ID: 981718840

View in Genome Browser
Species Human (GRCh38)
Location 4:147778815-147778837
Sequence CAGGGAATGAATTCTGTTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 165}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981718834_981718840 20 Left 981718834 4:147778772-147778794 CCTCTTGCTCCATTTCATTTTAA 0: 1
1: 0
2: 2
3: 34
4: 454
Right 981718840 4:147778815-147778837 CAGGGAATGAATTCTGTTGGAGG 0: 1
1: 0
2: 0
3: 15
4: 165
981718835_981718840 11 Left 981718835 4:147778781-147778803 CCATTTCATTTTAATAAGTGTTG 0: 1
1: 1
2: 4
3: 57
4: 620
Right 981718840 4:147778815-147778837 CAGGGAATGAATTCTGTTGGAGG 0: 1
1: 0
2: 0
3: 15
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981718840 Original CRISPR CAGGGAATGAATTCTGTTGG AGG Intronic
902674709 1:18000656-18000678 AAGGGAATGAGTTCCGTTGGTGG + Intergenic
906164967 1:43679362-43679384 CAGTCAATTAATTCTGATGGTGG - Intronic
909537558 1:76755207-76755229 CAGTGAATGGACTCTGATGGGGG + Intergenic
911778697 1:101847295-101847317 GAGGAAATGGATTCTGTTGATGG - Intronic
913051618 1:115121485-115121507 CAGGGGGTGAATTCTGGTGGGGG - Intergenic
915669917 1:157479435-157479457 CTGGAAATGGAGTCTGTTGGTGG + Intergenic
916164100 1:161949447-161949469 CAGGTAATAAAGCCTGTTGGAGG - Intronic
918135139 1:181665891-181665913 TAAAGAATGAATTCTGTTTGGGG - Intronic
920680677 1:208070112-208070134 CAGGGCATGCATTCTCATGGTGG - Intronic
921448721 1:215277517-215277539 CAGGGAAAGAATTATATTGTGGG - Intergenic
921691658 1:218157902-218157924 CAGGGACTGAATTCCCTTGATGG + Intergenic
922167897 1:223130929-223130951 CAGGGCATCAATGCTGTTGGTGG + Intronic
923376856 1:233372908-233372930 CAGGGAATTAAGTTTGGTGGAGG - Intronic
1064297599 10:14092435-14092457 CTGGGAATGGACTCTGTTGCTGG + Intronic
1064781052 10:18838449-18838471 CAGTGAAGGAAATCTATTGGCGG + Intergenic
1065181545 10:23131192-23131214 CAGGAAATGGATACAGTTGGAGG + Intergenic
1068657762 10:59592325-59592347 CTGGGATTGAAATCTGTTGCTGG - Intergenic
1068716914 10:60198925-60198947 CATGGAATGAATTATTTTGTTGG + Intronic
1072024069 10:91436418-91436440 CAGGGTAAGTATTCTGTTTGTGG + Intronic
1074046658 10:109845569-109845591 CAGGGAAAGAATTCTTTTTTAGG + Intergenic
1074902550 10:117831477-117831499 AAGGGAATGTCTTGTGTTGGAGG - Intergenic
1075196467 10:120363842-120363864 AAGGGATTGTATTCTGGTGGGGG - Intergenic
1079216265 11:18514969-18514991 CAGGAAATAAATTCTGCTGGGGG - Intronic
1080124580 11:28717950-28717972 CAGGGAATGAATTTTGTCTCAGG - Intergenic
1085449355 11:76622736-76622758 CAGGCAATGGGTCCTGTTGGGGG - Intergenic
1085835785 11:79955201-79955223 GAGGAAATGAATTCACTTGGTGG - Intergenic
1086186419 11:84022300-84022322 CAGAGACTGAATTCTGTTGCTGG - Intronic
