ID: 981716318

View in Genome Browser
Species Human (GRCh38)
Location 4:147756194-147756216
Sequence AGGTATTAGCAGAAGCTGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 161}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981716318_981716323 25 Left 981716318 4:147756194-147756216 CCAGTCAGCTTCTGCTAATACCT 0: 1
1: 0
2: 1
3: 7
4: 161
Right 981716323 4:147756242-147756264 TCCCTAGCCCCAAGTAAGTCTGG 0: 1
1: 0
2: 0
3: 9
4: 100
981716318_981716325 26 Left 981716318 4:147756194-147756216 CCAGTCAGCTTCTGCTAATACCT 0: 1
1: 0
2: 1
3: 7
4: 161
Right 981716325 4:147756243-147756265 CCCTAGCCCCAAGTAAGTCTGGG 0: 1
1: 0
2: 1
3: 19
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981716318 Original CRISPR AGGTATTAGCAGAAGCTGAC TGG (reversed) Intronic
903685184 1:25126349-25126371 ATGTATTAGGAGAAAGTGACTGG + Intergenic
905589362 1:39149164-39149186 AGGTATTTGCAGGAACTGATAGG + Intronic
907597345 1:55732128-55732150 AGTTATCTGCAGAAGATGACAGG - Intergenic
907613839 1:55903170-55903192 CGGTATTAGCACAAGCTCATAGG - Intergenic
915500640 1:156314412-156314434 AGGAATTAACACAAGATGACAGG + Intronic
916106331 1:161435329-161435351 AGTTATTTGCAGAAGATGGCAGG + Intergenic
917958593 1:180125167-180125189 AGGTGTGAGCAGAAGCAGAAAGG + Intergenic
919946905 1:202326121-202326143 AGGGATTAGAATAAGCTGATAGG - Intergenic
920588432 1:207192263-207192285 GGATATTACCATAAGCTGACTGG + Intergenic
922781048 1:228252583-228252605 AGTTATCTGCAGAAGATGACAGG + Intronic
923565000 1:235069962-235069984 AGGCGTTGGCAGGAGCTGACCGG - Intergenic
1063868601 10:10393840-10393862 GTGTATGAGCAGAAGCTGCCTGG + Intergenic
1070596210 10:77834782-77834804 GGGTCTGAGCAGAAGCAGACAGG + Intronic
1073572240 10:104590161-104590183 AGGTGTTAGCAGGAGCACACTGG - Intergenic
1074177965 10:111030093-111030115 AGGTACCAGCAAATGCTGACGGG - Intergenic
1076819839 10:132932712-132932734 GGGTCTTTGCAGAAACTGACAGG + Intronic
1083826151 11:65205190-65205212 AGCTGTGAGCAGAAGCTGGCAGG + Intronic
1084434302 11:69129860-69129882 AGGAACCAGCAGAAGCTGGCAGG + Intergenic
1087245044 11:95825444-95825466 AGGAATTAACAGAAGATGACTGG + Intronic
1087369872 11:97269951-97269973 TGGTATTATGAGAAGCTGAATGG - Intergenic
1089786910 11:120914281-120914303 TGGTAATAACAGCAGCTGACAGG + Intronic
1094629652 12:32160230-32160252 AGGGATTAGCCGAGGCTGCCTGG - Intronic
1098749845 12:74279564-74279586 AGTTATCTGCAGAAGATGACAGG - Intergenic
1101264129 12:103066095-103066117 AGTTATCTGCAGAAGATGACAGG - Intergenic
1103022466 12:117547214-117547236 AGGGACTAACAGAAGCTGAATGG - Intronic
1105444700 13:20442976-20442998 AGGCAGTATCAGCAGCTGACAGG + Intronic
1106363181 13:29051098-29051120 AGGTAATGGCAGAAGCGGAGAGG + Intronic
1107983578 13:45755999-45756021 AGTTATCTGCAGAAGATGACAGG + Intergenic
1108010928 13:46009083-46009105 AGGTATAAGCAAAATCTGATAGG + Intronic
1108904275 13:55449944-55449966 AGTTATTTGCAGAAGATGGCAGG - Intergenic
1110246286 13:73327852-73327874 TGGTATTAGCCAAAGCTCACAGG + Intergenic
1111865402 13:93762041-93762063 AGTGATTACCAGAGGCTGACGGG - Intronic
1113640577 13:111954099-111954121 TGGTAGGAGCAGAAGCTGCCAGG + Intergenic
1114298499 14:21352372-21352394 ATGTCTTGGCAGAAGGTGACAGG + Exonic
