ID: 981725514

View in Genome Browser
Species Human (GRCh38)
Location 4:147843204-147843226
Sequence ATGGTTCAAAATCTCTGACA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 192}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981725514_981725518 0 Left 981725514 4:147843204-147843226 CCGTGTCAGAGATTTTGAACCAT 0: 1
1: 0
2: 0
3: 14
4: 192
Right 981725518 4:147843227-147843249 TCTTTCTGGATTCTTCACATGGG 0: 1
1: 0
2: 3
3: 35
4: 369
981725514_981725517 -1 Left 981725514 4:147843204-147843226 CCGTGTCAGAGATTTTGAACCAT 0: 1
1: 0
2: 0
3: 14
4: 192
Right 981725517 4:147843226-147843248 TTCTTTCTGGATTCTTCACATGG 0: 1
1: 0
2: 2
3: 105
4: 502

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981725514 Original CRISPR ATGGTTCAAAATCTCTGACA CGG (reversed) Intronic
902153151 1:14461202-14461224 AGGGTTCAAAATTTCTGGGAGGG + Intergenic
903964683 1:27079721-27079743 CTGGGTCAAAGTCTCTCACAGGG - Intergenic
907659561 1:56379294-56379316 CTGATTCAGAAACTCTGACATGG + Intergenic
908743445 1:67352417-67352439 ATGGTCCAAAATGGCTGCCAAGG + Intronic
909065437 1:70930746-70930768 ATGGTTCAAATTTTCTCACCTGG + Intronic
910581868 1:88837241-88837263 AATGTACGAAATCTCTGACAGGG - Intergenic
911025558 1:93432897-93432919 ATGGTTGGAAATTTCTGAAACGG - Intergenic
911769210 1:101717789-101717811 ATAGTTTAAAATCTCTTTCAAGG + Intergenic
912838681 1:113019738-113019760 AAGGTTTAACATCTGTGACAAGG - Intergenic
913042158 1:115037603-115037625 ATGACTCAAAATCTATGCCATGG + Intergenic
915445650 1:155973265-155973287 AAGGTTCTAAAGCTCTGATAAGG - Intronic
915883175 1:159694850-159694872 ATGATTCAAACTCTCTGCCTTGG + Intergenic
917807588 1:178627733-178627755 ACACTTTAAAATCTCTGACAGGG - Intergenic
921540828 1:216412858-216412880 ATTTTTTAAAATCTCTGTCATGG + Intronic
923016845 1:230133258-230133280 AATGTTCAAACTCTCTGACCCGG - Intronic
1063694795 10:8323705-8323727 ATGATTTACAATCTCTGCCAAGG + Intergenic
1064076881 10:12275941-12275963 AGGGTTAATAATATCTGACATGG + Intergenic
1064825203 10:19390995-19391017 ACAGTACAAAATCTCTAACATGG - Intronic
1064893521 10:20207940-20207962 ATGGTGCATAATCTCTGGCAAGG + Intronic
1065100856 10:22331969-22331991 AAGGTTGAAAATTTCTAACATGG - Intergenic
1071665848 10:87557586-87557608 ATGGTTTAAAATCTGGGAAAGGG - Intergenic
1072105755 10:92272070-92272092 GTTGTTCAAAATATCTGACTTGG + Intronic
1072490635 10:95902698-95902720 TTGGTTCAAAAACTCTGTGATGG + Intronic
1072499972 10:96004911-96004933 CTTGTTCAACTTCTCTGACATGG - Intronic
1073769800 10:106723799-106723821 AAGGTTCAGAATCTGTGCCATGG + Intronic
1075513812 10:123093702-123093724 ATGGTCCTGAACCTCTGACACGG + Intergenic
1076153721 10:128186654-128186676 AGGGTTTAAAATCTATGAGAGGG + Intergenic
1077840022 11:5964389-5964411 CTGGTTCAAAATCTCTGGACAGG - Intergenic
1078457439 11:11486181-11486203 ATGGTGCCAAGCCTCTGACAAGG - Intronic
1084855492 11:71982596-71982618 ATGGTCCTAAGTCTCTGACTTGG + Intronic
1086186587 11:84024777-84024799 AGAGTACAAAATCTCAGACAGGG + Intronic
1087789212 11:102389626-102389648 ATGGGTTAAATTCTCTGATATGG - Intergenic
