ID: 981739855

View in Genome Browser
Species Human (GRCh38)
Location 4:147990373-147990395
Sequence CAGTCTTAGCTCAGGCACAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 178}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981739852_981739855 4 Left 981739852 4:147990346-147990368 CCAGAAAATGGCTAAACTAAGGG 0: 1
1: 0
2: 2
3: 15
4: 188
Right 981739855 4:147990373-147990395 CAGTCTTAGCTCAGGCACACTGG 0: 1
1: 0
2: 0
3: 16
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981739855 Original CRISPR CAGTCTTAGCTCAGGCACAC TGG Intronic
901648737 1:10730490-10730512 CACTCTCAGCTCAGTCACACGGG - Intronic
908170582 1:61500638-61500660 TAGCCTAAGCTAAGGCACACAGG + Intergenic
909496635 1:76286230-76286252 TAGTCATAGCTTAGGCCCACAGG - Intronic
909496820 1:76288143-76288165 CAGTCATACCTTAGGCCCACAGG - Intronic
916474255 1:165153570-165153592 CTGTCTTGGCTCAGGCAAGCAGG + Intergenic
917869389 1:179228887-179228909 CAGTATTAGCTCAGTCCCAGAGG - Intronic
919454022 1:197801648-197801670 CTAGCTTAGCTCAGGCCCACTGG - Intergenic
921149000 1:212385245-212385267 CAGACCCAGCTCAGGCAGACAGG + Intronic
1063347453 10:5325201-5325223 CAGTCTTTGCTCTGCCTCACTGG - Intergenic
1063434953 10:6022076-6022098 CAGTCTCAGCTGAGACACAAGGG + Intronic
1066693952 10:38061467-38061489 CAGGCCACGCTCAGGCACACTGG - Intronic
1066998871 10:42587715-42587737 CAGGCCATGCTCAGGCACACTGG + Intronic
1068041326 10:51828405-51828427 CAGTCTTTGCTCAGTAACACAGG - Intronic
1069036874 10:63654906-63654928 CAGTCTCAGGCCAGGCACAGTGG + Intergenic
1070732554 10:78841417-78841439 CAGTATCAACTCAGTCACACAGG - Intergenic
1070741942 10:78909001-78909023 TAGTCTTAGCTCTGTCACTCAGG + Intergenic
1074851355 10:117442023-117442045 GAGCCATAACTCAGGCACACAGG - Intergenic
1075786724 10:125054992-125055014 CAGAGTTAACTCAGGCACCCTGG + Intronic
1076052519 10:127346967-127346989 CAGTCTTATCTCAGGCTCCGGGG - Intronic
1076747836 10:132523236-132523258 GAGGCTGAGCCCAGGCACACCGG + Intergenic
1087956858 11:104299239-104299261 CAGTCTCAGCAAAGGAACACAGG - Intergenic
1088927702 11:114319184-114319206 CAGTCGTTGGTCAGGCACAGTGG + Intergenic
1091533255 12:1380528-1380550 CTGTCTTAGCTAAGGCAAAGGGG + Intronic
1091919263 12:4291122-4291144 CAGGCTTACCTCTGGCACCCCGG + Intronic
1094361213 12:29633262-29633284 CAGTCATAGCACAGGGTCACGGG + Exonic
1097125477 12:56771114-56771136 CAGTCTTTGCTCAGGCTCATGGG + Intronic
1098526280 12:71490725-71490747 GAGTCCTGGCTCAGGAACACAGG - Intronic
1100394645 12:94174116-94174138 CAGTCTGAGCCCAAGCACATAGG - Intronic
1101733908 12:107448664-107448686 CAGTCTCAGCTCTGTCACCCAGG + Intronic
1102028862 12:109728575-109728597 CAGTCTGAGCAAAGGCACAGAGG - Intronic
1102932626 12:116874277-116874299 CAGTCTTACCTCCGGGCCACTGG + Intronic
1103313964 12:120036586-120036608 GAATCTTAGGTCAGGCACAGTGG + Intronic
