ID: 981713631

View in Genome Browser
Species Human (GRCh38)
Location 4:147732347-147732369
Sequence CGGATCCTCTCCCGGAACCA CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 52
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 48}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981713631_981713633 -9 Left 981713631 4:147732347-147732369 CCGTGGTTCCGGGAGAGGATCCG 0: 1
1: 0
2: 0
3: 3
4: 48
Right 981713633 4:147732361-147732383 GAGGATCCGCGCTCACGAAGCGG 0: 1
1: 0
2: 0
3: 1
4: 16
981713631_981713635 2 Left 981713631 4:147732347-147732369 CCGTGGTTCCGGGAGAGGATCCG 0: 1
1: 0
2: 0
3: 3
4: 48
Right 981713635 4:147732372-147732394 CTCACGAAGCGGAACTCGAGAGG 0: 1
1: 0
2: 0
3: 2
4: 18

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981713631 Original CRISPR CGGATCCTCTCCCGGAACCA CGG (reversed) Exonic