ID: 981721142

View in Genome Browser
Species Human (GRCh38)
Location 4:147802661-147802683
Sequence CAGTGTAAGTAGAAGTTACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 160}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981721142_981721146 -10 Left 981721142 4:147802661-147802683 CCCTGTAACTTCTACTTACACTG 0: 1
1: 0
2: 1
3: 17
4: 160
Right 981721146 4:147802674-147802696 ACTTACACTGGTTTTTTGTTGGG 0: 1
1: 0
2: 2
3: 18
4: 238
981721142_981721147 -2 Left 981721142 4:147802661-147802683 CCCTGTAACTTCTACTTACACTG 0: 1
1: 0
2: 1
3: 17
4: 160
Right 981721147 4:147802682-147802704 TGGTTTTTTGTTGGGTCTCTAGG 0: 1
1: 0
2: 1
3: 21
4: 339
981721142_981721148 8 Left 981721142 4:147802661-147802683 CCCTGTAACTTCTACTTACACTG 0: 1
1: 0
2: 1
3: 17
4: 160
Right 981721148 4:147802692-147802714 TTGGGTCTCTAGGACCATGCAGG No data
981721142_981721149 9 Left 981721142 4:147802661-147802683 CCCTGTAACTTCTACTTACACTG 0: 1
1: 0
2: 1
3: 17
4: 160
Right 981721149 4:147802693-147802715 TGGGTCTCTAGGACCATGCAGGG 0: 1
1: 0
2: 0
3: 10
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981721142 Original CRISPR CAGTGTAAGTAGAAGTTACA GGG (reversed) Intronic
901794575 1:11672955-11672977 CATTGTAAGTACAGGTGACATGG + Intronic
903999203 1:27328914-27328936 CAGTTTAAGGAGAACTCACAGGG - Intronic
904739913 1:32666174-32666196 CACTGTAAGGAGAAGATAAACGG + Intronic
906261166 1:44391628-44391650 CAGTGGAGCAAGAAGTTACAAGG - Intergenic
906439811 1:45831576-45831598 CAGTCTAGGTAAAACTTACATGG - Intronic
907586713 1:55624573-55624595 GAGTATGAGTAGAAGTGACATGG + Intergenic
908711300 1:67018638-67018660 CATTGAAAGTAGAAATTCCAAGG - Intronic
909127117 1:71686563-71686585 AAATGTAAGCAGAAGTGACATGG - Intronic
909801242 1:79810458-79810480 GTATTTAAGTAGAAGTTACATGG + Intergenic
910017744 1:82548067-82548089 CAGTGTTAGAAGTAGTCACATGG - Intergenic
910062883 1:83114697-83114719 CAGTGTAAGTAGCATTTACAGGG - Intergenic
912874003 1:113337303-113337325 CAGTGAAAGAAAGAGTTACATGG - Intergenic
917536787 1:175880028-175880050 CAATGTAAATGGAAGTGACATGG - Intergenic
920958715 1:210644918-210644940 CGCAGTAAGTGGAAGTTACAAGG - Intronic
923381447 1:233423534-233423556 CAGTGTGTGCAGAGGTTACATGG + Intergenic
1063257419 10:4343562-4343584 TAGTCTAAGCAGCAGTTACAAGG - Intergenic
1064207480 10:13336224-13336246 CAGGGTAAGTAGGAGCTACCCGG - Exonic
1064294146 10:14062855-14062877 CAGTGAAAGGGGAAGATACATGG + Intronic
1065677941 10:28197939-28197961 CAATGTAACCAGATGTTACAGGG + Intronic
1065746203 10:28844857-28844879 CAGAGTAATTAGAAGTTAAAAGG + Intergenic
1066122270 10:32300864-32300886 CAGTATAACAAGATGTTACAGGG + Intronic
1069099664 10:64304174-64304196 CCATGTAAGTAGAAGCTACTAGG - Intergenic
1070418499 10:76212812-76212834 CAGTGTAGGTGGAAGTGACTTGG + Intronic