1105821873 13:24087268-24087290 CAGGCTTTGCTCAGGAACTCAGG - Intronic
1107496635 13:40931743-40931765 GAGTCTTAGCTCTGTCACCCAGG - Intergenic
1107632003 13:42351740-42351762 CAGGCTAGCCTCAGGCACACTGG - Intergenic
1108240174 13:48456576-48456598 CAATTTTTGCTCAGGCCCACCGG + Intronic
1108442483 13:50469443-50469465 CAGTCTGAGATCAGGGACAGCGG - Intronic
1109316296 13:60753792-60753814 CAGTCATTCCTCAGGCAAACAGG - Intergenic
1111016459 13:82387916-82387938 CATTCTTAGCTCACTCACAGTGG + Intergenic
1112138496 13:96611679-96611701 TAGCCTTTGCTCAGGCATACAGG + Intronic
1112409283 13:99148349-99148371 CAGTACTAGCCCAGGCACAGTGG - Intergenic
1113607142 13:111617271-111617293 CAGTCCTAGCTCAGGGAGAAAGG + Intronic
1113905171 13:113815993-113816015 CAGTCACTGCTCAGGGACACGGG + Exonic
1113905182 13:113816069-113816091 CAGTCACTGCTCAGGGACACGGG + Exonic
1114192746 14:20452734-20452756 CAGTCTCAGCTCTGTCACCCAGG + Intronic
1116427819 14:44811491-44811513 CTGTTTTAGCTCAGAAACACTGG + Intergenic
1117552270 14:56848242-56848264 CAGTTTTAGGCCAGGCACAGTGG + Intergenic
1118127915 14:62929561-62929583 CACTCTTATCTCAGACACTCTGG + Intronic
1118570251 14:67187749-67187771 CAGTCTGAGCAAAGGCACAGAGG - Intergenic
1121688760 14:95859293-95859315 GAGTCTTTGCTCAAGCTCACAGG + Intergenic
1123706385 15:22954028-22954050 CAGTCTTCGCTCTGTCACCCAGG - Intronic
1124014127 15:25862249-25862271 CAGTCTTCGGCCAGGCACAGTGG - Intronic
1125060803 15:35420799-35420821 CAGTTTTAGGCCAGGCACAGTGG - Intronic
1128562357 15:68677275-68677297 CAGTCTCTGCTCAGGCCCAGTGG - Intronic
1132262046 15:100434222-100434244 ATGTCTTAGCTCAGGCATCCAGG + Intronic
1132313965 15:100877738-100877760 CAGTCTGATCTCAGGCTCCCAGG + Intronic
1132981174 16:2739348-2739370 CAGGCACAGCTCAGCCACACTGG + Intergenic
1135089652 16:19503199-19503221 CTGCCCTAGCTGAGGCACACAGG - Exonic
1137282332 16:46988494-46988516 CAGTCTTAGCTCCATCACCCAGG + Intergenic
1137737912 16:50738702-50738724 CAGTGTTAGGTCAGGCACAGTGG + Intergenic
1139356993 16:66372485-66372507 CAGGCATAGCTCCGGCCCACAGG - Intronic
1141111279 16:81272914-81272936 CAGTCTTGGCTCTGCCACTCTGG - Intronic
1141821032 16:86445948-86445970 GCGTTTGAGCTCAGGCACACTGG - Intergenic
1141882017 16:86866526-86866548 AAGTCTCAGCTCCTGCACACCGG - Intergenic
1144241746 17:13319448-13319470 CAGTCTTAGGCCAGGGACAGTGG - Intergenic
1146071974 17:29690461-29690483 GAGTCTTACATCATGCACACAGG - Intronic
1149040952 17:52187565-52187587 CAGTGTGAGCTCAGGGACATGGG + Intergenic
1149602678 17:57903423-57903445 CAGTCTTTGCTCAAGAACAAAGG - Intronic
1150369441 17:64624207-64624229 CTGCCTTAGGTCAGGCACAGTGG + Intronic
1150827050 17:68486150-68486172 CAGTTTCACCTCAGTCACACTGG + Intergenic
1154059111 18:11042302-11042324 CTGTCACAGCTCAGTCACACAGG + Intronic
1157622921 18:49026562-49026584 CAGTGACAGCCCAGGCACACAGG + Intergenic
1157837203 18:50916028-50916050 CAGATTTAGCTAAGTCACACTGG - Intronic