1087394891 11:97584869-97584891 CAGGGATAAAAATCTGTTGGGGG - Intergenic
1091473413 12:751156-751178 CAGGGCAAGACTTCTGTAGGTGG + Intergenic
1092912784 12:13162817-13162839 CAGGTTATAAATTCTGTTGCTGG + Intergenic
1093211520 12:16314518-16314540 CAGGCATTGAATGGTGTTGGTGG - Intergenic
1094571218 12:31643114-31643136 CACAGAATGAATTCTGTTAAAGG - Intergenic
1094741204 12:33291124-33291146 CAGTAAATTAATTTTGTTGGGGG + Intergenic
1096464325 12:51839884-51839906 CAGGGAATGTTTTCTGAGGGAGG - Intergenic
1102364101 12:112316507-112316529 CACGGAAGGCATTCTCTTGGTGG - Intronic
1104539911 12:129654607-129654629 CAAAGCATGAATTTTGTTGGGGG - Intronic
1105992393 13:25635619-25635641 CAGGGAATGCTGTCTGTTGGAGG + Intronic
1107115066 13:36738173-36738195 CAGGTACTGAATGTTGTTGGAGG - Intergenic
1107733062 13:43367769-43367791 CAGGGAAGGAATCCTGGAGGGGG + Intronic
1109580872 13:64332385-64332407 CAGGGAATGAATACTGATAAAGG + Intergenic
1112302991 13:98247310-98247332 CAGGGTGTGTACTCTGTTGGTGG + Intronic
1113608177 13:111625024-111625046 CAGGGAAGGAGTGCTGTTTGCGG - Intronic
1113838433 13:113344940-113344962 CAGGGAATGAATTTTATAGCAGG - Exonic
1113948684 13:114059288-114059310 CAGGGCCTGAATTAGGTTGGGGG - Intronic
1117556928 14:56895500-56895522 AAGGACATGAATTCTGCTGGAGG + Intergenic
1119878025 14:78076900-78076922 CTGGCAATAAATTCTGTTGGGGG - Intergenic
1120735357 14:88046445-88046467 TAGAGAATGAATTGGGTTGGAGG + Intergenic
1120781482 14:88489945-88489967 CTGGGAAGGAATACTGATGGAGG + Intronic
1121596664 14:95168587-95168609 CAGGAAAGGAACTCTCTTGGGGG - Intergenic
1122346537 14:101064499-101064521 CAGGGAAAGGATTCTGCTGTCGG + Intergenic
1125298733 15:38231693-38231715 CAGGGACTGTATTCTGTTTCTGG + Intergenic
1125832178 15:42724795-42724817 CAGGGAGCGAACTCTGATGGAGG + Intronic
1131458510 15:92602098-92602120 CAGGGGAAGAATGCTGGTGGAGG - Intergenic
1132568845 16:635376-635398 CAGGGCCTGGCTTCTGTTGGGGG - Intronic
1132719112 16:1307316-1307338 CAGGGACTGGATTCTGGGGGAGG + Intergenic
1136103249 16:28010753-28010775 CAAGGAATGATTTCCGGTGGAGG - Intronic
1139335246 16:66226720-66226742 CGGGGGATGAGTTCTGTGGGAGG - Intergenic
1140833253 16:78770573-78770595 CAGGGAAGGACGTCTGTGGGAGG + Intronic
1144205262 17:12975351-12975373 CAGGGAATGAATGGAGGTGGCGG + Intronic
1147680076 17:42237550-42237572 CAGTGAATGAATTCTAGTGTGGG + Intronic
1151362103 17:73595318-73595340 CAGGTAATGAATGCCGTTTGTGG + Intronic
1153653350 18:7260969-7260991 TTGGGAATGATTTCTGTTGAAGG + Intergenic
1154343434 18:13523433-13523455 AAGGGACTGAATTCTGCTGACGG + Intronic
1155072017 18:22325033-22325055 CAGGGAGTGAATTCCTTGGGCGG + Intergenic
1157917969 18:51688046-51688068 CAGAGAATGCCTTCTGCTGGTGG - Intergenic
1158557937 18:58490572-58490594 CAGGGCTTGGTTTCTGTTGGGGG - Intronic
