ID: 981740384

View in Genome Browser
Species Human (GRCh38)
Location 4:147995695-147995717
Sequence AGATGGACCATGCAAATTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 164}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981740384_981740388 26 Left 981740384 4:147995695-147995717 CCAAAAATTTGCATGGTCCATCT 0: 1
1: 0
2: 1
3: 15
4: 164
Right 981740388 4:147995744-147995766 TCTTGCTCTGTCACCCAGGCTGG 0: 26457
1: 73050
2: 147182
3: 159645
4: 143243
981740384_981740386 1 Left 981740384 4:147995695-147995717 CCAAAAATTTGCATGGTCCATCT 0: 1
1: 0
2: 1
3: 15
4: 164
Right 981740386 4:147995719-147995741 TCTCTCTTTTTTTTTCATGACGG No data
981740384_981740387 22 Left 981740384 4:147995695-147995717 CCAAAAATTTGCATGGTCCATCT 0: 1
1: 0
2: 1
3: 15
4: 164
Right 981740387 4:147995740-147995762 GGAGTCTTGCTCTGTCACCCAGG 0: 11170
1: 44232
2: 101511
3: 128684
4: 136249

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981740384 Original CRISPR AGATGGACCATGCAAATTTT TGG (reversed) Intronic
900798924 1:4725957-4725979 AGCTTCAACATGCAAATTTTTGG + Intronic
901294564 1:8150878-8150900 AGATGGAGCACGCGAGTTTTAGG + Intergenic
903758558 1:25681790-25681812 AGATGGACAATGAAAAGTGTTGG - Intronic
909328633 1:74385256-74385278 AGAGGGACCATGAATCTTTTTGG + Intronic
911374346 1:97032756-97032778 AACTGGATCATGCTAATTTTTGG + Intergenic
912497411 1:110100486-110100508 AGATGGCCCATAAAAATCTTGGG + Intergenic
914049624 1:144120601-144120623 AGATTAACAATGTAAATTTTTGG + Intergenic
914129558 1:144844850-144844872 AGATTAACAATGTAAATTTTTGG - Intergenic
916441401 1:164828698-164828720 AGAGGGACCATGCCACTTTCAGG - Intronic
918951700 1:191148684-191148706 ATATTGGCCATGCAAATTATTGG - Intergenic
919985872 1:202674427-202674449 AGATGGACCATGCTAACACTGGG - Intronic
920191142 1:204194687-204194709 AGGAGGACCAGGCAGATTTTTGG + Intronic
922360233 1:224814531-224814553 TGATGTTCCATACAAATTTTAGG - Intergenic
924847345 1:247786656-247786678 AGATTGACATTGTAAATTTTTGG + Intergenic
1063053688 10:2480228-2480250 AGCTGCACCAGGAAAATTTTGGG - Intergenic
1065084379 10:22160087-22160109 AGAGTAAGCATGCAAATTTTTGG - Intergenic
1068203585 10:53816978-53817000 AGATACACAATTCAAATTTTGGG + Intronic
1070459736 10:76652394-76652416 AGATAGAACATGCAGAATTTTGG - Intergenic
1073502185 10:103950219-103950241 ACATTGACTATGGAAATTTTTGG + Intergenic
1074409515 10:113213908-113213930 AGATGGATTATGCAAATATCAGG - Intergenic
1081006191 11:37746392-37746414 AGATGGACTAACCAAATTTCTGG + Intergenic
1081550373 11:44106207-44106229 AGAAGTACCATGCAAATTCAGGG + Intronic
1082887137 11:58097443-58097465 ATATGGACCATGCCAAGTGTTGG + Intronic
1082896379 11:58194833-58194855 AGACTGACCATGCTAAGTTTTGG - Intergenic
1091111704 11:132975344-132975366 AAATGAACCATGCAAAGTTTTGG + Intronic
