ID: 981713633

View in Genome Browser
Species Human (GRCh38)
Location 4:147732361-147732383
Sequence GAGGATCCGCGCTCACGAAG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 18
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 16}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981713631_981713633 -9 Left 981713631 4:147732347-147732369 CCGTGGTTCCGGGAGAGGATCCG 0: 1
1: 0
2: 0
3: 3
4: 48
Right 981713633 4:147732361-147732383 GAGGATCCGCGCTCACGAAGCGG 0: 1
1: 0
2: 0
3: 1
4: 16
981713622_981713633 24 Left 981713622 4:147732314-147732336 CCCCTGGAGTTCAGCGACTGCTA 0: 2
1: 0
2: 0
3: 4
4: 60
Right 981713633 4:147732361-147732383 GAGGATCCGCGCTCACGAAGCGG 0: 1
1: 0
2: 0
3: 1
4: 16
981713627_981713633 1 Left 981713627 4:147732337-147732359 CCTCGACAGCCCGTGGTTCCGGG 0: 1
1: 0
2: 0
3: 3
4: 50
Right 981713633 4:147732361-147732383 GAGGATCCGCGCTCACGAAGCGG 0: 1
1: 0
2: 0
3: 1
4: 16
981713624_981713633 22 Left 981713624 4:147732316-147732338 CCTGGAGTTCAGCGACTGCTACC 0: 1
1: 0
2: 0
3: 5
4: 65
Right 981713633 4:147732361-147732383 GAGGATCCGCGCTCACGAAGCGG 0: 1
1: 0
2: 0
3: 1
4: 16
981713623_981713633 23 Left 981713623 4:147732315-147732337 CCCTGGAGTTCAGCGACTGCTAC 0: 1
1: 0
2: 1
3: 4
4: 91
Right 981713633 4:147732361-147732383 GAGGATCCGCGCTCACGAAGCGG 0: 1
1: 0
2: 0
3: 1
4: 16
981713630_981713633 -8 Left 981713630 4:147732346-147732368 CCCGTGGTTCCGGGAGAGGATCC 0: 1
1: 0
2: 1
3: 11
4: 102
Right 981713633 4:147732361-147732383 GAGGATCCGCGCTCACGAAGCGG 0: 1
1: 0
2: 0
3: 1
4: 16

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981713633 Original CRISPR GAGGATCCGCGCTCACGAAG CGG Exonic