1115059714 14:29173867-29173889 AGTTATCTGCAGAAGATGACAGG - Intergenic
1116158382 14:41236692-41236714 AGCTATCTGCAGAAGGTGACAGG + Intergenic
1116415069 14:44669285-44669307 AGTTATTTGCAGAAGATGGCAGG - Intergenic
1117421902 14:55555087-55555109 AGGTATTGCCTGAAGCTGACCGG - Intergenic
1118398138 14:65355020-65355042 AGGCAGTAGGAGAAGCTGCCAGG - Intergenic
1125514608 15:40310924-40310946 ACTTATTAGCAGACACTGACAGG + Intergenic
1128487704 15:68111229-68111251 AGGATTGAGCAGATGCTGACAGG - Intronic
1130905406 15:88236861-88236883 AGGCAATGGCAGATGCTGACTGG + Intronic
1140565253 16:76034887-76034909 AGGAAGTAGCAGGAGCTGAGCGG - Intergenic
1143388011 17:6543548-6543570 AGGTATTGGCCGATGCTTACTGG + Intronic
1155172768 18:23279303-23279325 AGATATAAGCAGAAGTTGATGGG - Intronic
1157429663 18:47614257-47614279 AGCAATGTGCAGAAGCTGACTGG - Intergenic
1159743309 18:72200253-72200275 AGGCATGAGCAGAAACTCACTGG + Intergenic
1160741693 19:689232-689254 AGGGGTTAGCAGGAGATGACGGG + Intronic
1161324502 19:3656918-3656940 AGTCATAAGCAGAAGCTGTCAGG + Intronic
1165410145 19:35654831-35654853 AGGCATCAGCAGAAGGAGACAGG - Intronic
1167844206 19:52147320-52147342 AGGTATTAGTAGAAACTCATTGG - Intergenic
1167869167 19:52353320-52353342 AGGTATTAGCAAAAGCCCAATGG - Intronic
926575523 2:14576181-14576203 TGATATAAGCAGAAGCTGTCTGG - Intergenic
928850657 2:35741399-35741421 AGGAATTAACAGAAGATGACTGG - Intergenic
930931213 2:56885988-56886010 AGGGATTAACAGAAGCTCAAAGG - Intergenic
932505731 2:72229526-72229548 AGGTATTATCAGAGGGAGACAGG + Intronic
933265687 2:80178412-80178434 AGTTATCTGCAGAAGATGACAGG + Intronic
935425113 2:102911356-102911378 AGTTATTTGCAGAAGATGGCAGG + Intergenic
936053519 2:109243188-109243210 AGGTCTGAGCAGTAGCTGAGAGG + Intronic
939648266 2:144729210-144729232 AGGTAACAGAAGAAGATGACAGG - Intergenic
940770292 2:157832347-157832369 AGGTATCAGAAGAAACTAACAGG + Intronic
943538546 2:189182946-189182968 AGGTACTAGCAGAAGAAGAAAGG - Intergenic
945045876 2:205781380-205781402 AGGTAGGAGCAGAAACAGACCGG - Intronic
945772805 2:214066141-214066163 TGGAATTAGCAAAAGGTGACAGG - Intronic
947137984 2:226994099-226994121 AGGAATTAGAAGAGGCAGACTGG - Intronic
948921263 2:241066992-241067014 AGGTGTCAGCAGGAGCTGCCAGG + Intronic
1168906474 20:1407977-1407999 AAGTAGTATCAGAAGCTGCCAGG + Intergenic
1170092312 20:12604140-12604162 AGGTATCTGCAGAGGATGACAGG + Intergenic
1171454159 20:25257726-25257748 AGGTTTTATAAAAAGCTGACAGG - Intronic
1172012640 20:31854878-31854900 TGGTATGACCAGAAGCTGGCAGG - Intronic
1177279342 21:18959942-18959964 AGCTATGAGCAGTTGCTGACAGG - Intergenic
1177766209 21:25460473-25460495 AGGTATAAGCAGAAACTTTCAGG - Intergenic
1178012657 21:28305146-28305168 AGTTATCAGCAGAAGATGGCAGG - Intergenic
1180892075 22:19296724-19296746 AGCTCTTAGCAGAAGCTGAAAGG + Intergenic
1183412537 22:37663670-37663692 AGGTGGCAGCAGAGGCTGACTGG - Intronic
1183574860 22:38681779-38681801 GGGCATTAGCAGCAGCTGAGAGG - Intergenic
1184692691 22:46124347-46124369 TGGTGTGAGCAGAAGCTGGCAGG - Intergenic
949393263 3:3586624-3586646 AAGAATTATGAGAAGCTGACAGG - Intergenic
950689395 3:14643654-14643676 AGGTAGATGCAGAAGCTGCCTGG - Intergenic
