ID: 981716569

View in Genome Browser
Species Human (GRCh38)
Location 4:147757961-147757983
Sequence CAAGCTATGGCACACGTACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 37
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 34}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981716569_981716571 -4 Left 981716569 4:147757961-147757983 CCTGGTACGTGTGCCATAGCTTG 0: 1
1: 0
2: 0
3: 2
4: 34
Right 981716571 4:147757980-147758002 CTTGCTTTGTGCACCCCTATTGG 0: 1
1: 0
2: 0
3: 11
4: 107
981716569_981716575 23 Left 981716569 4:147757961-147757983 CCTGGTACGTGTGCCATAGCTTG 0: 1
1: 0
2: 0
3: 2
4: 34
Right 981716575 4:147758007-147758029 ATAAACGTTACATTAGATAAAGG 0: 1
1: 0
2: 0
3: 13
4: 240

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981716569 Original CRISPR CAAGCTATGGCACACGTACC AGG (reversed) Intronic
903073822 1:20745774-20745796 CAAGCTAGGTTACACGTATCAGG + Intronic
903180751 1:21603639-21603661 CTGGCTCTGGCACAGGTACCAGG + Intronic
906195989 1:43931103-43931125 CAAGCTGTGGCAGCCGTCCCAGG + Exonic
907717578 1:56941672-56941694 CAAATTATGAAACACGTACCTGG + Intronic
909787253 1:79629668-79629690 CAAGCTTTGACAGAGGTACCAGG - Intergenic
921735701 1:218625519-218625541 CAAGCTATGACATCCATACCAGG + Intergenic
1069574253 10:69515672-69515694 CAAGCTCTGGCACAAGGTCCTGG + Intergenic
1083550897 11:63589614-63589636 CAGGCTATGCCACACAGACCTGG + Intronic
1099433475 12:82617086-82617108 CAAACTCTGGCACAAGTCCCAGG - Intergenic
1104222806 12:126801804-126801826 CAAGCAATGGCAAATGTCCCAGG + Intergenic
1122700065 14:103582251-103582273 CCAGCTATGGCTCAGGGACCAGG - Intronic
1126426423 15:48531509-48531531 AAAGCAATGGCAAAGGTACCAGG + Intronic
1128028267 15:64458082-64458104 CAAGCTAGGGTACACTTACTAGG - Intergenic
1129144756 15:73636587-73636609 CAAGCTGAGACACACTTACCTGG + Intergenic
1132678916 16:1131740-1131762 CAAGAGAAGGCACACGTCCCAGG + Intergenic
1148426263 17:47599859-47599881 CACGCTATGGCACTCGAGCCTGG - Intronic
1153595102 18:6717105-6717127 GAAGATATGGCACAGGTCCCAGG - Intergenic
934765606 2:96878470-96878492 CAAGCTGTGGCACAGGTAGCAGG + Exonic
938005292 2:127785111-127785133 CAAACTATGGCATTCATACCTGG - Intronic
938869951 2:135464737-135464759 CAAGCTGTGGAATACGTACATGG - Intronic
1176002356 20:62838277-62838299 CAGGCTCTGGCACACGGCCCAGG - Intronic
966626180 3:182019496-182019518 CAAGCCATGGTACCCATACCAGG - Intergenic
970440282 4:16075890-16075912 CTAGCTATGGCCCTCGTACTCGG - Exonic
980622804 4:135330990-135331012 CAAGCTTTGGCTCACCAACCTGG - Intergenic
981716569 4:147757961-147757983 CAAGCTATGGCACACGTACCAGG - Intronic
1001395450 5:171416395-171416417 CAAGCTACGGTACCCTTACCTGG + Intergenic
1012475157 6:99608843-99608865 GAAGCTATTGCAGACTTACCCGG + Exonic
1017994852 6:159522817-159522839 CAAGCCATGGCACACCAGCCTGG + Intergenic
1018803388 6:167240240-167240262 CAAGCTATGGCACCGGCTCCCGG - Intergenic
1019471481 7:1223801-1223823 CAAGCTACTGCACAGGTCCCAGG + Intergenic
1039143416 8:34418845-34418867 CAAGCTATGGCACAGGGTCATGG - Intergenic
1048829219 8:138459775-138459797 CAAGCTATGGCAAAGGGAACTGG + Intronic
1055377652 9:75667334-75667356 CAAGCTATGGCAAACCCACCTGG + Intergenic
1187474103 X:19594839-19594861 CAATCTATGGCACTTGAACCAGG + Intronic
1192232845 X:69277951-69277973 CAAGCTATGTCCCACCTGCCTGG - Intergenic
1198478122 X:137015590-137015612 CAAGCCATTGCACTCGAACCTGG + Intergenic
1198568506 X:137930848-137930870 CAAACTAGGGCACACCTACTTGG - Intergenic