1159449603 18:68583534-68583556 CAGGGTATGAAGGCTTTTGGTGG - Intergenic
1161704736 19:5814312-5814334 CAGGGAAGGGTTTCTGGTGGAGG + Intergenic
1165102974 19:33449837-33449859 CAGGGAATGAAATCTGTCCGGGG + Intronic
1166193202 19:41189580-41189602 CAGTGAATGAATTGTGGAGGAGG + Intergenic
1166260971 19:41640562-41640584 CAGGGAATGAATCCTCTGCGGGG + Intronic
928536715 2:32248255-32248277 GAGGGGATGCATTCAGTTGGTGG - Intronic
928603927 2:32926851-32926873 CAGGGGAGGAATGCTGATGGGGG - Intergenic
929754457 2:44752533-44752555 CAAGGAAAGGATTCTGTGGGTGG - Intronic
930173709 2:48279250-48279272 TAGGGAATGAAATCTGATGATGG + Intergenic
932269605 2:70398197-70398219 AAGGGAAAGAATGCTATTGGGGG - Intergenic
932476007 2:72006321-72006343 CAGGGAAGGTATCCTGGTGGAGG + Intergenic
932614973 2:73226110-73226132 CAGGGCATGAGGTCTGGTGGGGG - Exonic
940558258 2:155260280-155260302 CATGGAATGTTTTCTGGTGGTGG + Intergenic
941920317 2:170843904-170843926 CAGGAAATGAATCATGTTAGTGG + Intronic
944308743 2:198208046-198208068 CACGGAATGAACTGGGTTGGGGG + Intronic
945672770 2:212821939-212821961 AAGGGAATGTTCTCTGTTGGGGG + Intergenic
948043026 2:234919459-234919481 CTGGGAATGAAGTGTGTGGGAGG - Intergenic
1169386655 20:5155766-5155788 AAGTGAATTAATTTTGTTGGGGG + Intronic
1172202673 20:33137959-33137981 CAGGATAAGAATTCTGTTGTGGG - Intergenic
1173285819 20:41670694-41670716 CACGGACTGAGTTCAGTTGGAGG + Intergenic
1174656399 20:52175871-52175893 CAGAAAATGAATTATTTTGGGGG - Intronic
1176034485 20:63029537-63029559 CAGGGAAGGAAGCCTTTTGGGGG - Intergenic
1178708897 21:34896903-34896925 GAGAGAATGAAATTTGTTGGAGG + Intronic
1179110818 21:38443486-38443508 CACTGAATGAATTCTGTTTTGGG - Intronic
1179370606 21:40802973-40802995 AAGGAAAGGAATTCTGTTAGTGG - Intronic
951051049 3:18093917-18093939 CAATGTATGAATTCTTTTGGTGG + Intronic
951305184 3:21051686-21051708 GAAGTAATGAACTCTGTTGGTGG + Intergenic
953691845 3:45126362-45126384 GTTAGAATGAATTCTGTTGGAGG - Intronic
955576507 3:60370519-60370541 AAGAGAAGGAATTCTGTTGTGGG - Intronic
955965356 3:64383430-64383452 CAGATAATGAATTCTTTAGGCGG - Intronic
956124313 3:65997108-65997130 CAGGGAATGGTTTTTGTTGTAGG + Intronic
963840459 3:150099638-150099660 AAGGGAAGGAATTGTCTTGGAGG + Intergenic
964750527 3:160049992-160050014 CAGGAAATTAATACAGTTGGTGG - Intergenic
964982700 3:162705185-162705207 CAGGGAATGCATTCTTTTCTAGG + Intergenic
965792626 3:172405950-172405972 CAGGTGAAGAGTTCTGTTGGAGG + Intergenic
967211445 3:187173856-187173878 CAGTGAATGAATTCTGTGCACGG - Intronic
967878440 3:194282184-194282206 CAGGGAATGGTTTCTGAGGGAGG - Intergenic
970503164 4:16699363-16699385 CAGGGAATGAAGTCTGTAGCAGG - Intronic