1088965552 11:114717469-114717491 ATGTTTCAAAGTATCTGACATGG + Intergenic
1089189433 11:116643498-116643520 ATGGTGCATCATGTCTGACAAGG + Intergenic
1090726217 11:129529668-129529690 ATGGTTGAGAACTTCTGACATGG - Intergenic
1093386769 12:18566598-18566620 ATGGTTCAAAATTTTTAAAAAGG - Intronic
1096065699 12:48738315-48738337 CTGGCTCAGAATCTCTCACATGG + Intergenic
1097609619 12:61803255-61803277 TTAGTTCAAACTCTCTGACTAGG + Intronic
1098080647 12:66781291-66781313 ATGCTTCAAAAACTGTGCCAGGG + Intronic
1100806109 12:98285370-98285392 ATTATTCAAAATCCCTGAAAGGG - Intergenic
1101825184 12:108214839-108214861 ATGGTTCACAATTTTTTACATGG + Intronic
1102053104 12:109877624-109877646 ATGGTGGAAAATCCCTGACTTGG + Intronic
1102636440 12:114328461-114328483 TTGATTCAAGGTCTCTGACAAGG - Intergenic
1102756944 12:115349154-115349176 ATGATGCTGAATCTCTGACACGG - Intergenic
1103098648 12:118153110-118153132 ATGGTTCAAAATCTCTTCCCTGG + Intronic
1103342171 12:120226521-120226543 CTGATTCAAAATGTTTGACAAGG - Intronic
1103486247 12:121284708-121284730 CTGGACCAAAATCTCTAACAAGG + Intronic
1104625682 12:130352376-130352398 ATGTTTAAAAATATTTGACAGGG + Intronic
1106323571 13:28665780-28665802 AGGGATCAAATTATCTGACAAGG + Intronic
1109594206 13:64528199-64528221 ATGCTTCTATATCTTTGACATGG - Intergenic
1110094696 13:71502480-71502502 ATGGTTAAACAGCTCCGACAAGG - Intronic
1110598164 13:77341492-77341514 CTGGTTCATAGCCTCTGACAGGG + Intergenic
1111427942 13:88113717-88113739 ATGATTTAAGATCTCTTACAAGG - Intergenic
1113092974 13:106634090-106634112 ACTGCTCAAAATCTTTGACAGGG + Intergenic
1114411908 14:22508923-22508945 ATGGTTAAAACTCTTTGCCAAGG + Intergenic
1114928671 14:27438527-27438549 ATTCTACAAAATGTCTGACAAGG + Intergenic
1116174328 14:41447765-41447787 ATGAGTCAAAATTTCTGATAAGG - Intergenic
1116591658 14:46784325-46784347 TAGGTGCAAAATCTCTGAGATGG - Intergenic
1119752228 14:77087633-77087655 TTTGCTGAAAATCTCTGACAAGG + Intergenic
1121583987 14:95050365-95050387 ATGGATGAAAATCAGTGACATGG + Intergenic
1122570315 14:102694082-102694104 ATTTTTCAAGATCTCTCACATGG - Intronic
1126911499 15:53421955-53421977 ATGATTCCAACTCTATGACAGGG + Intergenic
1128444215 15:67742405-67742427 ATGTTTCAAAATGTCTGAGAGGG - Intronic
1129187212 15:73916211-73916233 CTGGCTCAAAGTCTCTTACAAGG + Intergenic
1130546490 15:84860306-84860328 CTGGATCAAAGACTCTGACATGG - Intronic
1130860322 15:87880272-87880294 ATGGTTCCAACTCTCAAACACGG - Exonic
1131783606 15:95886878-95886900 TTGGTTCAGAATCTTTCACAAGG - Intergenic
1132786618 16:1660377-1660399 GTGGTTCAAAGTCCCTGAGAAGG + Intronic
1135389411 16:22077425-22077447 ATAATTCAAAATCTCTGAAAGGG + Intronic
1135683372 16:24478062-24478084 AAGGTTCAAATTCTCTACCAGGG + Intergenic
1135790535 16:25390274-25390296 ATTGTACAGAATTTCTGACAAGG - Intergenic
1137428240 16:48397982-48398004 ATGGTTCTGAATCTCAGAAATGG + Intronic
1138724628 16:59122500-59122522 ATGGTACTCTATCTCTGACATGG - Intergenic
1140335485 16:74100937-74100959 ATCTTTAAAAATCTCTCACAGGG - Intergenic
1144351952 17:14405214-14405236 ATGGTTCCATATCTCAAACAAGG + Intergenic