1072344050 10:94485328-94485350 CAGTGTCAGTTGAAATTATATGG + Intronic
1072412985 10:95222071-95222093 CAGAGTAAGTAGAAAATAAAAGG + Intronic
1074437972 10:113450746-113450768 CAGAGTTAGAAAAAGTTACATGG - Intergenic
1074667363 10:115743592-115743614 CAGTTCAAGTAGAAGTGAAAGGG + Intronic
1075637594 10:124040077-124040099 CATTGTGAGTAGAATTTTCAAGG - Intronic
1082971351 11:59025094-59025116 CAGTATACTTAGAAGTTAGAAGG - Intronic
1087236795 11:95728217-95728239 TAGTGAAAGTAGAAATGACATGG - Intergenic
1088746278 11:112807642-112807664 CAGGGGAAGTGGAAGTTAGAGGG + Intergenic
1089996926 11:122917193-122917215 AAGTGGAAGTAGAAGTACCAAGG + Intronic
1091182085 11:133614482-133614504 AAGTGAAATTAGAAGTCACATGG - Intergenic
1093142512 12:15525663-15525685 GATTGTAAGTAGAAGTCACATGG - Intronic
1093798828 12:23346773-23346795 CAGTGTAAGTAGCTGTGCCAAGG - Intergenic
1097191647 12:57222312-57222334 CAGGGTAAGGAGAGGTTCCAGGG - Intronic
1097409410 12:59232495-59232517 TATTGTCAGTAGAAGTTACAAGG - Intergenic
1098155272 12:67591465-67591487 CAGTGTAAGCTAAAGTTAAAGGG + Intergenic
1099865335 12:88272885-88272907 CAGTGTCAGTGGAAGTTATGTGG + Intergenic
1102232855 12:111275571-111275593 TAGTGTCAGGAGAAGTGACAGGG - Intronic
1104535207 12:129612175-129612197 CAGTGTAGGGAGAACTTACAGGG - Intronic
1105543890 13:21338006-21338028 CTGTGTAAGTAGAAGTATGAAGG + Intergenic
1105623178 13:22088515-22088537 GAGTGTGAGTAGATGTGACATGG + Intergenic
1109023924 13:57136246-57136268 CAATGTGAGCAGAAGTGACAAGG + Intergenic
1109459139 13:62631080-62631102 CCATGTAAGAAAAAGTTACATGG + Intergenic
1109832433 13:67809041-67809063 CTGTGTAAGTATTTGTTACATGG - Intergenic
1111244591 13:85519177-85519199 CAGTGTAAGTGTAAAATACAGGG + Intergenic
1112936824 13:104810746-104810768 AAGCATAAGTAGAAATTACATGG + Intergenic
1113599192 13:111556226-111556248 CAGTGAAAGTAAAAGGTGCACGG - Intergenic
1119534144 14:75387157-75387179 CAGTGAAAGTAGAAATTTGAGGG + Intergenic
1120416752 14:84228980-84229002 GAGTGAAAGTAGAAACTACAGGG - Intergenic
1120501321 14:85300595-85300617 CAGTGAGAGCAGAAGCTACAAGG + Intergenic
1120594756 14:86419827-86419849 CAAAGTAACTATAAGTTACATGG + Intergenic
1121032239 14:90668188-90668210 CAGAATAGGTAGAAATTACAAGG + Intronic
1124873682 15:33569423-33569445 GAGAGTAAGTAGAAGTTATAAGG - Intronic
1124927561 15:34086164-34086186 CAGTGTTCGTAGAAGATTCAAGG - Intronic
1124958844 15:34379509-34379531 AAGAGTCAGTTGAAGTTACAAGG + Intronic
1129982549 15:79887295-79887317 AAGTGTAAATATAAGTTAAAAGG + Intronic
1130416186 15:83696739-83696761 CAGTGTTTGTAGCAGTGACAAGG + Intronic
1131745434 15:95442415-95442437 CAGAAGAAGTAGAAGTGACACGG + Intergenic
1137018599 16:35399916-35399938 CAGTGTAAGTAGTAGAGTCAGGG - Intergenic
