ID: 981723908

View in Genome Browser
Species Human (GRCh38)
Location 4:147828349-147828371
Sequence CTGGTGGCTCAAAACCAACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 154}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981723908_981723913 17 Left 981723908 4:147828349-147828371 CCCTGTTGGTTTTGAGCCACCAG 0: 1
1: 0
2: 0
3: 11
4: 154
Right 981723913 4:147828389-147828411 CCTCATCTCTATGCTTAAATAGG 0: 1
1: 0
2: 0
3: 6
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981723908 Original CRISPR CTGGTGGCTCAAAACCAACA GGG (reversed) Intronic
900355388 1:2259420-2259442 CTGGTGGCATGAAACCACCACGG - Intronic
900437368 1:2637565-2637587 CTGGTGCCTCACAGCCAGCATGG - Intronic
900521450 1:3107238-3107260 CTGGTCCCCCAAGACCAACAGGG - Intronic
900739648 1:4322940-4322962 CAGGTGGTTCAAAATCAGCATGG + Intergenic
902840329 1:19070241-19070263 CTGGTGGCTCAGATGCAATAGGG - Intergenic
902970034 1:20041655-20041677 CTAGTGGCTTATAACCTACATGG + Intronic
903283577 1:22263769-22263791 CTGGCTGCCCAAGACCAACAGGG - Intergenic
903307925 1:22426898-22426920 CAGATGGCTCAAAACCTGCAGGG + Intergenic
903694591 1:25197506-25197528 CGGGTGGCTCAAAGACAGCAAGG - Intergenic
905060151 1:35133228-35133250 CTAGCGGCTCATAACCTACATGG + Intergenic
905088440 1:35406177-35406199 CATGTGCCCCAAAACCAACAGGG - Intronic
905622289 1:39458593-39458615 ATTTTGGTTCAAAACCAACACGG - Intronic
906646259 1:47477660-47477682 CTGGAGGCTCAAATCCAAAGAGG - Intergenic
907771410 1:57468559-57468581 CTGGTGGCTCTGAACAGACAGGG + Intronic
910049719 1:82959917-82959939 CTAGCGGCTCATAACCTACATGG - Intergenic
910493163 1:87795392-87795414 CTGGAGGCTCAGAACCAGCAAGG - Intergenic
912744193 1:112231503-112231525 AGGGGTGCTCAAAACCAACAGGG + Intergenic
916151504 1:161796701-161796723 CTGGTCACCCAAAACCATCAAGG - Intronic
919999139 1:202782940-202782962 CTGGGAGCTCAAGACCAACCTGG + Intronic
920071940 1:203308347-203308369 GAGGTGGCTCAAAAGCTACAGGG + Exonic
921920929 1:220668304-220668326 CAGGTTGCTTAAAACCAGCAAGG + Intergenic
923770226 1:236931762-236931784 ATGGTTGCTCACAACCAACTAGG + Intergenic
924041733 1:239990630-239990652 ATGATGGCTCAGAACAAACATGG + Intergenic
924895847 1:248337358-248337380 CTAGTGGCTCGTAACCTACATGG + Intergenic
1063118995 10:3091339-3091361 CTGGTGGGTCCAAACCAAGCTGG + Intronic
1063493161 10:6483614-6483636 CTGGTGGTTAAAAATGAACATGG + Intronic
1068526938 10:58141170-58141192 CAGGTGGCTCAAAGGCAACTTGG - Intergenic
1072458640 10:95599647-95599669 CTGGGAGCTCAAGACCAACCTGG + Intergenic
1074393866 10:113080699-113080721 ATGGTGTCTCTTAACCAACATGG + Intronic
1075314403 10:121440569-121440591 CTGGTTGCCAAAAACCTACAAGG + Intergenic
1075601868 10:123775382-123775404 CTGGTGGCTCATCACGAACTAGG + Intronic
1079230888 11:18647842-18647864 CTAGTGGCTTATAACCTACATGG - Intergenic
1080188336 11:29518956-29518978 CTAGTGGCGCAAAACTTACAGGG - Intergenic
1080555267 11:33410517-33410539 CAGGTGGTTCAGAACCAAGATGG - Intergenic
1085988374 11:81811005-81811027 CTAGTGGCTCCTAACCTACATGG - Intergenic
1088277553 11:108103348-108103370 CTGGGGGTTCAAGACCAACCTGG + Intronic
