ID: 981713602

View in Genome Browser
Species Human (GRCh38)
Location 4:147732208-147732230
Sequence AGGTGCGGCGCCGCGCGTTC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 42
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 41}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981713602_981713605 -9 Left 981713602 4:147732208-147732230 CCTGAACGCGCGGCGCCGCACCT 0: 1
1: 0
2: 0
3: 0
4: 41
Right 981713605 4:147732222-147732244 GCCGCACCTGGCAGCGGCCTCGG 0: 1
1: 0
2: 1
3: 18
4: 186
981713602_981713609 3 Left 981713602 4:147732208-147732230 CCTGAACGCGCGGCGCCGCACCT 0: 1
1: 0
2: 0
3: 0
4: 41
Right 981713609 4:147732234-147732256 AGCGGCCTCGGAGCTCGGCTCGG 0: 1
1: 0
2: 0
3: 12
4: 101
981713602_981713608 -2 Left 981713602 4:147732208-147732230 CCTGAACGCGCGGCGCCGCACCT 0: 1
1: 0
2: 0
3: 0
4: 41
Right 981713608 4:147732229-147732251 CTGGCAGCGGCCTCGGAGCTCGG 0: 1
1: 0
2: 3
3: 12
4: 200
981713602_981713612 8 Left 981713602 4:147732208-147732230 CCTGAACGCGCGGCGCCGCACCT 0: 1
1: 0
2: 0
3: 0
4: 41
Right 981713612 4:147732239-147732261 CCTCGGAGCTCGGCTCGGGCAGG 0: 1
1: 0
2: 0
3: 18
4: 148
981713602_981713610 4 Left 981713602 4:147732208-147732230 CCTGAACGCGCGGCGCCGCACCT 0: 1
1: 0
2: 0
3: 0
4: 41
Right 981713610 4:147732235-147732257 GCGGCCTCGGAGCTCGGCTCGGG 0: 1
1: 0
2: 1
3: 6
4: 178
981713602_981713613 17 Left 981713602 4:147732208-147732230 CCTGAACGCGCGGCGCCGCACCT 0: 1
1: 0
2: 0
3: 0
4: 41
Right 981713613 4:147732248-147732270 TCGGCTCGGGCAGGAGCGCGCGG 0: 1
1: 0
2: 0
3: 13
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981713602 Original CRISPR AGGTGCGGCGCCGCGCGTTC AGG (reversed) Exonic
900371659 1:2334904-2334926 AGGTGCCGCCCTGGGCGTTCGGG + Intronic
920805678 1:209231732-209231754 AGGTGCTGCGCGGCGCCTACAGG - Intergenic
1074121536 10:110497558-110497580 CGGGGCGGCGCCGCACGATCCGG - Intergenic
1075129458 10:119725960-119725982 AGGGGCGGAGCCGGGCGCTCGGG + Intergenic
1077155299 11:1088416-1088438 AGGAGCGGCGGTGCGGGTTCAGG - Intergenic
1084957068 11:72697202-72697224 AGGGGCGGGGCCAAGCGTTCGGG + Intronic
1108618580 13:52159425-52159447 AGGGGCGCGGCCGCGCGTCCGGG + Intronic
1119808743 14:77499156-77499178 AGCTGCGGCCCGGCGCGCTCCGG + Intergenic
1123072236 14:105647514-105647536 GGGTGAGGCTCCGTGCGTTCAGG - Intergenic
1127207333 15:56733855-56733877 AGGCGAGGAGCCGTGCGTTCCGG + Intronic
1128425943 15:67542656-67542678 GGTTCCGGCGCCGCGCGTTTTGG + Intergenic
1130608000 15:85334955-85334977 AGGTGCGGGGCCGGGCGTGGTGG + Intergenic
1132512732 16:352406-352428 CGGAGCGGCGCGGCGCGGTCCGG + Exonic
1132586080 16:706184-706206 CGGGGCGGCACCGCGCGTCCCGG + Intronic
1132734069 16:1376983-1377005 AGGTGCGACGCCTGGGGTTCAGG + Intronic
1144952995 17:19004108-19004130 AGCTGGGGCACCGCGCGCTCGGG + Exonic
1147183639 17:38702303-38702325 AGGTGCGGGCCGGCGCGGTCGGG + Intergenic
1160803865 19:982898-982920 GGCTGCGGCGCCGCACGCTCTGG + Intergenic
1162959479 19:14117578-14117600 AGCTGCGGCGCGGCGGGTGCTGG + Exonic
1165944854 19:39435919-39435941 GGTTGCGGCGCCGCGCGGTGAGG - Exonic
1168297383 19:55384056-55384078 AGGTGCGCGGCCGCGACTTCGGG - Exonic
932621828 2:73269317-73269339 AGGTGCGGCGCCGCGGGCGACGG + Exonic
946394267 2:219435307-219435329 AGGCCCGGCCCCGCTCGTTCTGG - Exonic
1180999140 22:19979873-19979895 AGGTGCGGCGCCGGGCCTGTGGG - Exonic
1181592724 22:23894972-23894994 AGGGGCGGCGGCGCGCGGCCAGG + Exonic
952942672 3:38455465-38455487 AGGGGCGGGGCCGGGCGTGCAGG + Intronic
965590592 3:170357514-170357536 AGCGGCGGCGCCGCGCGCGCGGG - Intergenic
981713602 4:147732208-147732230 AGGTGCGGCGCCGCGCGTTCAGG - Exonic
982370382 4:154627108-154627130 GAGGGCGGCGCCGCGCCTTCTGG + Intronic
986608435 5:9545517-9545539 CGGCGCGGCGCGGCGCGGTCAGG + Intronic
991587509 5:68215645-68215667 AGGGGCGGAGCCGCGGGCTCTGG + Intergenic
998262159 5:140639671-140639693 AGGCTCGGAGCCGCGGGTTCTGG + Intronic
998334076 5:141355428-141355450 AGGTGCCGCTGCGCGGGTTCAGG - Exonic
1020210448 7:6154482-6154504 AGGTGCGGCGCCGCCGGTGACGG - Exonic
1034676088 7:152893970-152893992 AGGTGAGGTGCGGGGCGTTCAGG - Intergenic
1049854443 8:144852741-144852763 GGGCGCGGCGTCGCCCGTTCCGG + Intronic
1054174560 9:61866259-61866281 AGATGGGGCGCCGGGCGGTCAGG - Intergenic
1054662978 9:67714532-67714554 AGATGGGGCGCCGGGCGGTCAGG + Intergenic
1062341270 9:136094902-136094924 GGACGCCGCGCCGCGCGTTCGGG - Intronic
1203775514 EBV:70985-71007 GGGTGCAGAGCCCCGCGTTCTGG + Intergenic
1185507595 X:642206-642228 GGGCGCTGCGCTGCGCGTTCAGG - Intronic
1198750259 X:139931982-139932004 CGCTGCGGCTCCGCGCGTGCCGG - Intronic