1137025057 16:35465742-35465764 CAGTGTAAGTAGTAGTGTCAGGG - Intergenic
1142555193 17:770488-770510 CAGTGTAAGCTGGAGCTACAGGG - Exonic
1147502197 17:40976317-40976339 CAGTGTCAGTGGAAGCTGCATGG - Intergenic
1149365163 17:55936560-55936582 CTGATTAAATAGAAGTTACAAGG + Intergenic
1149580176 17:57744565-57744587 CAGTTCAAGTGAAAGTTACAGGG + Exonic
1150117490 17:62566638-62566660 CAGTGTAAACAGCAGTTACATGG + Intronic
1150640206 17:66944489-66944511 CAGGGAAAGAAGCAGTTACAGGG - Intergenic
1151125102 17:71836379-71836401 CATTGTCAGTAGAATTTATAAGG - Intergenic
1153938604 18:9955389-9955411 CAGTATAAGTATGCGTTACAGGG + Intronic
1155267148 18:24105313-24105335 CAGTGTGAATAAAAGATACAGGG + Intronic
1158745256 18:60192488-60192510 CAGTGTCAGTAGAAATTTTAGGG - Intergenic
1158837501 18:61346548-61346570 GAGAGTAAGTAGAATTTTCAAGG + Intronic
1159276921 18:66233493-66233515 CAGTGTGAGTAGGTTTTACATGG - Intergenic
1160423324 18:78764242-78764264 CAGGGTAAGACGAAGTTATAAGG + Intergenic
1165820768 19:38674309-38674331 CAGTGTGAGTTGAAGTCAGAGGG + Intronic
1166083815 19:40461913-40461935 CAGAGGAAGTACAAGTTACTGGG - Intronic
1167563857 19:50243818-50243840 CAATGCAAGTAGAATTTAAAAGG - Intronic
925021823 2:575660-575682 CAGTGAAAGTGGAAATAACAAGG + Intergenic
925456668 2:4022075-4022097 CAGTGTAGGTGGGAGTCACAGGG + Intergenic
930532008 2:52600334-52600356 CTGTGTAAGAAAAAGCTACATGG - Intergenic
935153782 2:100464098-100464120 CAGTGAGAGGAGAAGCTACAAGG - Intergenic
936152688 2:110030302-110030324 CAGTGTAGGCAGGAGTCACAGGG - Intergenic
936191992 2:110341110-110341132 CAGTGTAGGCAGGAGTCACAGGG + Intergenic
936431059 2:112463550-112463572 CACTGAAAGTAGAATATACAGGG + Intergenic
936889325 2:117350669-117350691 CAATGTAAGTAAAACTCACAAGG + Intergenic
940548513 2:155120536-155120558 CACTTCAAGTAGAAGTTACTAGG - Intergenic
942648308 2:178139214-178139236 CAATTTAAGGAGAAGTTATAAGG + Intergenic
943422009 2:187677147-187677169 CAGTGAAAGTAGAAATCAAAAGG + Intergenic
944346106 2:198667558-198667580 CAGGGTGAGTGGAAGCTACATGG + Intergenic
944472195 2:200065854-200065876 CATGTTAAGAAGAAGTTACAGGG - Intergenic
946281099 2:218666013-218666035 CAGTGGAAGTAGTGGTAACAGGG + Exonic
947559500 2:231135164-231135186 GAGTGAAAATAGAAGTTAAATGG + Intronic
947560305 2:231143571-231143593 GAGTGTGAATAGAAGTTATACGG + Intronic
1170636823 20:18113640-18113662 CGGTGAAAGTAGTACTTACAAGG - Intergenic
1172902973 20:38348190-38348212 CAATGCAAGTAGCAGTTACCAGG - Intronic
1178781858 21:35611165-35611187 CAGTGTAACAACAATTTACATGG - Intronic
1179127053 21:38599739-38599761 CACTGTATCTAGAAGTGACAGGG + Intronic
1179562576 21:42225253-42225275 CAGTGTAAATATAAGTTTCTCGG + Intronic
1180789974 22:18570451-18570473 CAGTATATTTAGAAGTTACAAGG - Intergenic
