ID: 981713635

View in Genome Browser
Species Human (GRCh38)
Location 4:147732372-147732394
Sequence CTCACGAAGCGGAACTCGAG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 21
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 18}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981713632_981713635 -6 Left 981713632 4:147732355-147732377 CCGGGAGAGGATCCGCGCTCACG 0: 1
1: 0
2: 0
3: 1
4: 41
Right 981713635 4:147732372-147732394 CTCACGAAGCGGAACTCGAGAGG 0: 1
1: 0
2: 0
3: 2
4: 18
981713630_981713635 3 Left 981713630 4:147732346-147732368 CCCGTGGTTCCGGGAGAGGATCC 0: 1
1: 0
2: 1
3: 11
4: 102
Right 981713635 4:147732372-147732394 CTCACGAAGCGGAACTCGAGAGG 0: 1
1: 0
2: 0
3: 2
4: 18
981713627_981713635 12 Left 981713627 4:147732337-147732359 CCTCGACAGCCCGTGGTTCCGGG 0: 1
1: 0
2: 0
3: 3
4: 50
Right 981713635 4:147732372-147732394 CTCACGAAGCGGAACTCGAGAGG 0: 1
1: 0
2: 0
3: 2
4: 18
981713631_981713635 2 Left 981713631 4:147732347-147732369 CCGTGGTTCCGGGAGAGGATCCG 0: 1
1: 0
2: 0
3: 3
4: 48
Right 981713635 4:147732372-147732394 CTCACGAAGCGGAACTCGAGAGG 0: 1
1: 0
2: 0
3: 2
4: 18

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981713635 Original CRISPR CTCACGAAGCGGAACTCGAG AGG Exonic
901668258 1:10838648-10838670 CTCAGGAAGCGGTAATTGAGGGG - Intergenic
913138267 1:115913703-115913725 CTCACAAAGCTGAAGTCCAGAGG - Intergenic
915677397 1:157544417-157544439 CTGAAGAAGCGGAACCGGAGCGG + Exonic
1065382146 10:25101445-25101467 CTCAGGAAGTGGAACTCTAAAGG - Intergenic
1078099150 11:8319466-8319488 TTCACGAAGGGAAAGTCGAGGGG - Intergenic
1085050447 11:73377432-73377454 CTCACCAAGCTGAACTCCTGAGG - Intronic
1096091708 12:48906391-48906413 CTCAGGAGGCTGAACTCGGGAGG - Intronic
1123630823 15:22258462-22258484 CCGAAGAAGCGGACCTCGAGCGG - Intergenic
1133836437 16:9371793-9371815 CTCACGTAACAGAACTCGAGAGG + Intergenic
1143924128 17:10354738-10354760 CTCACGAAGGGGAAGTCGAAGGG + Exonic
1147918082 17:43900475-43900497 CTGAGGAAGCGGAGCTCCAGAGG - Intronic
955681508 3:61506169-61506191 CTCACGAAGAGGAACAAAAGGGG - Intergenic
981713635 4:147732372-147732394 CTCACGAAGCGGAACTCGAGAGG + Exonic
1001553705 5:172622228-172622250 CTCACCAGGCGGAAGTGGAGTGG + Intergenic
1002489694 5:179566171-179566193 CTCACCAAGCAGCACTTGAGAGG + Intronic
1002930247 6:1629417-1629439 CTCAGGAAGCGGGACTCGGTGGG + Intronic
1005268534 6:24138715-24138737 CTCAAGAGGGGGAACTGGAGAGG - Intronic
1007345115 6:41223280-41223302 CTCACAAGGTGTAACTCGAGAGG + Intergenic
1035037642 7:155905802-155905824 CTCAAGAAGCTGAATTCCAGAGG - Intergenic
1035403937 7:158586822-158586844 CACACGCGGCGGAACACGAGCGG + Intronic
1193349544 X:80444728-80444750 CACACGAAGAGGCACTTGAGTGG - Exonic