1091626427 12:2124492-2124514 TGATGGCCCATGCAAACTGTTGG + Intronic
1094190185 12:27690006-27690028 AAATGGAGCATGCATGTTTTGGG + Intronic
1098567651 12:71953879-71953901 AGATGGAGTATGGATATTTTGGG + Intronic
1098701096 12:73627733-73627755 ATTTGGAACATGCAAATTTGAGG + Intergenic
1098832105 12:75375475-75375497 AGATGAACAGTACAAATTTTTGG + Intronic
1098933597 12:76450879-76450901 AGATGGCTGATGCAAATCTTTGG + Exonic
1099871316 12:88352583-88352605 AGATGTACCATTTAAATATTTGG - Intergenic
1101269641 12:103130039-103130061 AAATGAACAATGCAAATCTTTGG - Intergenic
1101733621 12:107446418-107446440 AGGGGGACCAGGCACATTTTTGG + Intronic
1105334597 13:19454954-19454976 AGATGGAATTTGGAAATTTTTGG + Intronic
1105860315 13:24404370-24404392 AGATGGAATTTGGAAATTTTGGG - Intergenic
1106852197 13:33805764-33805786 AGATGAACCAGGCTAATTGTAGG + Intergenic
1111276290 13:85951700-85951722 AGATTTAACATACAAATTTTGGG + Intergenic
1111452804 13:88440902-88440924 AAATGTACCTTGCAAATCTTGGG + Intergenic
1113899920 13:113791037-113791059 AGGTAGACCCTGCAATTTTTAGG + Intronic
1115629858 14:35233615-35233637 AGAAGCAACAAGCAAATTTTAGG - Intronic
1115774724 14:36702752-36702774 AGATGCACCATGAATACTTTTGG + Intronic
1116142081 14:41010194-41010216 AGACTGCACATGCAAATTTTGGG + Intergenic
1122376407 14:101262572-101262594 AGATGGATCATGCCAAGTGTTGG - Intergenic
1122916221 14:104860222-104860244 AGATGGAGCATGGAAATGGTGGG - Intergenic
1123419494 15:20119823-20119845 AGATTAACAATGTAAATTTTTGG + Intergenic
1123446368 15:20333689-20333711 AGATTAACAATGTAAATTTTTGG - Intergenic
1123528717 15:21126361-21126383 AGATTAACAATGTAAATTTTTGG + Intergenic
1123716773 15:23039402-23039424 AGTTGGACCAGGCGAAGTTTAGG + Exonic
1126422119 15:48485737-48485759 AGAAGGACCATGCAAAATCCTGG + Intronic
1133893195 16:9901182-9901204 AGATGCTCAATGCAAATTTGTGG + Intronic
1203137590 16_KI270728v1_random:1738901-1738923 AGATTAACAATGTAAATTTTTGG - Intergenic
1149241251 17:54652299-54652321 AGCTTCACCATGTAAATTTTGGG + Intergenic
1149303082 17:55323386-55323408 ACATGGACCATCCAAATTTATGG + Exonic
1150665426 17:67131529-67131551 AGATTTAACATGCAAATTTCAGG - Intronic
1152456830 17:80421636-80421658 AGATGTACCCTGCAAATTGGTGG - Intronic
1157100339 18:44723612-44723634 AGATGGGCCAAGCAAATAGTTGG - Intronic
1158160847 18:54481364-54481386 AGATGGAGCTTGGAAATTTGTGG - Intergenic
1159688688 18:71458070-71458092 TGATGGTCCATTAAAATTTTTGG + Intergenic
1159884955 18:73894991-73895013 GGATGGTCCGTGCACATTTTAGG + Intergenic
1162702471 19:12527507-12527529 AGATGGACCATATAAATGTCAGG - Exonic
1162847074 19:13401175-13401197 AAATGGATTATGCCAATTTTAGG + Intronic
1164313381 19:24065711-24065733 GGAGGGATCCTGCAAATTTTGGG + Intronic