1181231765 22:21424864-21424886 CAGTATATTTAGAAGTTACAAGG + Intronic
1181246886 22:21510004-21510026 CAGTATATTTAGAAGTTACAAGG - Intergenic
1183886543 22:40888113-40888135 CAGAGAAAGTAGAGGTTACTGGG - Intronic
949143825 3:670440-670462 AAATGTATGTGGAAGTTACAGGG + Intergenic
952848427 3:37708268-37708290 AAGAGTGAGTAGAAGTTCCAAGG + Intronic
953512349 3:43554937-43554959 CAGTGTCAGTGGAAGCCACATGG - Intronic
959750824 3:109832557-109832579 CAGTGTAAGTAATAGTCCCACGG - Intergenic
960200508 3:114829651-114829673 GATTCTAGGTAGAAGTTACACGG + Intronic
962683095 3:137820677-137820699 CAGTCAAAGGAGAAGTTAAAGGG + Intergenic
964177025 3:153836209-153836231 CATTTTAAGTAGGAGTTACAAGG - Intergenic
964717479 3:159737470-159737492 AAGAGTAAGTACAAGTTACTGGG - Intronic
966983987 3:185163259-185163281 ATGTGTAAATAGAAGCTACAAGG - Intergenic
968723565 4:2226501-2226523 CAATGTAAGTGGTAGTTACATGG + Intronic
969065420 4:4476055-4476077 CAGTCTTAGTAGATTTTACATGG - Intronic
970056754 4:11982543-11982565 CAGTTAAAGAAGAAGTTAAATGG - Intergenic
976295432 4:83466473-83466495 AAATGTGAGTAGAAGTGACATGG + Intronic
977531785 4:98208965-98208987 GAGTGGAAGTAGAAGTGAGACGG + Intergenic
979544667 4:121926342-121926364 CAGTGGAAATACAAGTGACATGG - Intronic
981240354 4:142468671-142468693 CAGTGTGTGCAGAAATTACAGGG - Intronic
981721142 4:147802661-147802683 CAGTGTAAGTAGAAGTTACAGGG - Intronic
983354661 4:166640823-166640845 CAGTGTAAAAATTAGTTACATGG - Intergenic
983509680 4:168594218-168594240 TAGTGTAAGTAGAAGTGAAAAGG + Intronic
984017562 4:174443946-174443968 AAGTGTGAGTGGAAGCTACATGG - Intergenic
988117395 5:26913555-26913577 CAGTGTAGGTTGCAGATACAAGG - Intronic
989034727 5:37158460-37158482 AAATCTAAGTAGAAGTGACATGG + Intronic
990992265 5:61697893-61697915 GACTGTAAGTAGAAATGACATGG - Intronic
991116668 5:62963145-62963167 CAGTGTGTGCAGAAGTCACATGG + Intergenic
991119250 5:62992920-62992942 CAGTGTGTGTAGAGATTACATGG + Intergenic
991405503 5:66297255-66297277 AAGTCTAATTAGAAGTGACAAGG - Intergenic
991445337 5:66694128-66694150 CATTGAAAGAATAAGTTACATGG + Intronic
992710432 5:79448133-79448155 CATTATAGGTAGAAGTGACAAGG - Intronic
993126127 5:83837914-83837936 CAGAGAAAGTAGAAGCTACAGGG - Intergenic
993536416 5:89092240-89092262 TAGTGTAAGTGGAGGTGACAAGG - Intergenic
994364648 5:98899228-98899250 CAGTGCAAATAGTTGTTACATGG + Intronic
995178157 5:109202716-109202738 CAGTCAAAGGAGAAGATACATGG + Intergenic
995453351 5:112326812-112326834 GATTGAATGTAGAAGTTACATGG - Intronic
995710911 5:115034610-115034632 TACTGTGAGTAGAAGTTTCAGGG + Intergenic
995805987 5:116053054-116053076 CACTGTAATTAGAAATTAGATGG - Intronic
996068400 5:119106244-119106266 GAGTGAAAGTAGAAGCTGCAAGG + Intronic
1001392450 5:171390323-171390345 CAGTGTGACTGGAATTTACATGG - Intronic
