + Intronic
1015045117 6:128767790-128767812 GAGATCATTTTGGAACTTTAAGG - Intergenic
1015228636 6:130887519-130887541 CAGATCATGCAGGGCCTTGGAGG - Intronic
1015713052 6:136162849-136162871 GAGATCATTTTGGAACTTGAAGG - Intronic
1015899147 6:138046975-138046997 GAGATCATTTTGGAACTTTAAGG - Intergenic
1016143564 6:140643513-140643535 GAGATCATTTTGGAACTTTAAGG - Intergenic
1016175298 6:141072079-141072101 GAGATCATTTTGGAACTTCAAGG + Intergenic
1016296048 6:142574542-142574564 GAGATCATTTTGGAACTTTAAGG + Intergenic
1016492007 6:144615898-144615920 CTGATCATGTAGGACCTGGTAGG - Intronic
1016540637 6:145160020-145160042 TAGATCATTTTGGAGCTTTAAGG + Intergenic
1016587777 6:145708949-145708971 GAGATCATTTTGGAACTTTAAGG + Intronic
1017321980 6:153105077-153105099 CAGATCACACTGGGCCTTGAGGG + Intronic
1018566803 6:165163135-165163157 GAGATCATTTTGGAACTTTAAGG - Intergenic
1019309279 7:352403-352425 CAGGCCATGGTGGACCTTGGTGG - Intergenic
1019569958 7:1706487-1706509 CAGTGCATGGTGGAACTTGAAGG - Intronic
1020942880 7:14562608-14562630 GAGATCATTTTGGAACTCGAAGG + Intronic
1021170974 7:17397681-17397703 CAAATCATGACAGACCTTGAAGG + Intergenic
1021573243 7:22085667-22085689 GAGATCATTTTGGAACTTTAAGG - Intergenic
1021762341 7:23913843-23913865 GAGATCATTTTGGAACTTTAAGG + Intergenic
1022144620 7:27524661-27524683 CAGATCATATGGGGCCTTGCAGG - Intergenic
1022481176 7:30744108-30744130 CACATCCTGTGGGGCCTTGAGGG - Intronic
1023208487 7:37776709-37776731 AAGATCATTTTGGAACTTTAAGG + Intronic
1023397472 7:39764663-39764685 GTGATCCTGTTGGACTTTGATGG + Intergenic
1024721118 7:52138668-52138690 GAGATCATTTTGGAACTTTAAGG - Intergenic
1025135201 7:56405802-56405824 GTGATCCTGTTGGACTTTGATGG - Intergenic
1026241768 7:68581716-68581738 CAGATCATGTAGGGTCTTGTAGG - Intergenic
1026375526 7:69746721-69746743 CAGGTCATATAGGACCTTGTAGG + Intronic
1027977650 7:85179438-85179460 GAGATCATTTTGGAACTTTAAGG + Intronic
1028084290 7:86617288-86617310 GAGATCATTTTGGAACTTTAAGG + Intergenic
1028286693 7:89011646-89011668 GAGATCATTTTGGAACTTTAAGG - Intronic
1028493728 7:91441594-91441616 GAGATCATTTTGGAACTTTAAGG + Intergenic
1028775664 7:94673312-94673334 CAGCTCATGTTCCTCCTTGAGGG - Intergenic
1030487526 7:110189091-110189113 CAGATCATGCAGGACTTTGTAGG + Intergenic
1030722316 7:112884567-112884589 GAGATCATTTTGGAACTTGGAGG - Intronic
1031194252 7:118591662-118591684 GAGATCATTTTGGAACTTTAAGG + Intergenic
1031417965 7:121516084-121516106 CAGATCTTGTAGGATCTTGAAGG - Intergenic
1031584522 7:123518464-123518486 TAGATCATTTAGGACCTTGAAGG - Intronic
1031645647 7:124222000-124222022 GAGATCATTTTGGAACTTTAAGG + Intergenic
1032140644 7:129326854-129326876 TGGATCATGTAGGACCCTGAGGG + Intronic
1032732451 7:134657075-134657097 GAGATCATTTTGGAACTTTAAGG - Intronic
1033036194 7:137878485-137878507 CAGATCCTGTTGGGCCTGGCTGG - Exonic
1033133732 7:138767767-138767789 CAGATCATGGAGGACCCTGGGGG - Intronic
1033491954 7:141853024-141853046 GAGATCATTTTGGAACTTTAAGG - Intergenic
1033777612 7:144629850-144629872 TAGATCATTTTGGAACTTTAAGG + Intronic
