ID: 981713631 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 4:147732347-147732369 |
Sequence | CGGATCCTCTCCCGGAACCA CGG (reversed) |
Strand | - |
Crispr in exon? | Yes |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 52 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 3, 4: 48} |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
981713631_981713633 | -9 | Left | 981713631 | 4:147732347-147732369 | CCGTGGTTCCGGGAGAGGATCCG | 0: 1 1: 0 2: 0 3: 3 4: 48 |
||
Right | 981713633 | 4:147732361-147732383 | GAGGATCCGCGCTCACGAAGCGG | 0: 1 1: 0 2: 0 3: 1 4: 16 |
||||
981713631_981713635 | 2 | Left | 981713631 | 4:147732347-147732369 | CCGTGGTTCCGGGAGAGGATCCG | 0: 1 1: 0 2: 0 3: 3 4: 48 |
||
Right | 981713635 | 4:147732372-147732394 | CTCACGAAGCGGAACTCGAGAGG | 0: 1 1: 0 2: 0 3: 2 4: 18 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
981713631 | Original CRISPR | CGGATCCTCTCCCGGAACCA CGG (reversed) | Exonic | ||