1002848319 6:968420-968442 CAGTGTATGCAGAACTTCCAAGG - Intergenic
1003408204 6:5840378-5840400 CTGTGTAAGTAGAAGTATGAAGG - Intergenic
1004217438 6:13715867-13715889 CAGGGTCACTGGAAGTTACAAGG - Intergenic
1005985653 6:30872904-30872926 CAGTGTCAGTGGAGGTAACATGG - Intergenic
1007811971 6:44492801-44492823 CAGTGGAAGTAGGAGATACAGGG - Intergenic
1008117942 6:47574513-47574535 CAGTGTAAATAAAAATTAGAGGG + Intronic
1008791121 6:55235239-55235261 CAGTCTGAATAGTAGTTACAAGG + Intronic
1009489752 6:64274689-64274711 CAATATAAGTAGGAGTGACAGGG - Intronic
1017032837 6:150239206-150239228 CAATATACGTACAAGTTACATGG + Intronic
1017782085 6:157723253-157723275 CAGTGAAAATAGAGGTTAGAAGG - Intronic
1018881628 6:167888264-167888286 CAGTGTAGAGAGAAATTACAGGG + Intronic
1020802320 7:12747100-12747122 CAGTGTAATTACAATTAACATGG + Intergenic
1021022925 7:15626100-15626122 GTGTGTAAATAGAAGTGACATGG + Intronic
1022753542 7:33259333-33259355 CAGTGTACGTAGGAGTCACCTGG + Intronic
1023067384 7:36391242-36391264 CAGTGTAAGTGAAAGATACTTGG - Intronic
1023213754 7:37836989-37837011 CAGTTTAAGTAACAGATACATGG + Intronic
1024130674 7:46349539-46349561 CAGTGTAATAAGAGGTTACACGG - Intergenic
1024173525 7:46814286-46814308 GAGTGTGAGTGGAAGTGACATGG - Intergenic
1024936385 7:54716191-54716213 CAAGGTAAGCAGCAGTTACAAGG + Intergenic
1025973788 7:66353503-66353525 CAGTGAGAGAAGACGTTACAGGG - Intronic
1026595417 7:71730620-71730642 CAGTGTCAGGAGAGGTGACATGG + Intergenic
1027502814 7:78975516-78975538 CAGTGAAAGTAGTACTTAGAGGG + Intronic
1028720372 7:94023630-94023652 CACTGTAATTAGATGTTACCAGG - Intergenic
1034710882 7:153190561-153190583 CAGTCTCAGAAGAAGTCACAGGG - Intergenic
1037416240 8:18652876-18652898 CAGTTTTAGTAGATGTTAAAAGG + Intronic
1038363826 8:26910379-26910401 CAGAGTAGTTAGAAGTTTCATGG + Intergenic
1039829507 8:41201702-41201724 CAGTAGAAGTGGAAGTGACAGGG + Intergenic
1043382987 8:79722821-79722843 CAATGTAGGAAGAACTTACAGGG + Intergenic
1047019842 8:120763417-120763439 CAGTGTAACTACAAGCTACAAGG - Intronic
1056499180 9:87190895-87190917 CAGGGTAAGAAGACATTACAGGG + Intergenic
1056996290 9:91463337-91463359 CAGCAAAAGTAGAAGTTAGAAGG - Intergenic
1057641747 9:96830381-96830403 CAGTGTCAGTAGAAGCCCCATGG + Intronic
1185931523 X:4208594-4208616 CAATGAAAGGAGAAATTACAGGG - Intergenic
1186255255 X:7711301-7711323 CAGAGGAAGTGGAAGCTACAGGG - Intergenic
1188095182 X:26012498-26012520 CACTTCAAGTAGAAGTCACAGGG - Intergenic
1188184178 X:27092966-27092988 GAGTGTGTGTAGAAGTTTCAGGG - Intergenic
1195264247 X:103164510-103164532 CAGGGTCAGTGGAAGCTACATGG - Intergenic
1195640336 X:107167653-107167675 CAGTTGAAGTATAAGGTACAAGG + Exonic
1200270526 X:154678502-154678524 TAATGTAAGTGGAAGTGACATGG + Intronic