1033871825 7:145763071-145763093 GAGATCATTTTGGAGCTTTAAGG + Intergenic
1033885104 7:145934522-145934544 GAGATCATTTTGGAACTTTAAGG + Intergenic
1034040676 7:147873954-147873976 GAGATCATTTTGGAACTTTAAGG - Intronic
1034725501 7:153331828-153331850 CACATCATGTTGGGTCTTTAGGG + Intergenic
1034739754 7:153462871-153462893 GAGATCATTTTGGAACTTAAAGG + Intergenic
1036230113 8:6992577-6992599 CAGATCATGCTGGTTCATGAAGG - Intergenic
1036232565 8:7011680-7011702 CAGATCATGCTGGTTCATGAAGG - Intronic
1036598534 8:10238051-10238073 CAGATAGTGTAGGACCTTGTGGG - Intronic
1036748435 8:11427189-11427211 CTGCTCATGTTTAACCTTGATGG + Intronic
1037108469 8:15138106-15138128 GAGATCATTTTGGAACTTTAAGG + Intronic
1037206078 8:16321257-16321279 GAGATCATTTTGGAACTTTAAGG + Intronic
1037660201 8:20919776-20919798 GAGATCATTTTGGAACTTTAAGG - Intergenic
1037950220 8:23014725-23014747 CAGATGATGGTGGACATCGATGG + Exonic
1038887720 8:31683559-31683581 CAGAGCATGTAGGATCTTCAGGG + Intronic
1039955271 8:42202517-42202539 CAGCTCATGTGGGTGCTTGAGGG - Intronic
1040645080 8:49388399-49388421 GAGATCATTTTGGAACTTTAAGG + Intergenic
1040969700 8:53121624-53121646 CTGATCATTTTGGTCCTTAAGGG + Intergenic
1041033184 8:53759153-53759175 CAGATAATGTTAGAACTGGAAGG + Intronic
1041106075 8:54445161-54445183 CAGTTCATATGGGACCTTGTAGG + Intergenic
1041654531 8:60335817-60335839 GAGATCATTTTGGAACTTTAAGG + Intergenic
1042053053 8:64732327-64732349 GAGATCATTTTGGAACTTTAAGG + Intronic
1042150798 8:65781368-65781390 CAGATCATGCTGGACCTTTGTGG + Intronic
1042164953 8:65936113-65936135 GAGATCATTTTGGAACTTTAAGG + Intergenic
1042601510 8:70503560-70503582 GAGATCATCTTGGAACTTTAAGG + Intergenic
1043043740 8:75294876-75294898 CAGACCATGTTAGACCTTAAAGG - Intergenic
1043207906 8:77470867-77470889 AAGATCAGGTAGGACCTTGAAGG + Intergenic
1043551192 8:81374953-81374975 CAGATCCTGTAGGACTTTGTGGG + Intergenic
1043877610 8:85503785-85503807 CAGATCATGTAAGGCCTTGGGGG - Intergenic
1044126994 8:88471467-88471489 GAGATCATTTTGGAACTTTAAGG - Intergenic
1044462363 8:92460279-92460301 CAGATCATGGCCGGCCTTGAGGG - Intergenic
1045227389 8:100262568-100262590 CAGATCATGTGGGGCCTTTTGGG + Intronic
1045919371 8:107511552-107511574 GAGATCATTTTGGAACTTTAAGG + Intergenic
1046880135 8:119298808-119298830 AAGATCATTTTGGAACTTTAAGG - Intergenic
1046917471 8:119692504-119692526 GAGATCATTTTGGAACTTTAAGG + Intergenic
1046930352 8:119835901-119835923 TAGATCACGTAGAACCTTGAAGG + Intronic
1047917982 8:129603471-129603493 GAGATCATTTTGGAACTTTAAGG - Intergenic
1048013911 8:130480899-130480921 CAGTGCTGGTTGGACCTTGAGGG - Intergenic
1048226751 8:132595027-132595049 CAGATCATGGTGGAAGGTGAAGG - Intronic
1048334815 8:133494639-133494661 CAGTTCATGTAGGATCTTGCAGG - Intronic
1048694687 8:137012823-137012845 GAGATCATTTTGGAACTTTAAGG - Intergenic
1048781582 8:138007613-138007635 GAGATCATTTTGGAACTTTAAGG + Intergenic
1050272705 9:3962913-3962935 CAGATCTTGTTGGACATTTGGGG - Intronic
1050412931 9:5385061-5385083 CAGATCATGTGGGACCTTCCAGG + Intronic
1050508571 9:6371329-6371351 GAGATCATTTTGGAACTTTAAGG + Intergenic