1158734526 18:60064477-60064499 CAGATTTACCCCAGGCACACTGG - Intergenic
1159962975 18:74569754-74569776 AAGTCAGAGCGCAGGCACACAGG + Intronic
1160988205 19:1849481-1849503 AAGTCTTAGGTCGGGCACAGTGG + Intergenic
1161382512 19:3973197-3973219 CAGTCTTTGCTCTGTCACCCAGG - Intergenic
1161382671 19:3974269-3974291 CAGTCTTTGCTCTGTCACCCAGG - Intergenic
1161548884 19:4899604-4899626 CAGTCTTTACTCTGGCACCCAGG - Intronic
1162815338 19:13190880-13190902 CAGTCTTAACTCTGTCACACAGG + Intergenic
1163004148 19:14387066-14387088 CAGTAAATGCTCAGGCACACCGG + Intronic
1164553864 19:29234796-29234818 CAGTCTGAACTCAGGCCCTCAGG - Intergenic
1165061794 19:33208396-33208418 CAGTCTGAGCTCGGCCACCCAGG - Exonic
1165296143 19:34927298-34927320 CAGTCTTCGCGGATGCACACCGG - Intronic
1166617232 19:44261086-44261108 CAGGCTGAGCTCAGGCAGAGTGG + Intronic
1167089312 19:47332463-47332485 CAGTCTTATTACAGCCACACTGG + Intronic
925512326 2:4641679-4641701 CCGTCTTTGCTCAGAAACACTGG + Intergenic
925628180 2:5862780-5862802 AGGACTTAGCTCAGGCCCACTGG - Intergenic
925886970 2:8401698-8401720 CAGTCCCAGCATAGGCACACAGG + Intergenic
926227762 2:10980590-10980612 CAGTTTCAGCTCAGGCACTGGGG + Intergenic
930477833 2:51906488-51906510 CAGTCTTATTTCATGCACAAAGG + Intergenic
932012512 2:67992605-67992627 CAGTCTTAGCTCAGTCGAATGGG - Intergenic
932617941 2:73247651-73247673 CATGATTAGCTCAGGCTCACAGG + Intronic
934014556 2:87865799-87865821 CAGTCTTTGCTCAGGCAGAATGG - Intergenic
934085944 2:88509709-88509731 CAGTCCTAGGCCAGGCACAGGGG - Intergenic
937037875 2:118796798-118796820 CACTCCTGGCTCAGACACACTGG + Intergenic
937776209 2:125778943-125778965 CAGTTTTATCTTAGACACACTGG - Intergenic
938318235 2:130344759-130344781 CAGTCCTTCCTCAGACACACCGG + Intronic
940468660 2:154064744-154064766 CAGTCTTACCCAAGGCCCACTGG - Intronic
942028043 2:171930452-171930474 CATTTTTAGGTCAGGCACAGTGG - Intronic
942107313 2:172645544-172645566 CAGTTTTAGGCCAGGCACAGTGG - Intergenic
942472304 2:176273510-176273532 CAGTGTTAGCTCATGTCCACAGG - Intronic
942555622 2:177169772-177169794 CAGCCTCAGCTCAGACACAATGG - Intergenic
946170209 2:217890796-217890818 TGGTGTGAGCTCAGGCACACAGG - Intronic
946923002 2:224598477-224598499 CAGTCATGACACAGGCACACAGG - Intergenic
948700497 2:239756753-239756775 CAGTCTTATTTCAGAGACACTGG + Intergenic
948736411 2:240009299-240009321 CAGTGTTAGCTGAGACACAGAGG - Intronic
1169263593 20:4154648-4154670 CAGTCTCAGGCCAGGCACAGTGG - Intronic
1171970671 20:31563051-31563073 CATTCAGAGCTCTGGCACACAGG + Intronic
1181632448 22:24158256-24158278 CTGTGTCAGCTCAGGCACCCAGG + Intronic
1181689496 22:24550664-24550686 CCGTCTTAGCTGGCGCACACAGG - Intronic
1181844909 22:25699265-25699287 CTGTCTTTTCTCAGGCACACGGG + Intronic
1184849843 22:47113859-47113881 CAGACCTAGCTCAGGTACCCTGG - Intronic
953386434 3:42508850-42508872 CAGTGTGATCACAGGCACACAGG - Intronic