1166459372 19:42972776-42972798 AGATGTAACATGAAAAATTTAGG + Intronic
1167173682 19:47850661-47850683 AGACAGACCATGCCAAGTTTTGG + Intergenic
1168592035 19:57644524-57644546 AGATAGACCATGCCAAGTATTGG - Intergenic
1202689014 1_KI270712v1_random:73164-73186 AGATTAACAATGTAAATTTTTGG + Intergenic
925691768 2:6531850-6531872 AGATGTACCATCCAAATACTAGG - Intergenic
927220535 2:20704101-20704123 AAATGGACCATGCAGATACTTGG + Intronic
928003846 2:27545546-27545568 AGATGGACAATGCCAAGTGTTGG - Intronic
933449691 2:82431806-82431828 AGATGGATTATGTACATTTTGGG - Intergenic
933957424 2:87382937-87382959 AGATTAACAATGTAAATTTTTGG - Intergenic
934241541 2:90274833-90274855 AGATTAACAATGTAAATTTTTGG - Intergenic
934271633 2:91541851-91541873 AGATTAACAATGTAAATTTTTGG + Intergenic
937453377 2:122020949-122020971 ATATGGCCCATGCAATATTTTGG + Intergenic
938120182 2:128627513-128627535 AAATGGACCAGGCAGATGTTGGG - Intergenic
938543615 2:132306776-132306798 AGATGGCACATTCAAATTTGAGG - Intergenic
942796829 2:179830724-179830746 AGGTGGAACATGGGAATTTTGGG + Intronic
945277270 2:208000493-208000515 AGATGGGCCATTGAAATTGTGGG - Intronic
945344104 2:208692603-208692625 ATTTGGACCATGACAATTTTGGG + Intronic
946863235 2:224019934-224019956 AGATGGACCAACCAAATGTCTGG + Intronic
946943915 2:224799671-224799693 AGACTGACCATCCAAAGTTTTGG - Intronic
948855291 2:240727476-240727498 AGATGGACCATGGAGGTTTTTGG - Intronic
1168918263 20:1509583-1509605 AGATGGAAGATGCAAACGTTTGG + Intergenic
1168957934 20:1847913-1847935 AGAGGAACCAGGCAAATATTTGG + Intergenic
1169667278 20:8051388-8051410 ACAAGGACTATACAAATTTTTGG + Intergenic
1170942622 20:20861674-20861696 AGATGGAGCTGGCAAAATTTGGG + Intergenic
1171872479 20:30539482-30539504 AGATGGCACATTCAAATTTGAGG - Intergenic
1172297005 20:33819440-33819462 AGAAGGACCAAACAAACTTTAGG - Intronic
1173095176 20:40020112-40020134 AGATGGAAAGTGCAAATTTATGG - Intergenic
1175038839 20:56026528-56026550 AGGTAGAAAATGCAAATTTTTGG - Intergenic
1175577418 20:60071215-60071237 GAATGAACCATGCAAACTTTGGG + Exonic
1178244484 21:30937553-30937575 GGGTGGCCCATGCAATTTTTTGG + Intergenic
1180552410 22:16551446-16551468 AGATTAACAATGTAAATTTTTGG - Intergenic
1181351620 22:22262584-22262606 AGATAAACAATGTAAATTTTTGG + Intergenic
949584847 3:5427472-5427494 AGATGGTACATGCAAACATTTGG + Intergenic
952089893 3:29872598-29872620 AGAAGGACCATGCAACTTGTTGG + Intronic
960775743 3:121250729-121250751 AGATGGATCAATAAAATTTTGGG + Exonic
963680848 3:148374482-148374504 AGAAGAGCCATGCATATTTTAGG - Intergenic
964082366 3:152774826-152774848 AGATTGACAATGCTAATTATTGG - Intergenic
964726850 3:159822566-159822588 AGATGGTCCCTGCAAAATTTTGG - Intronic
965744024 3:171906157-171906179 AGAGGGACCTTGAAAATTTTGGG - Intronic
967286234 3:187873232-187873254 AGCTGGAAGATGCAAATGTTGGG - Intergenic