1088794981 11:113260242-113260264 GTGGTGGCTGAGAACCAGCAAGG + Exonic
1088811097 11:113393141-113393163 CTGGGGGCTCAAAATCTACTAGG + Intronic
1090508530 11:127346043-127346065 CTGGTGGCTCCAAAGCTACATGG + Intergenic
1091682685 12:2538282-2538304 CTGATGGCTTAAAATCAACCAGG + Intronic
1091779332 12:3204126-3204148 CTTGTGGCTCAGATCCAAAAAGG + Intronic
1096317391 12:50580025-50580047 CTTGTGGGGCAAAAACAACAGGG + Intronic
1097958944 12:65513815-65513837 CTGATGTCTCAAAACAAAAATGG + Intergenic
1104409494 12:128546473-128546495 CTGGAAGCTCAGAACAAACAGGG - Intronic
1104595497 12:130117580-130117602 CTACAGGCTCAAAACCAAAAGGG - Intergenic
1113341236 13:109428100-109428122 TGGGTGGCCCACAACCAACACGG + Intergenic
1122832442 14:104406066-104406088 CATGTGGCTAAAAACCAAGAAGG + Intergenic
1125849417 15:42889048-42889070 CTAGTGGCTTATAACCTACATGG - Intronic
1129241964 15:74257265-74257287 CCTGGGGCTCAAAACCCACAAGG + Intronic
1132736476 16:1388448-1388470 CTGGAGGCCATAAACCAACAGGG + Intronic
1134792635 16:17003921-17003943 ATGGTTGCCCCAAACCAACATGG - Intergenic
1136929269 16:34404473-34404495 CTGGAGACGCAAAACCTACAGGG + Intergenic
1136975305 16:35007331-35007353 CTGGAGACGCAAAACCTACAGGG - Intergenic
1137552611 16:49450559-49450581 GGGGTGGCCCAAAACGAACAGGG - Intergenic
1140289633 16:73641013-73641035 CTGGAAGCTCAAAGACAACAGGG + Intergenic
1140304260 16:73788046-73788068 CTGGGAGCTAAAAAACAACATGG + Intergenic
1140921453 16:79542422-79542444 CTGGTGTCTCCCAAGCAACAGGG + Intergenic
1141689340 16:85587608-85587630 GTGATGGGGCAAAACCAACAGGG - Intergenic
1203094768 16_KI270728v1_random:1244283-1244305 AGGGTTGCTCAAAACCACCAGGG + Intergenic
1143437840 17:6942393-6942415 CTGGTGCTTCAATACCAACCTGG + Intronic
1144001375 17:11058197-11058219 GTGGTGGCTCTTAATCAACAGGG + Intergenic
1144520629 17:15950330-15950352 CTAGTGGCTTAAAACAAGCAGGG - Intronic
1145922500 17:28620905-28620927 CTACTGTCTCAAAACCACCAAGG + Intronic
1148680701 17:49471963-49471985 CTGATGGCTGAAAGCCAAGAAGG - Intronic
1149473132 17:56935679-56935701 CTGATGGAGCAAAACCAATACGG + Intergenic
1152849142 17:82621570-82621592 CAGGAGGCACAACACCAACAAGG + Intronic
1153519648 18:5939780-5939802 CCTGTGGCTGAAAACCATCATGG + Intergenic
1156214776 18:34986449-34986471 CAGGTGGAGCAAAACCAGCAAGG - Intronic
1157465302 18:47938882-47938904 CTGGTGCCTCAAAGACAACATGG - Intergenic
1160565607 18:79785027-79785049 CTGGCGGCTCAAACCCACCCCGG - Intergenic
1161457461 19:4376705-4376727 CTGGTGGCTAAGACCCAGCATGG - Intronic
1162121334 19:8471094-8471116 AAGGCGGCTGAAAACCAACACGG - Intronic
1164881407 19:31735486-31735508 CTGGTGGCTTAAGTCCAACATGG - Intergenic
1164890288 19:31817590-31817612 CGGGCGGATCAAAACCAGCATGG + Intergenic
1167525442 19:49980887-49980909 CTGGTGGCTCAGATCCATCTTGG - Intronic
925837270 2:7958691-7958713 CTGCTGGCTCCAAACCAGCATGG + Intergenic
929288274 2:40160927-40160949 CTGGAGTTTCAAAATCAACAAGG - Intronic
933460713 2:82580656-82580678 CTGGTGTCATAAAACCAACTAGG + Intergenic
933769999 2:85737518-85737540 CTGGGGGTTCAAAACCAGCCTGG - Intergenic