953394440 3:42556203-42556225 CAGACTTAGCACAGTCACATGGG - Intronic
953490630 3:43347477-43347499 CTTTCTTAGCTGAGTCACACAGG - Exonic
954645654 3:52130073-52130095 CAGTCAGAGTTCAGGCATACAGG - Intronic
956625101 3:71259116-71259138 CAGTCTTAGCTCTGTCACCCAGG - Intronic
960605056 3:119496696-119496718 CAGTCTTAGCTTCGTCACCCAGG - Intergenic
961360753 3:126365722-126365744 CAGTCACAGCTCAGGGAAACTGG - Intergenic
962052073 3:131826742-131826764 CAGTCTCAGGTCAGGCACAGTGG + Intronic
963085222 3:141429867-141429889 CTGCCTTTGCTCAGGCACACAGG - Intronic
965129191 3:164673044-164673066 CAGTCATAGCTCAGAGACAGAGG - Intergenic
969843502 4:9901130-9901152 CAGACTGAGCTCAGGCCCCCAGG + Intronic
974552521 4:63396505-63396527 CGGACTTGGCTCAGGCCCACTGG - Intergenic
975800620 4:78056751-78056773 CAGTTCTTGCTCAGGCACACCGG - Intergenic
975985905 4:80201756-80201778 CATTCTTTTCTCAGGCACTCAGG + Intronic
978315987 4:107437777-107437799 CTGTCTTAGCCCAAGCACAAAGG - Intergenic
981739855 4:147990373-147990395 CAGTCTTAGCTCAGGCACACTGG + Intronic
983161798 4:164425894-164425916 CAGTATTAGGCCAGGCACAGTGG - Intergenic
986163354 5:5251022-5251044 CAGGCTTGGCTCAAGGACACTGG - Intronic
986328992 5:6703637-6703659 CTGTCTTAGGCCAGGCACAGAGG - Intergenic
986637308 5:9835835-9835857 CAGTTTTAACTCAGCCACCCTGG - Intergenic
986651750 5:9970945-9970967 CAGGCTCACCTCAGGCACCCCGG + Intergenic
991206616 5:64057360-64057382 CATTTTTAGCTCATGGACACTGG - Intergenic
991516934 5:67447462-67447484 AAGTCATAGCTCAAACACACAGG - Intergenic
993292686 5:86095639-86095661 CAGGCCTTGCTCAGCCACACTGG + Intergenic
993661667 5:90645191-90645213 CAGTCTCAGCACCGGGACACGGG + Intronic
996569546 5:124917614-124917636 CATTTTTAGGTCAGGCACAGTGG + Intergenic
997037461 5:130209960-130209982 CCCTCTTAGCTCTGTCACACAGG + Intergenic
997799431 5:136844921-136844943 CAGTCTTAGCTCAGTCACTGTGG + Intergenic
997985510 5:138498202-138498224 GAGTTTTAGCCCAGGCACAGTGG - Intergenic
998107735 5:139478940-139478962 CAGGCTTAGGGCAGGCACAGTGG + Intronic
999230356 5:150058112-150058134 CAGCCTAAGCTGAGGCCCACTGG + Intronic
1002386328 5:178869884-178869906 CAATCTTAGTCCAGGCAGACAGG - Intronic
1002663549 5:180806867-180806889 CAGTCTTTGCTTAGACACAGGGG - Intronic
1006646899 6:35521154-35521176 CAGTCTTAGTTCAGCCAGAGAGG + Intergenic
1006945663 6:37783151-37783173 GAGTCTTTGCTCAGGGACAGGGG + Intergenic
1007353753 6:41294813-41294835 CAGTGTGAACACAGGCACACAGG + Intergenic
1009687209 6:66977729-66977751 CAGGCTTACCCCAGGCAAACAGG - Intergenic
1012944609 6:105451919-105451941 CAGTCTTCCCTCAGGCTTACAGG - Intergenic
1016435953 6:144037288-144037310 CAGTTTTAGGCCAGGCACAGTGG + Intronic
1019763157 7:2829222-2829244 CAGTTTAAAATCAGGCACACAGG + Intronic
1021744339 7:23723444-23723466 CAGTCATAGGTCAGGCACAGTGG - Intronic
1022539904 7:31125802-31125824 CAGGCTGAGCCAAGGCACACTGG - Intergenic