971311792 4:25531439-25531461 AGATGGAACATGAAATTTTGTGG + Intergenic
972164534 4:36266501-36266523 AGATGGACCCTGCAGTTTTAAGG - Intergenic
972306213 4:37832471-37832493 AAATGAACCAGGCAAACTTTGGG - Intronic
972884880 4:43472825-43472847 AGAGGGTCCAAGTAAATTTTTGG - Intergenic
975248318 4:72146678-72146700 AGACGGTCCATGCAAATTAATGG + Intronic
976317295 4:83672412-83672434 AGATGGCAGCTGCAAATTTTGGG + Intergenic
976505966 4:85847869-85847891 AGATGAACAATGCTCATTTTTGG - Intronic
979218633 4:118194986-118195008 TGTTGTACCATGTAAATTTTAGG + Intronic
981740384 4:147995695-147995717 AGATGGACCATGCAAATTTTTGG - Intronic
982388020 4:154833693-154833715 AGAAGAACCAAACAAATTTTTGG + Intergenic
982735305 4:159000215-159000237 ATATGTACCATGCAAATGTTTGG - Intronic
983216816 4:165009740-165009762 AGATGGACCAAGTAAACATTGGG + Intergenic
984140552 4:176000272-176000294 AGAAGGAACAAACAAATTTTAGG + Intronic
987824592 5:23012654-23012676 AGAAGCACCATGCACAGTTTTGG - Intergenic
989592338 5:43122762-43122784 AGATGGAGCTTCCAAATATTAGG + Intronic
990013994 5:51035476-51035498 ATATGAATCATGCAGATTTTTGG + Intergenic
991898073 5:71426759-71426781 AGATGTATCAGGCAAATTCTTGG + Intergenic
992389841 5:76320306-76320328 AGATGGAGCATGGGACTTTTAGG + Intronic
992732455 5:79686875-79686897 AGATGCACAGTGTAAATTTTAGG - Intergenic
993030924 5:82704780-82704802 AGATAAACCATGCAAAGATTCGG - Intergenic
994815566 5:104582702-104582724 AGATTGACAATATAAATTTTTGG - Intergenic
996653876 5:125915378-125915400 AGATGGACAAAGCAAATCTTGGG + Intergenic
1000025709 5:157357472-157357494 ACATGGAACATGCAATTTATGGG - Intronic
1001813605 5:174649298-174649320 AGCTGGCCCATGCAAACCTTTGG + Intergenic
1003040438 6:2682833-2682855 AGATGGAACATGCAAATATTAGG + Intronic
1004343380 6:14826952-14826974 AGGTTGCCCATGCAATTTTTGGG - Intergenic
1006336644 6:33424544-33424566 AGATGGACCCTGAAAGTTATTGG + Intronic
1006960557 6:37925783-37925805 AGATGGGTCAGGCAAATTTGTGG + Intronic
1009789302 6:68380463-68380485 TGAAGGTCCATACAAATTTTAGG + Intergenic
1009866541 6:69405153-69405175 AGATTAACCATGCACATTTCTGG - Intergenic
1010524261 6:76880985-76881007 AGAAGTACCATGCTAAGTTTTGG - Intergenic
1011886921 6:92108300-92108322 AGATGAAATATGCAAATTATTGG - Intergenic
1012485942 6:99722665-99722687 AGATGTACAGTGCAAATTGTTGG - Intergenic
1013526497 6:110979333-110979355 AGATGGACAATGCTAAGTTTTGG + Intergenic
1014653300 6:124068567-124068589 AGATGGAACATGCACATGTCTGG - Intronic
1014785923 6:125619264-125619286 AGATGGACCATGCCAAGTATTGG + Intergenic
1015597609 6:134880704-134880726 AGATGGAACGTGGAAGTTTTTGG - Intergenic
1017852311 6:158315428-158315450 AGATTCACCATACAAATTTTGGG + Intronic
1020889826 7:13865252-13865274 ATCTGTTCCATGCAAATTTTTGG - Intergenic