935406119 2:102711390-102711412 CTCGTGGCTCAGAACACACAAGG + Intergenic
935852937 2:107242865-107242887 CTGGTGGCTCAAAAGAAAGTAGG + Intergenic
937878284 2:126843295-126843317 CTGTTGGCTGACAACCAACCGGG - Intergenic
939364345 2:141213159-141213181 CTGGGGGTTCAAGACCAACCCGG - Intronic
940023710 2:149182670-149182692 GTGGATGCTCACAACCAACAAGG + Intronic
940400302 2:153241277-153241299 CAGTTGGATCAAAACCAACAGGG + Intergenic
940709999 2:157151089-157151111 ATGGTTGCTCAAAAGTAACAAGG + Intergenic
943908021 2:193525464-193525486 CTGGTGACTCAAGACCCACAGGG - Intergenic
945159454 2:206874282-206874304 CTGATGGCTCAAAAAAAATAAGG - Intergenic
947306435 2:228753501-228753523 CTGGTGGCAGAAACACAACAAGG + Intergenic
948048479 2:234961573-234961595 CATGGGGCTCAAAACCAACATGG - Intronic
1169817723 20:9675550-9675572 CTGGGAGCTCAAGACCAACCTGG - Intronic
1172358191 20:34294190-34294212 CTGATGGCTCAAAAGCACCAGGG + Intronic
1173687232 20:44932211-44932233 CTGGTGAGTCAAGACCCACAAGG - Intronic
1175735260 20:61381640-61381662 CTGGTGGCTCAAATCTTCCAAGG - Intronic
1177928865 21:27254485-27254507 CCAGTGGCTCAAGACCAGCATGG - Intergenic
1178278310 21:31258881-31258903 CTGGTGGTCCAAAGCCAACTGGG + Intronic
1178875926 21:36413848-36413870 TTGGGGGCTCACAACCAGCAGGG - Intronic
1183810760 22:40255217-40255239 ATGGTGAGTCAAAGCCAACAGGG + Intronic
1184813877 22:46855715-46855737 CGGCTGGCTCACAACCCACACGG - Intronic
949876264 3:8627987-8628009 CTGATGTCTCAAAAGAAACAGGG - Intronic
950151697 3:10692628-10692650 CTGGAGGTTCATAACCCACAAGG - Intronic
950311126 3:11958870-11958892 CCAGGGGTTCAAAACCAACATGG + Intergenic
952843640 3:37668745-37668767 CAGGTGGCTCAGAACAAACTTGG - Intronic
954596576 3:51830302-51830324 CTGGGTCCTCAAAACCAGCAGGG + Intronic
955303179 3:57803698-57803720 CTGGAGGCACAAATCCAACATGG + Intronic
955570091 3:60295481-60295503 CTGGTTGCTCAAAAACTACCTGG - Intronic
955729126 3:61965285-61965307 ACGGTGGCTCACACCCAACATGG + Intronic
955799418 3:62670567-62670589 CTGGTGACTCAAATACAGCAGGG - Intronic
955854132 3:63255078-63255100 CCAGTGGGTAAAAACCAACAAGG - Intronic
956396981 3:68836323-68836345 GTGGTGGCTCAAAATTAACAGGG + Intronic
958122016 3:89303103-89303125 CTAGGAGCTCAAGACCAACATGG - Intronic
959021919 3:101196925-101196947 CTGGTGGCTCAAGCCAAACTTGG + Intergenic
963723810 3:148896159-148896181 CTGGTCGTTGAAAACCACCAGGG - Intronic
966717579 3:183029349-183029371 CTGGTGACTTAAGACGAACATGG + Intronic
967306699 3:188066568-188066590 ATGGCAGCTTAAAACCAACAGGG + Intergenic
968953971 4:3708843-3708865 CTGGGGTCTCAAAACCAGGATGG + Intergenic
970069586 4:12142426-12142448 CTGGAGGTTCAAGACCAACTTGG + Intergenic
972628381 4:40822382-40822404 CTGGTGGCCCAAAACCCATTTGG + Intronic
973243244 4:47981441-47981463 CTGGTGTATCCAAACAAACAGGG + Exonic
977225009 4:94384591-94384613 CTAGCGGCTCATAACCTACATGG + Intergenic
981723908 4:147828349-147828371 CTGGTGGCTCAAAACCAACAGGG - Intronic
982066098 4:151656064-151656086 CTCCTGCCTCAAAACCAAAACGG - Intronic
