ID: 981741292

View in Genome Browser
Species Human (GRCh38)
Location 4:148004735-148004757
Sequence GTATTCTGGACGCTGAACTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 136}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981741292_981741300 17 Left 981741292 4:148004735-148004757 CCCCAGTTCAGCGTCCAGAATAC 0: 1
1: 0
2: 1
3: 6
4: 136
Right 981741300 4:148004775-148004797 GATTATAGCTTTGTGGGCTGAGG 0: 1
1: 0
2: 0
3: 12
4: 159
981741292_981741297 10 Left 981741292 4:148004735-148004757 CCCCAGTTCAGCGTCCAGAATAC 0: 1
1: 0
2: 1
3: 6
4: 136
Right 981741297 4:148004768-148004790 ACACCTTGATTATAGCTTTGTGG 0: 1
1: 0
2: 3
3: 33
4: 312
981741292_981741298 11 Left 981741292 4:148004735-148004757 CCCCAGTTCAGCGTCCAGAATAC 0: 1
1: 0
2: 1
3: 6
4: 136
Right 981741298 4:148004769-148004791 CACCTTGATTATAGCTTTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981741292 Original CRISPR GTATTCTGGACGCTGAACTG GGG (reversed) Intronic