1050773540 9:9233753-9233775 GAGATCATTTTGGAACTTTAAGG - Intronic
1051087022 9:13361786-13361808 GAGATCATGTTGGTCCTAGAGGG - Intergenic
1052689779 9:31802385-31802407 GAGATCATTTTGGAGCTTTAAGG + Intergenic
1053371410 9:37564619-37564641 GAGATCATTTTGGAACTTTAAGG + Intronic
1054861835 9:69961793-69961815 CAGATCATGATGGATCTTGCAGG + Intergenic
1055142058 9:72887162-72887184 GAGATCATTTTGGAGCTTTAAGG + Intergenic
1055170803 9:73255444-73255466 AAGATCATTTTGGAGCTTTAAGG + Intergenic
1055225426 9:73989563-73989585 GAGATCATTTTGGACCTTTAAGG - Intergenic
1055774311 9:79751650-79751672 AAGATCATTTTGGAACTTTAAGG - Intergenic
1055848401 9:80594863-80594885 GAGATCATTTTGGAACTTTAAGG + Intergenic
1056042772 9:82685443-82685465 AAGATCATTTTGGAACTTTAAGG - Intergenic
1056670385 9:88622935-88622957 AAGATTATGTTGGAGCTTTAAGG - Intergenic
1057040301 9:91843119-91843141 AAGAGCATGTTGGAGCTGGAGGG + Intronic
1058087222 9:100761518-100761540 CAGAGCATGTTGGAGCAAGAAGG + Intergenic
1058101870 9:100925375-100925397 GAGATCATTTTGGAACTTTAAGG + Intergenic
1058547251 9:106073758-106073780 CAGATCATGGATGATCTTGAGGG - Intergenic
1058934184 9:109752648-109752670 CATATTATGAAGGACCTTGAAGG + Intronic
1059348245 9:113646795-113646817 CAGATCACGCAGGGCCTTGAAGG - Intergenic
1059513933 9:114875614-114875636 GAGATCATTTTGGAACTTTAAGG - Intergenic
1059622292 9:116020279-116020301 CAGATCATTTGGGACCTTCTGGG - Intergenic
1059917027 9:119115332-119115354 CAGATCATGAAGAACCTTCATGG - Intergenic
1060463655 9:123882931-123882953 CAGATCATGTAGGACTTTGTAGG - Intronic
1061411225 9:130422789-130422811 CAGAACATGCTGGACCTAGGAGG + Intronic
1062751326 9:138256055-138256077 GTGATCCTGTTGGACTTTGATGG + Intergenic
1186679241 X:11854645-11854667 GAGATCATTTTGGAACTTTAAGG - Intergenic
1186704560 X:12127900-12127922 GAGATCATTTTGGAACTTTAAGG - Intergenic
1186797571 X:13061914-13061936 GAGATCATTTTGGAGCTTTAAGG - Intergenic
1186844290 X:13515756-13515778 GAGATCATTTTGAACCATGAGGG - Intergenic
1187097140 X:16161223-16161245 GAGATCATTTTGGAACTTTAAGG - Intergenic
1187927560 X:24263896-24263918 CAGAGCATGTGGGACCTTGCAGG - Intergenic
1188055979 X:25541681-25541703 GAGATCATTTTGGAACTTTAAGG - Intergenic
1188062423 X:25617830-25617852 GAGATCATTTTGGAACTTTAAGG - Intergenic
1188232150 X:27677663-27677685 CAGGTCATGCAGGACCTTGCAGG + Intronic
1188749323 X:33885596-33885618 AAGATCATTTTGGAACTTTAAGG + Intergenic
1188865234 X:35305839-35305861 CAGATCATTTTGGAAATTTAAGG + Intergenic
1189145963 X:38655055-38655077 CAGGTCAAGTAGGACCTTGCAGG + Intronic
1189537986 X:41956206-41956228 CAGATCATGTAGGGCCTTGTAGG - Intergenic
1189604303 X:42660239-42660261 GAGATCATTTTGGAACTTTAAGG + Intergenic
1190262163 X:48804244-48804266 CAGATCATGTGGAACCTTTGAGG - Intronic
1190489342 X:50965394-50965416 CAGATCATGTAGGATTTTGTAGG - Intergenic
1190531743 X:51385828-51385850 GAGATCATTTTGGAACTTTAAGG - Intergenic
1190853077 X:54265553-54265575 CAGATCCTGTAGGACTTTGCAGG + Intronic
1192273832 X:69610180-69610202 CAGATCATGTAGGGCCTTGTAGG + Intergenic