950969923 3:17176112-17176134 AGGTAATAGCAGAACCAGGCAGG - Intronic
951139033 3:19139696-19139718 AGGTATTGTCAGAAGCTTAGAGG + Intergenic
952817520 3:37458494-37458516 AGGTATTGGCTGGAGCTGTCTGG + Intronic
953585875 3:44200497-44200519 AGCTACAAGCAGAAGATGACAGG + Intergenic
953826720 3:46259271-46259293 AGGTATTTGCAAAAGCTTTCAGG + Intronic
956703897 3:71982917-71982939 AGTTATCTGCAGAAGATGACAGG + Intergenic
959008731 3:101049814-101049836 AGATATTAGCAAAAGCAGTCTGG + Intergenic
959575652 3:107930174-107930196 ATGTATAAGCAGAAGCTCAGGGG + Intergenic
963094394 3:141520334-141520356 AGGGATTGGCAGAAGCAGAGGGG + Intronic
968850517 4:3074709-3074731 AGGTAAAAGCAGAACCTGAGCGG - Exonic
970970535 4:21978438-21978460 AGGTATGATCAGAAGCTCTCTGG + Intergenic
971857654 4:32062863-32062885 AGTTATCTGCAGAAGATGACAGG + Intergenic
972762204 4:42117783-42117805 TGGTTTTTGCAGAAGATGACAGG + Intronic
973326055 4:48863259-48863281 AGGCATTAGCAGAAGCCCAAAGG - Intergenic
976034208 4:80795851-80795873 AGTTATTTGCAGAAGATGGCAGG + Intronic
977204714 4:94155654-94155676 AGTTATCTGCAGAAGATGACAGG - Intergenic
977430763 4:96928182-96928204 AGGTATCTGCAGAAGATGGCAGG - Intergenic
981716318 4:147756194-147756216 AGGTATTAGCAGAAGCTGACTGG - Intronic
987325972 5:16812000-16812022 AGGTCTTAGCAGGCGGTGACAGG + Intronic
988550677 5:32198106-32198128 ATGTATTAGCAGAGGCTAATAGG - Intergenic
988903960 5:35765330-35765352 AGGTATTATCAAAAGCAGGCTGG - Intronic
988932970 5:36054960-36054982 AGGTATGAGGAGAATATGACAGG - Intronic
992109883 5:73482906-73482928 AGTTATCTGCAGAAGATGACAGG + Intergenic
992809210 5:80370148-80370170 AGGTATTAGCAGCATGTGGCAGG + Intergenic
994177452 5:96726912-96726934 AGTTATTAGCACATGCTGAGCGG - Intronic
995427736 5:112043755-112043777 AGTTATTTGCAGAAGATGGCAGG + Intergenic
997212496 5:132085721-132085743 AGGTATCTGCAGGGGCTGACGGG - Intergenic
998600219 5:143577769-143577791 AGCTCTTAGCTGAAGCTCACAGG + Intergenic
999412218 5:151360851-151360873 AGGAATTAACAAAAGATGACTGG - Intergenic
1000034337 5:157432009-157432031 AGCAATTAACAGAAGATGACTGG + Intronic
1000223249 5:159234277-159234299 AGGTATCTGCAGAAGATGGCAGG + Intergenic
1003448171 6:6204492-6204514 ATGTATTAGCAGAACCAGAGAGG - Intronic
1005075963 6:21907843-21907865 AGATATTAGCAGAGGCTTACTGG + Intergenic
1009390114 6:63135106-63135128 AGTTATCTGCAGAAGATGACAGG + Intergenic
1011996274 6:93592933-93592955 AGGCAATAGCATAAACTGACAGG + Intergenic
1013203862 6:107928723-107928745 AGGTAATAGATGAAACTGACAGG - Intronic
1014136587 6:117896564-117896586 AGGCCTCAGCAGAAGCTGAGCGG + Intergenic
1016039367 6:139416244-139416266 AGGTATGAGTGGAAGCTGAGAGG + Intergenic
1016417011 6:143843532-143843554 AGGTATTACCGGAAGCAGCCTGG - Intronic
1016714574 6:147209995-147210017 ATGTAATAGGAGATGCTGACAGG + Intronic
1018564190 6:165134184-165134206 AAGTATTATCAGAAGCTAAAGGG + Intergenic
1028657833 7:93231508-93231530 AGCTATTAGCAGTTCCTGACAGG + Intergenic
1030298999 7:107956630-107956652 AGGCATAGGCAGAGGCTGACAGG - Intronic
1031236824 7:119187986-119188008 AGTTATCTGCAGAAGATGACAGG - Intergenic
1032714333 7:134492081-134492103 AGGAATTAGCTAAAGCAGACTGG + Intergenic
1032929816 7:136653565-136653587 TGGTATTGGCAGAATCTCACTGG - Intergenic