972663594 4:41142436-41142458 CAGAAAATGAAATGTGTTGGTGG + Intronic
973123049 4:46546557-46546579 CAGGGAATGAATGGAGCTGGAGG - Intergenic
973268017 4:48230785-48230807 CAGGGAATGAATGCTGTGAGGGG - Intronic
981718840 4:147778815-147778837 CAGGGAATGAATTCTGTTGGAGG + Intronic
982791169 4:159593231-159593253 CAGGAGAGGCATTCTGTTGGGGG - Intergenic
983037729 4:162888043-162888065 CAGAGAATGAGTTGTGTTGAAGG - Intergenic
983992628 4:174139748-174139770 CAGGGAATATATTTTGGTGGAGG - Intergenic
984947754 4:184983199-184983221 GAGGCAAGGAAGTCTGTTGGTGG - Intergenic
989490960 5:42052693-42052715 AAGGGAGTGTATTCTATTGGTGG - Intergenic
993740020 5:91527204-91527226 CATGGAATGATTTCTGGTGTGGG + Intergenic
994364685 5:98899732-98899754 CATGTAATTAATTCTGTTGTAGG + Intronic
995553051 5:113299404-113299426 CATGAAATGATTTTTGTTGGTGG + Intronic
996282345 5:121745773-121745795 CAGGGAATGAAGCATGTTTGGGG + Intergenic
996759459 5:126972657-126972679 CAGAAAATGAAACCTGTTGGGGG - Intronic
997701582 5:135904740-135904762 CTGGGAATGATTACTTTTGGAGG + Intergenic
997758363 5:136421571-136421593 CAGGGCATGACATCTGTTGGTGG - Intergenic
1000804145 5:165767665-165767687 CTGGGAATGAATTGTGGTGATGG + Intergenic
1001071789 5:168591811-168591833 AAGGGAAGGCATTCTGGTGGTGG + Intergenic
1004843760 6:19615320-19615342 CAGGTAATGAATGGTGGTGGTGG - Intergenic
1004857050 6:19761930-19761952 CAGGGGATGAATCCTGTTTCAGG - Intergenic
1007283035 6:40726253-40726275 GAGGGAATGAGTTGTGCTGGAGG - Intergenic
1009475625 6:64087520-64087542 CAGAGAATGTATACTGTAGGAGG - Intronic
1010779669 6:79930993-79931015 CAGGGTTTGACTTCAGTTGGTGG - Intronic
1011560098 6:88605478-88605500 AAGAGAAGGAAGTCTGTTGGAGG + Intergenic
1012247684 6:96944054-96944076 CAGGGAACGAATACAGCTGGGGG - Intronic
1012414836 6:99002000-99002022 CAGGAGATGGATCCTGTTGGGGG + Intergenic
1013488596 6:110621560-110621582 CAGGGAAAGAGTCCTGTTTGGGG - Intronic
1015592530 6:134836072-134836094 CCAGGAAGGAATGCTGTTGGAGG + Intergenic
1015645866 6:135387375-135387397 CAGGGCATGGGTTCGGTTGGGGG - Intronic
1015983574 6:138863570-138863592 CAGGGTATGAACGCTGTTGCTGG + Intronic
1017705268 6:157116654-157116676 GAGGAAATGTATTCTGTTGCTGG + Intronic
1017866813 6:158451156-158451178 CAGGGACTGAATTCTGTTCTTGG - Intronic
1018319970 6:162597859-162597881 CTAGGAATGAATTCTATTGCAGG - Intronic
1018867475 6:167757531-167757553 GTGAGAATGCATTCTGTTGGAGG - Intergenic
1020286862 7:6688835-6688857 CATGGAATACATTTTGTTGGAGG - Exonic
1023206506 7:37756460-37756482 GAAGGAATGAATTCTGTTCTGGG - Intronic
1023257853 7:38329623-38329645 CATGGAATGAATTCTGCTGCAGG + Intergenic
1023417765 7:39949244-39949266 GAGGGAAATAATGCTGTTGGTGG - Intergenic
1024718684 7:52109645-52109667 GAGAGAATGAATTCTGTCTGTGG + Intergenic