985951846 5:3228043-3228065 TTGCTGCCTCAAAACAAACAAGG - Intergenic
989592990 5:43129279-43129301 CTGGTAGTTCAAGACCAGCATGG - Intronic
990201353 5:53379521-53379543 CTGCTGTCCTAAAACCAACATGG + Intergenic
990742704 5:58928411-58928433 ATGGTGGTTCAACACCATCAGGG - Intergenic
1004118735 6:12797766-12797788 CAGGTGGCACAAAACCCCCAGGG - Intronic
1005812587 6:29528815-29528837 CTGGAGGCTCAAAATGAGCAGGG - Intergenic
1006488883 6:34368577-34368599 CTGGTGGCTCACAACCTCCCAGG + Intronic
1007300587 6:40865018-40865040 CTAGTGGCTTATAACCTACATGG + Intergenic
1008405947 6:51118611-51118633 CTTGTGGCTCAGAACAAATATGG + Intergenic
1010435473 6:75825202-75825224 ATGGTAGCTCAAAATCAGCATGG - Intronic
1010677773 6:78764053-78764075 CTGGGGGCACCACACCAACATGG + Intergenic
1016243800 6:141960422-141960444 CGGGTGGTTTAAAACCAAGATGG - Intergenic
1018877015 6:167830265-167830287 CTGGTAAGTTAAAACCAACAGGG - Intronic
1022251116 7:28609665-28609687 CTGGTGCATCAAACTCAACAAGG - Intronic
1022520890 7:31006280-31006302 CTGGTGGCTCAGTCCCAACTGGG + Intergenic
1022689887 7:32638416-32638438 AAGGTGCCTCAGAACCAACAAGG + Intergenic
1025194312 7:56920694-56920716 CTTCAGGCTCAAAACCAAAAGGG - Intergenic
1025677639 7:63656251-63656273 CTTCAGGCTCAAAACCAAAAGGG + Intergenic
1028834955 7:95364692-95364714 TTGGTGGCTCAAAACTGCCAAGG - Intronic
1029672326 7:102041941-102041963 CTTTAGGCTCAAAACCAAAAGGG - Intronic
1032180490 7:129672551-129672573 ATAGTGTCTTAAAACCAACATGG + Intronic
1033362578 7:140648286-140648308 CTGGGGGTTCAAGACCAGCATGG + Intronic
1035685716 8:1522221-1522243 CTGGTGCATCAAACCCAACTGGG - Intronic
1036067289 8:5396070-5396092 TTGGTGGCACATAAACAACAAGG + Intergenic
1038216520 8:25566732-25566754 CTGCTGTTTGAAAACCAACATGG + Intergenic
1038977060 8:32711053-32711075 CTTGTAGCTAAAAACAAACAAGG - Intronic
1044483924 8:92727343-92727365 CTGCTGGCTCTAAACCTACTGGG + Intergenic
1045264561 8:100608429-100608451 TTAGTGGCTCCAAGCCAACATGG + Intronic
1053428363 9:38025829-38025851 CTGGTGGCTCCTCATCAACATGG - Intronic
1055768617 9:79692083-79692105 GTGGGGCCTCAAAACTAACATGG - Intronic
1057064179 9:92033478-92033500 CTGAGGGCACAAAACCAGCACGG + Intronic
1058769596 9:108217261-108217283 TTGGTAGCTCAAAATCAGCATGG + Intergenic
1059573976 9:115470341-115470363 CTGGATGCTCAAAGCCAGCAGGG - Intergenic
1060169136 9:121446492-121446514 CTGATGGGTCTAAAGCAACATGG - Intergenic
1060302654 9:122384333-122384355 CTGGTGACTCAGAGCGAACATGG - Intronic
1060520909 9:124293593-124293615 CTGGAGATTCAAAACCAACTGGG - Intronic
1185914386 X:4019177-4019199 CTGTTGGCTCAAAGCCTGCATGG + Intergenic
1187092748 X:16114606-16114628 CTGGTGGAAAAAAACCAATAAGG - Intergenic
1192713858 X:73618641-73618663 CTGCTGCCTGAAAACCAACTTGG - Intronic
1193825580 X:86222004-86222026 ATGGTGGCTCTAATCCAAAATGG - Intronic
1194661052 X:96628829-96628851 CTAGCGGCTCATAACCTACATGG - Intergenic
1194873433 X:99160366-99160388 CTAGTGGCTCATAACCTATATGG + Intergenic
1200060397 X:153481317-153481339 CTGCTGGGTCACAAGCAACAGGG - Intronic
1200370837 X:155722861-155722883 ATGGTTGCACCAAACCAACATGG - Intergenic