1021162297 7:17290010-17290032 ATATGAACTATGCAAATATTTGG + Intergenic
1022659015 7:32348796-32348818 AGAGTGACCATGCAAAGTTCTGG - Intergenic
1023321375 7:39001596-39001618 AGGTTGACCATGCAACCTTTAGG - Intronic
1024148683 7:46544244-46544266 ATATGGCCCATGCTTATTTTGGG - Intergenic
1024890303 7:54193221-54193243 ATATATACCATGCAAATTTCAGG - Intergenic
1025060282 7:55799555-55799577 AGATATTCCATGCAAATTATAGG + Intronic
1030145196 7:106345950-106345972 AGATGGAAGAGGAAAATTTTAGG + Intergenic
1032628330 7:133618488-133618510 AAATGGAAAATGAAAATTTTGGG + Intronic
1037097580 8:15004048-15004070 ACATGTAGCATGCACATTTTGGG - Intronic
1038126674 8:24681608-24681630 AGGAGGACCTTGCATATTTTAGG - Intergenic
1041975183 8:63791335-63791357 GGATGGAGCATTCAACTTTTTGG - Intergenic
1042774372 8:72413695-72413717 AGATGGGACATGCACATTATGGG + Intergenic
1043590288 8:81824146-81824168 AGATGGACAATGCCAAGTTCTGG - Intronic
1043743012 8:83837573-83837595 AGACTGACCATACAAATTCTTGG + Intergenic
1047536866 8:125727871-125727893 AGATGCACCATGCACATTTGAGG - Intergenic
1047551673 8:125879870-125879892 AGTAGGGCCATACAAATTTTAGG + Intergenic
1050001626 9:1083693-1083715 AAATGGAGCATGTAAATTATGGG + Intergenic
1050893823 9:10859357-10859379 TGAATGACCAAGCAAATTTTTGG - Intergenic
1052674741 9:31605890-31605912 AGATGGACCATACTAGTTTTAGG - Intergenic
1052843294 9:33312132-33312154 AGATGAATCATGCAGATTTTCGG + Intronic
1055178632 9:73353759-73353781 ATTTGGAACATGCACATTTTAGG + Intergenic
1057298899 9:93865291-93865313 AGATGGACCAGGCAGGTTTCTGG - Intergenic
1058833706 9:108841907-108841929 ATATGAACCATGCAACTTTTTGG - Intergenic
1186185948 X:7019909-7019931 AGATGTAACATGAAAAATTTAGG + Intergenic
1186243508 X:7595018-7595040 AGATGTAGCATGGACATTTTCGG - Intergenic
1186848628 X:13556825-13556847 AAATGGATCATGCAAAATTCAGG + Intergenic
1187142206 X:16604808-16604830 AGCAAGACCATGCAAATTTGTGG + Intronic
1187994012 X:24905906-24905928 AAATGGAACATGTAAATTATCGG + Intronic
1193671526 X:84392405-84392427 ATTTGTTCCATGCAAATTTTAGG + Intronic
1194114869 X:89883720-89883742 TGTTGGTTCATGCAAATTTTAGG - Intergenic
1195007106 X:100696395-100696417 AGACTGACCATGCCAATTGTTGG - Intronic
1195129264 X:101838312-101838334 AGAAGGACCAAGCAAGATTTGGG - Intronic
1195176971 X:102321518-102321540 AGAAGGACCAAGCAAGATTTGGG + Intronic
1195181893 X:102365575-102365597 AGAAGGACCAAGCAAGATTTGGG - Intronic
1195509538 X:105698417-105698439 GGAGTGACCATGAAAATTTTAGG + Intronic
1196428331 X:115595527-115595549 AGATGAACCAAGCAAATGTGGGG + Intronic
1196433229 X:115650263-115650285 AGAGGGAAGATGCAAATTTAAGG - Exonic
1198927048 X:141809589-141809611 TGTTGTTCCATGCAAATTTTAGG + Intergenic
1200467659 Y:3540811-3540833 TGTTGGTTCATGCAAATTTTAGG - Intergenic