1147703501 17:42410610-42410632 TTGGTTAAAAATATCTGAAAGGG + Intronic
1148993547 17:51687188-51687210 ATGGTGCAAAATTTCAAACATGG - Intronic
1150537946 17:66063752-66063774 ATAGGTCAAAGCCTCTGACATGG + Intronic
1150823185 17:68452151-68452173 ATGCTTCAACATCATTGACATGG + Intronic
1151517701 17:74606897-74606919 ATAGTCCAGTATCTCTGACAGGG - Intergenic
1152059655 17:78061751-78061773 ATGTTTCAAAATCTTAGAAATGG - Intronic
1153283257 18:3434040-3434062 ATGGTACAAGATCTCTGGTAGGG - Intronic
1153452942 18:5249742-5249764 ATGGTTCAAGATATCTGCTAGGG - Intergenic
1154243451 18:12674068-12674090 ATGAATCAAAATCTGTGGCAAGG + Intronic
1156120053 18:33832256-33832278 ATAGTTCAAACTATCAGACAGGG - Intergenic
1156305957 18:35878321-35878343 ATGATTGAAAATATCTGATAAGG - Intergenic
1160316598 18:77853793-77853815 ATTGCTCAAAATAACTGACAGGG + Intergenic
1161267871 19:3373322-3373344 AGGGTTCAAACTCTCTGCCAAGG - Intronic
1165806081 19:38581513-38581535 ACTGTTCAAAGTATCTGACATGG - Intronic
926312862 2:11686973-11686995 AAGGATCAAAAGCTATGACATGG - Intronic
928006197 2:27564179-27564201 ATGGTTAAAATTCTCAGAGAAGG + Intronic
929027901 2:37623072-37623094 ATTGTTCATAATTTTTGACAAGG + Intergenic
932007195 2:67938927-67938949 ATGGTTCAAACTCCCTGGCCTGG + Intergenic
932363873 2:71133417-71133439 ATTCTTCAAACTCTCTGAAATGG + Exonic
933591608 2:84239226-84239248 ATGGTTCAAAATCACCTAAAAGG + Intergenic
936602994 2:113918152-113918174 AGGGTTCAAATTCTTTAACATGG - Intronic
937569037 2:123333985-123334007 TTGGTTCAATAGCTCTGGCAGGG - Intergenic
938632396 2:133181147-133181169 ATGGTTCTAAATGTGTGTCAAGG + Intronic
939926656 2:148183272-148183294 ATGGTTCAAACTCTAAGATAAGG - Intronic
942314849 2:174688809-174688831 TTGGTTCAGGATCTCTCACAAGG + Intergenic
943879775 2:193127257-193127279 ATGTTTCAAAACATCTGATAGGG + Intergenic
945871196 2:215228145-215228167 GTGGTCCACAATCTCTGATAGGG + Intergenic
947937467 2:234020510-234020532 ATGGTTCAAAATAAGTGAAAGGG + Intergenic
1170170091 20:13400980-13401002 AGGGTTCAAAATCTACAACACGG + Intronic
1170401424 20:15988112-15988134 AAGTGTCAAAATCTCTAACATGG - Intronic
1175272402 20:57743689-57743711 ATGGTTGTCAATCTCTGATATGG - Intergenic
1178830142 21:36049252-36049274 TTGGTTAAAAATCTCAGCCAAGG + Intronic
1179051466 21:37892102-37892124 ATGTTTCAAAAGCTCCCACATGG - Intronic
1179079682 21:38159256-38159278 ATCCTTCAAAATCCATGACAGGG - Intronic
1179626457 21:42652341-42652363 ATGGTGCCAAAGCTCTGACACGG + Intergenic
949547414 3:5083860-5083882 ATGGGTGAAAATTTCTGACAAGG - Intergenic
949761281 3:7473536-7473558 ATGTTACAAAAACTCTGTCAAGG - Intronic
950467623 3:13164457-13164479 ATGGTTCCAGAACTCTGACCTGG + Intergenic
953060165 3:39420931-39420953 TTGTTTCAAAATCCCTTACAGGG + Intergenic
953298181 3:41742740-41742762 ATTGTTTAAAATCTCAGATAAGG + Intronic
953862758 3:46559040-46559062 ATATTTCAAAATCACTGAAAGGG + Intronic
954727875 3:52630957-52630979 ATTGTTCAAAATTTTGGACAGGG + Intronic
955962963 3:64359825-64359847 TTGGTTCAAAATTTCTGGCAAGG - Intronic
956458436 3:69446779-69446801 CTAGTTTAGAATCTCTGACATGG + Intronic
958722375 3:97860048-97860070 CTAGTTAAAAATCTCTGAAAAGG + Intronic