1033761764 7:144443314-144443336 AGGAATAGGCAGAGGCTGACAGG - Intergenic
1034547873 7:151800852-151800874 AGGTATCAACAGAAGCTCAATGG + Intronic
1035325721 7:158064690-158064712 AGTGATTTCCAGAAGCTGACTGG + Intronic
1036961617 8:13250290-13250312 AGGTCTTTGCAGAAGCTTAGTGG - Intronic
1038507413 8:28096601-28096623 AGGCAACAGCAGAAGCTGACAGG - Intronic
1039346462 8:36710790-36710812 AGGTCTGAGCAGGAGCTGAGAGG - Intergenic
1039593922 8:38774145-38774167 AGGGATAGGCAGAAGCTGCCTGG - Intronic
1039620840 8:38996213-38996235 AGGTAAGAGCAGAGGATGACCGG + Exonic
1041934551 8:63321300-63321322 AGTTATCTGCAGAAGATGACAGG - Intergenic
1043259973 8:78184223-78184245 AGCTATCTGCAGAAGATGACAGG + Intergenic
1046585788 8:116147749-116147771 AGTTATTTGCAGAAGATGGCAGG + Intergenic
1047123182 8:121929451-121929473 AAATATTAGCAGAAACTTACCGG + Intergenic
1047251444 8:123184353-123184375 AGGTCTTAGCAGAGTCTGAGAGG - Intronic
1048344951 8:133569584-133569606 AGATATTGGCAGAGGCTGAGGGG + Intronic
1049888725 9:47307-47329 GGGTATGAGGGGAAGCTGACAGG + Intergenic
1052442272 9:28512312-28512334 AGTTATCTGCAGAAGATGACAGG + Intronic
1052566547 9:30160631-30160653 AGGCACCAGCAGACGCTGACAGG - Intergenic
1052944755 9:34159371-34159393 AGGTAAGAGCAGTAGATGACTGG + Intergenic
1053363169 9:37503941-37503963 AGGCTTTATCAGAAGCTAACTGG + Intergenic
1053868851 9:42469421-42469443 AGTTATTCGCAGAAGATGGCAGG - Intergenic
1054087439 9:60759759-60759781 AGTTATTCGCAGAAGATGGCAGG + Intergenic
1055512121 9:77005411-77005433 AGGTCCGAACAGAAGCTGACAGG - Intergenic
1055515791 9:77031651-77031673 AGGAGTTAGCAGAAGTTGAAGGG - Intergenic
1057306510 9:93915493-93915515 AGGTTTTCTCAGAAGCTGAGAGG + Intergenic
1058630356 9:106980082-106980104 AGGTATTTGGAGAAGTTGAAAGG - Intronic
1059920272 9:119152520-119152542 ACTTATTAGCAGAAGCTATCTGG + Intergenic
1062165018 9:135103328-135103350 AGGTCTTGGCAGAAGCAGTCTGG + Intronic
1062580691 9:137228060-137228082 AGGTGTTAGCAGAAGCTGGCTGG + Intronic
1187457405 X:19454511-19454533 AGGTATCAGGGAAAGCTGACCGG + Intronic
1188260272 X:28015780-28015802 AGGTGTGAGAAGAAGCTTACAGG - Intergenic
1189154887 X:38746752-38746774 AGTTATTTGCAGAAGATGGCAGG + Intergenic
1190422085 X:50295321-50295343 AGGGATTCTCAGCAGCTGACTGG + Intronic
1190619901 X:52276461-52276483 AGGAATTAGCTCAAGCAGACTGG - Intergenic
1191941263 X:66483896-66483918 AGTTATCTGCAGAAGATGACAGG + Intergenic
1192465551 X:71352918-71352940 AGGTATTTTTAGAAGCTGTCCGG + Intergenic
1193832946 X:86310065-86310087 AGTTATCTGCAGAAGATGACAGG - Intronic
1194513420 X:94822284-94822306 AGTTATCTGCAGAAGATGACAGG + Intergenic
1195238489 X:102926618-102926640 AGGTATTATCAGAAGGTCACAGG - Intergenic
1197002284 X:121452889-121452911 AGTTATCTGCAGAAGATGACAGG - Intergenic
1197591864 X:128419355-128419377 AGTTATCTGCAGAAGATGACTGG - Intergenic
1198154313 X:133943693-133943715 ATGTATTTGGACAAGCTGACAGG + Intronic
1198439983 X:136653662-136653684 AGGTATTTAAAGAAGCTAACAGG - Intronic
1198511630 X:137357710-137357732 AGGGACTACCAGAAGCTGAAAGG + Intergenic
1200340497 X:155390672-155390694 AGTTATCTGCAGAAGATGACAGG + Intergenic
1202139028 Y:21701674-21701696 AGGAAAAAGCAGAAGCTGAAGGG - Intergenic