1028362553 7:89986577-89986599 AAGGAAATGAACTCTGTTGAAGG + Intergenic
1028504064 7:91552433-91552455 CAGGTAATGAATTCAGCTTGAGG - Intergenic
1028521103 7:91731702-91731724 GAGGGAATGAATGTTGTTTGGGG + Intronic
1028585723 7:92449019-92449041 AAGGGAATGAGCTCTGTTGCAGG + Intronic
1029942713 7:104497045-104497067 CAAGGAATGATTTCTCCTGGTGG - Intronic
1030398638 7:109019917-109019939 CAGAAAATGCATTCTGTTTGAGG + Intergenic
1030673487 7:112362455-112362477 CAGGGAATGAAAGCTGATGAAGG - Intergenic
1030822351 7:114110911-114110933 CAGTGAATGAATGCTTATGGAGG - Intronic
1031421240 7:121553775-121553797 CTGGGAATGTATTTTGTTGCAGG + Intergenic
1032136500 7:129284129-129284151 TAAGGACTGAATTCTGTTAGTGG + Intronic
1032239264 7:130148469-130148491 CAGGAAATAAATTATGCTGGTGG - Intergenic
1032568663 7:132975575-132975597 CAGGGATGGAATTTTTTTGGTGG - Intronic
1033796165 7:144847945-144847967 AAGTGCATGAATTCTTTTGGTGG + Intergenic
1036429154 8:8673922-8673944 CTGGGAAGGAATTCAGTTGGTGG + Intergenic
1038149123 8:24927063-24927085 AAGGGAATGAACTCAGTGGGTGG - Intergenic
1038446023 8:27604923-27604945 CCTCGTATGAATTCTGTTGGCGG + Exonic
1040548320 8:48419432-48419454 CAGAGAAGGAAGTGTGTTGGAGG - Intergenic
1043575244 8:81649133-81649155 CAGGGCTTGAATTGTGATGGAGG + Intergenic
1044255679 8:90057596-90057618 CTTGGAATGAATTTTGTTTGTGG + Intergenic
1046424353 8:114027125-114027147 CTGGCAATCAATTCTTTTGGAGG + Intergenic
1047358435 8:124145095-124145117 CAGGGTATGACTTGAGTTGGTGG - Intergenic
1047589564 8:126313090-126313112 TAGGGAATGGGTTGTGTTGGAGG - Intergenic
1050789046 9:9442764-9442786 CTGGGAATGTCTTCTTTTGGCGG + Intronic
1050789798 9:9453145-9453167 CAGGCAATGCATTGTGTGGGGGG - Intronic
1055329681 9:75170961-75170983 CAGGGAAGAAAGCCTGTTGGTGG - Intergenic
1055462920 9:76536332-76536354 CAAGGAATGTATTTTGTTGGAGG + Intergenic
1055577183 9:77671761-77671783 CAGGGAATGAACCCTGGAGGTGG + Intergenic
1055927178 9:81522759-81522781 CAGGGAGTGGATTTTTTTGGTGG - Intergenic
1056349533 9:85735364-85735386 CAGGGAATGGATTATGGGGGAGG + Intronic
1059754125 9:117276503-117276525 TAGGGAGTGAAATATGTTGGTGG - Intronic
1203360122 Un_KI270442v1:212754-212776 CAGGGACTGTATTCGGGTGGGGG + Intergenic
1186863045 X:13691932-13691954 CAGGCAATAAATTCTGTTCTAGG - Intronic
1187798005 X:23025705-23025727 CAGGGAATGTTTTCTCTTTGGGG - Intergenic
1188817179 X:34729753-34729775 GAGGGAATAAATTCTGCTGAAGG - Intergenic
1200703302 Y:6420521-6420543 CATGCAATGAATTCTCATGGGGG + Intergenic
1200808100 Y:7453340-7453362 AATGGCATGAATCCTGTTGGCGG + Intergenic
1201030808 Y:9744186-9744208 CATGCAATGAATTCTCATGGGGG - Intergenic
1201682069 Y:16657337-16657359 CTGTGAATGGATTCTGTTGATGG + Intergenic