963897554 3:150703322-150703344 AGGGTTCAGTGTCTCTGACAAGG + Intronic
964552974 3:157905406-157905428 ATCTTTCAAAATCTCAGACAGGG - Intergenic
966809793 3:183833385-183833407 ATAGTTCAATGTCTCTGCCATGG + Intronic
967345989 3:188456323-188456345 ATGGTTTAAAATATCTGAAAAGG + Intronic
967448662 3:189597160-189597182 AGTTTTCAAAATCTCTGATAGGG - Intergenic
967954285 3:194865745-194865767 ATGTTTTAAAAACTCTGAAAAGG + Intergenic
968323738 3:197793970-197793992 ATATTTCAAAATATCTAACACGG - Intronic
970314024 4:14812114-14812136 AAGTTCCAAAATCTCTCACATGG - Intergenic
970618216 4:17788249-17788271 ATGAATCAAAATTTCTGAGATGG - Intergenic
972052154 4:34750751-34750773 ATGGGTGAAAATATATGACATGG - Intergenic
972536109 4:40001285-40001307 TTGATTTAAAATCTATGACAGGG - Intergenic
972542372 4:40050487-40050509 ATGGTTCAACATCCCTGGAAAGG + Intergenic
973777958 4:54260733-54260755 ATGGTTCACAATCACTGCAAAGG - Intronic
975457467 4:74609082-74609104 ATGGTTCAATATGTGGGACAGGG + Intergenic
976436489 4:85024400-85024422 ATGGTTCCAAATCCATGTCAAGG - Intergenic
977228165 4:94418826-94418848 ATGTTTCAAAATCTAAGAAAAGG - Intergenic
978756908 4:112312655-112312677 ATGTTTCCAGATTTCTGACAAGG - Intronic
979045034 4:115852057-115852079 CTGGCTCAATAGCTCTGACAAGG - Intergenic
979181580 4:117735298-117735320 AATGTTCAAATTCTTTGACATGG - Intergenic
980165373 4:129220170-129220192 TTGCTTCAGAATCTTTGACAGGG + Intergenic
980327305 4:131363796-131363818 ATGGTTCAGATTCACTGGCAGGG + Intergenic
981593557 4:146392700-146392722 ATTGTTCAAAATCTTTCACCAGG - Intronic
981725514 4:147843204-147843226 ATGGTTCAAAATCTCTGACACGG - Intronic
983975863 4:173933591-173933613 ATGTTTTAAAATCTCTTGCAAGG + Intergenic
985116952 4:186601061-186601083 ATGGACCTAAATCTCTGTCATGG + Intronic
987511812 5:18848835-18848857 ATGATTCAATTTCTCTCACAGGG + Intergenic
987775265 5:22357900-22357922 AAGGTTAAAAATTTTTGACAAGG - Intronic
988219649 5:28326983-28327005 GTGGTTAAAAATTTCAGACAGGG + Intergenic
991150183 5:63358975-63358997 ATGGTTCATAATCAATGACTAGG + Intergenic
993028168 5:82670292-82670314 ATGCTTCTCATTCTCTGACAAGG - Intergenic
994892681 5:105658338-105658360 ATGGTTTAAAATATATGAGAGGG - Intergenic
995904285 5:117104953-117104975 ATGGTTCAAAGTCTTAGAAAAGG + Intergenic
996066644 5:119086351-119086373 ATGGTTCAACATATGTGATATGG - Intronic
998628379 5:143871447-143871469 CTGATTCAGAACCTCTGACAAGG + Intergenic
999534255 5:152500015-152500037 ATGGTTATAAATCACTGAAAGGG + Intergenic
999692455 5:154160284-154160306 TTTGTACAAAGTCTCTGACATGG + Intronic
1000662375 5:163951883-163951905 ATGGTTCAGAAGCTCAGGCAGGG - Intergenic
1002388335 5:178888445-178888467 AGCATTCAAAGTCTCTGACAGGG - Intergenic
1002872524 6:1179608-1179630 ATGGGACAAAATCTCTTACTAGG + Intergenic
1005129491 6:22488963-22488985 ATGGTGCAACATCTCTTGCATGG + Intergenic
1005379716 6:25220891-25220913 ATGGTTCAAAACTTCCTACAGGG - Intergenic
1006298713 6:33181785-33181807 GTGGTTTAAAATCCCTGAAAGGG - Intronic
1007140906 6:39572941-39572963 ATGGCTCAAAAAATCTGATAGGG + Intronic
1007615274 6:43176159-43176181 ATGGTTGAAACTTACTGACAAGG - Intronic