1023416955 7:39942273-39942295 AAATCTTAGGTCAGGCACAGTGG - Intergenic
1023841593 7:44101421-44101443 CAGTCAGAACTCAGGCACACTGG + Intergenic
1026523403 7:71134782-71134804 CAGGCTTTTCTCAGGGACACAGG + Intronic
1027407385 7:77876037-77876059 GAATTCTAGCTCAGGCACACAGG - Intronic
1028163887 7:87515882-87515904 CAGTCTGAGGTCAAGCACAGTGG - Intronic
1029563516 7:101319925-101319947 AAGTCTTAGGCCAGGCACAGTGG - Intronic
1029664207 7:101984006-101984028 CAGTCTCAGCTCTGTCACCCAGG - Intronic
1030414593 7:109226736-109226758 CAGCCTTATCTCAGGAATACAGG - Intergenic
1030869863 7:114742091-114742113 CACTCTTGGTTCAGGCTCACTGG + Intergenic
1031952401 7:127905828-127905850 AAATCTTAGCTTAGGCACTCAGG + Intronic
1033786829 7:144742048-144742070 CTGTCTTAACACAGTCACACTGG + Intronic
1035657445 8:1320552-1320574 CAGGCTGAGCTCAAGCACAGGGG - Intergenic
1039527891 8:38232131-38232153 CAGACTTACCTCAGCCACCCTGG - Intronic
1040957460 8:52994458-52994480 CAGTCTCAGCTCTGTCACCCAGG + Intergenic
1041705617 8:60843561-60843583 CAGTCATGGCTCAGGCAGGCAGG + Intronic
1041858711 8:62486372-62486394 CATGCTTAGCTCAGACTCACAGG + Intronic
1042293819 8:67198686-67198708 CAGTGTCAGCTCATGCTCACGGG - Exonic
1042691253 8:71501597-71501619 AAGTCTTAGCTCATGCATGCTGG + Intronic
1044165907 8:88983617-88983639 CATACTTAGATCAGGCACAGTGG + Intergenic
1044417721 8:91954936-91954958 CAGTCTATTCTCAGTCACACTGG - Intergenic
1044722604 8:95165481-95165503 GAGTGTTAGCCCAGGCACAGTGG - Intergenic
1048009899 8:130447052-130447074 CAGTCTTTACTCAGGCACTTGGG - Intergenic
1048113212 8:131490633-131490655 CAGTCTAGGCACAGGCACAGGGG - Intergenic
1048596779 8:135875000-135875022 CAGTCTTAGATCAGCTTCACTGG + Intergenic
1051276418 9:15403340-15403362 GAGTCTTATCACATGCACACAGG - Intergenic
1052126265 9:24778810-24778832 CTGTATTAGCTCTGGCACATTGG + Intergenic
1055520371 9:77074833-77074855 CATTCTTAGGCCAGGCACAATGG + Intergenic
1055875790 9:80939921-80939943 AAGTCATAGCCCAGGAACACAGG + Intergenic
1057033402 9:91796574-91796596 CAGGCATAGCTTAGTCACACTGG - Intronic
1058180868 9:101797157-101797179 CAGTCTCAGCTCTGTCACCCAGG + Intergenic
1059281773 9:113140504-113140526 CAGTCTAATCTCAGAGACACTGG + Intergenic
1059787156 9:117598252-117598274 CAGCCTTAGCTCAGCCCCAAGGG - Intergenic
1060506233 9:124200261-124200283 CAGTCTTGTCTCAGGCTCCCAGG - Intergenic
1185794558 X:2954007-2954029 CATTTTTAGTTCAGGCACAATGG - Intronic
1187842784 X:23506119-23506141 AAGTCTGAACTCAGGCAAACTGG + Intergenic
1189737398 X:44085915-44085937 CAGTTTCAGCTCAAGCACTCAGG + Intergenic
1192664652 X:73076812-73076834 CAGTATTTTCTCAGGGACACAGG - Intergenic
1199129921 X:144172712-144172734 CAGTCTTTGCTCAGGCAGAATGG + Intergenic
1200911477 Y:8535077-8535099 CAGTCCAAGCACAGCCACACAGG - Intergenic
1201385328 Y:13434469-13434491 CAGTCTTAGGCCAGGCGCACTGG - Intronic