ID: 981713635

View in Genome Browser
Species Human (GRCh38)
Location 4:147732372-147732394
Sequence CTCACGAAGCGGAACTCGAG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 21
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 18}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981713627_981713635 12 Left 981713627 4:147732337-147732359 CCTCGACAGCCCGTGGTTCCGGG 0: 1
1: 0
2: 0
3: 3
4: 50
Right 981713635 4:147732372-147732394 CTCACGAAGCGGAACTCGAGAGG 0: 1
1: 0
2: 0
3: 2
4: 18
981713632_981713635 -6 Left 981713632 4:147732355-147732377 CCGGGAGAGGATCCGCGCTCACG 0: 1
1: 0
2: 0
3: 1
4: 41
Right 981713635 4:147732372-147732394 CTCACGAAGCGGAACTCGAGAGG 0: 1
1: 0
2: 0
3: 2
4: 18
981713631_981713635 2 Left 981713631 4:147732347-147732369 CCGTGGTTCCGGGAGAGGATCCG 0: 1
1: 0
2: 0
3: 3
4: 48
Right 981713635 4:147732372-147732394 CTCACGAAGCGGAACTCGAGAGG 0: 1
1: 0
2: 0
3: 2
4: 18
981713630_981713635 3 Left 981713630 4:147732346-147732368 CCCGTGGTTCCGGGAGAGGATCC 0: 1
1: 0
2: 1
3: 11
4: 102
Right 981713635 4:147732372-147732394 CTCACGAAGCGGAACTCGAGAGG 0: 1
1: 0
2: 0
3: 2
4: 18

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981713635 Original CRISPR CTCACGAAGCGGAACTCGAG AGG Exonic