ID: 981709544

View in Genome Browser
Species Human (GRCh38)
Location 4:147695566-147695588
Sequence CCATCTTGGTAGCAGAGCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981709544_981709550 29 Left 981709544 4:147695566-147695588 CCCAGGCTCTGCTACCAAGATGG No data
Right 981709550 4:147695618-147695640 ATAAACTCTGTGTCTTCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981709544 Original CRISPR CCATCTTGGTAGCAGAGCCT GGG (reversed) Intergenic
No off target data available for this crispr