1012300319 6:97579317-97579339 ATGGTTAAAAATCTCTAATGAGG + Intergenic
1012303319 6:97617872-97617894 ATGGGACAGAATCTCAGACAGGG - Intergenic
1012602830 6:101119147-101119169 ATGATTCAAAACCTCCCACAAGG - Intergenic
1013182924 6:107733118-107733140 CTGGTTCTGAATCTCTCACAAGG - Intronic
1013811978 6:114055171-114055193 ATGTTTCAAAAACTCAGACCAGG - Intergenic
1013944925 6:115711136-115711158 ATGTTACAATATCTCTGACTGGG + Intergenic
1015419537 6:132990255-132990277 ATGGTTTGAATTCTCTGACATGG - Intergenic
1016127559 6:140424219-140424241 ATGGTTCAACATATGTGATATGG - Intergenic
1023063182 7:36349119-36349141 AAAGTTCAAAATCTTTGTCATGG - Intronic
1024137604 7:46426557-46426579 TTGCTTCAAAATCTTTGTCAGGG - Intergenic
1024787208 7:52922034-52922056 ATGATTCAAAATCCTTGTCATGG + Intergenic
1025248292 7:57334519-57334541 CTGGTTCCTTATCTCTGACATGG - Intergenic
1027767303 7:82361391-82361413 ATGGTTCACAGTTTCTGAAAGGG - Intronic
1028075504 7:86508901-86508923 ATCCTTCAGAGTCTCTGACAGGG - Intergenic
1028128697 7:87145157-87145179 ATGCTTAAAAATCTCTGTAAAGG + Intergenic
1028819729 7:95193724-95193746 CTGCTTTAAAATCTCTCACAGGG + Intronic
1030084778 7:105806823-105806845 AGTGTTCAACACCTCTGACAAGG + Intronic
1032618616 7:133502930-133502952 ATGATTCAAAAATACTGACAAGG - Intronic
1033947053 7:146732594-146732616 ATGGTTCAAAATCTATCATCTGG - Intronic
1037250560 8:16888367-16888389 AGTGTTAAAAATATCTGACAAGG - Intergenic
1038514107 8:28169733-28169755 TTGGCTCAACATCTCTAACAAGG + Intronic
1040081507 8:43290941-43290963 AAGGTACAAAATTTCAGACAAGG - Intergenic
1053043811 9:34896851-34896873 TAGGCTCAAAATCTCTGAAAAGG + Intergenic
1055033908 9:71797549-71797571 ATGGGAAAAAATCCCTGACATGG + Intronic
1055538522 9:77276085-77276107 ATAGTTCACAATCTCCAACAAGG - Exonic
1055687862 9:78797024-78797046 AATGTTAAAAATCTCAGACAAGG + Intergenic
1056451323 9:86719784-86719806 CTGGTTCAAAATCTCTCACGAGG + Intergenic
1059470577 9:114502363-114502385 AGGCTTCAAAAACTATGACATGG + Intronic
1059842646 9:118235129-118235151 AAGGTTTAATATCTCTGATATGG - Intergenic
1060345592 9:122813030-122813052 ATGGTTAAAAGTCACTGATAAGG + Intronic
1060501995 9:124165228-124165250 ATGGGTCAAGATTTCTGTCAGGG - Intergenic
1186590761 X:10927809-10927831 TTGGTTCATAACATCTGACATGG + Intergenic
1187001059 X:15178922-15178944 ATGGTCCTGAATCTCTGATATGG - Intergenic
1188929227 X:36085820-36085842 ATGCATCAAAATCACTGAGAGGG + Intronic
1189273262 X:39766850-39766872 ATGGTTAAAAACCCCTGCCAAGG + Intergenic
1192057484 X:67787155-67787177 ATGAACCAAAAACTCTGACAGGG - Intergenic
1193418615 X:81255573-81255595 ATTGTTCAAATTCACTGAAATGG - Intronic
1194806693 X:98337963-98337985 ATGGTTCAAAATCTGTAAGATGG + Intergenic
1196096482 X:111806298-111806320 CTGGCTCAAGATCTCTTACAAGG + Intronic
1198330413 X:135617613-135617635 ATGATTGAAAATTTATGACAAGG - Intergenic
1198336514 X:135671386-135671408 ATGATTGAAAATTTATGACAAGG + Intergenic
1198340695 X:135710872-135710894 ATGATTAAAAATTTCTGTCAAGG - Intergenic
1198805653 X:140491569-140491591 CTGGTTCAGGATCTCTTACAAGG - Intergenic