1192280119 X:69676116-69676138 CAGATCATGTAGGGCTTTGTAGG + Intronic
1192335689 X:70217390-70217412 GAGATCATTTTGGAACTTTAAGG + Intergenic
1192340777 X:70261663-70261685 CAGATCATGAAGGTCCTTGGAGG + Intergenic
1193136016 X:77971218-77971240 GAAATCATGTGGGACCTTGTTGG + Intronic
1193199039 X:78666154-78666176 GAGATCATTTTGGAACTTTATGG + Intergenic
1193624707 X:83803842-83803864 TAGATCATGTAGGGCCTTGTAGG + Intergenic
1194423601 X:93708314-93708336 CAGATCATATAGGACCTTATAGG + Intronic
1194713699 X:97265761-97265783 CAAATCATGTAGGTCCTTGTTGG + Intronic
1194893343 X:99407149-99407171 GAGATCATTTTGGAACTTTAAGG + Intergenic
1194906016 X:99576833-99576855 GAGATCATTTTGGAACTTTAAGG + Intergenic
1195408582 X:104544271-104544293 CAGATCATAAAGGACCTTGTGGG - Intergenic
1195536372 X:106013214-106013236 CAGAACATTTTGGAACTTTAAGG + Intergenic
1196003794 X:110813914-110813936 CAGATCATGTAGGGCTTTGAAGG + Intergenic
1196004040 X:110816648-110816670 CAGATCATGCTAGGCCTTGCAGG + Intergenic
1196141535 X:112268108-112268130 CAGATTAGGTAGGATCTTGAAGG - Intergenic
1196173717 X:112617376-112617398 GAGATCATTTTGGAACTTTAAGG + Intergenic
1196756981 X:119166612-119166634 CAGATCATGACAGACCTTTAAGG - Intergenic
1196764657 X:119231952-119231974 CAGATCCTGTAGGGCCTTGTAGG + Intergenic
1197451812 X:126628861-126628883 GAGATCATTTTGGAACTTTAAGG - Intergenic
1197631803 X:128869460-128869482 CCAATCATGTTGGGCCTTGTAGG + Intergenic
1197741707 X:129900057-129900079 CAGATCATGTAGGGCCTTGTAGG - Intergenic
1197881749 X:131173841-131173863 CAGATCATGTAGGGCCTTTTAGG + Intergenic
1198380840 X:136081973-136081995 CAGATCATGTAAGGCCTTGTAGG - Intergenic
1198448235 X:136739922-136739944 CAGATCCTGGAGGACCTTGGAGG + Intronic
1198497088 X:137203815-137203837 GAGATCATTTTGGAGCTTTAAGG - Intergenic
1198612583 X:138418333-138418355 GAGATCATTTTGGAACTTTAAGG + Intergenic
1198710430 X:139495661-139495683 CAGATCATGGAGGTCCTTGTAGG - Intergenic
1198825724 X:140696146-140696168 GAGATCATTTTGGAACTTTAAGG - Intergenic
1198879991 X:141270140-141270162 CAGATAATTTTTGACCTTGTAGG + Intergenic
1198912894 X:141634026-141634048 GAGATCATGTTGGAACTTTAAGG + Intronic
1198966949 X:142237401-142237423 AAGATCATTTTGGAACTTTAAGG + Intergenic
1199339047 X:146654450-146654472 CAGATTATGTTGGGCCTTGTAGG + Intergenic
1199515188 X:148668138-148668160 GAGATCATTTTGGAGCTTTAAGG - Intronic
1199560602 X:149159140-149159162 GAGATCATTTTGGAACTTTAAGG - Intergenic
1199571859 X:149274311-149274333 CAGACCATGGTGTTCCTTGAAGG + Intergenic
1199778274 X:151034728-151034750 CAGATCCTATAGGACCTTGTGGG - Intergenic
1199999390 X:153049878-153049900 GAGATCATTTTGGAACTTTAAGG + Intergenic
1200016763 X:153170496-153170518 GAGATCATTTTGGAACTTTAAGG + Intergenic
1200303029 X:154997727-154997749 CATAACATGTAGGACCTTGCAGG + Intronic
1200441680 Y:3219255-3219277 GAGATCATTTTGGAGCTTTAAGG - Intergenic
1200921922 Y:8620887-8620909 CAGATCATTTTGGAACCTTAGGG - Intergenic
1200926404 Y:8658760-8658782 CAGATCCTTTTGGACCCTTAGGG - Intergenic
1200935210 Y:8732453-8732475 CAGATCATTTTGGATCCTTAGGG + Intergenic