ID: 981747612

View in Genome Browser
Species Human (GRCh38)
Location 4:148066717-148066739
Sequence TCTTCTGTGTGACCTGGGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 476
Summary {0: 1, 1: 0, 2: 7, 3: 67, 4: 401}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981747609_981747612 -9 Left 981747609 4:148066703-148066725 CCATGGCTTTCTTATCTTCTGTG 0: 1
1: 0
2: 3
3: 37
4: 477
Right 981747612 4:148066717-148066739 TCTTCTGTGTGACCTGGGACAGG 0: 1
1: 0
2: 7
3: 67
4: 401
981747608_981747612 3 Left 981747608 4:148066691-148066713 CCTGGGCTCACACCATGGCTTTC 0: 1
1: 0
2: 2
3: 19
4: 268
Right 981747612 4:148066717-148066739 TCTTCTGTGTGACCTGGGACAGG 0: 1
1: 0
2: 7
3: 67
4: 401

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981747612 Original CRISPR TCTTCTGTGTGACCTGGGAC AGG Intronic
900195498 1:1373649-1373671 TCTTCTGCAACACCTGGGACTGG + Intergenic
901181653 1:7346247-7346269 CTTGCTGTGTGACCTTGGACAGG + Intronic
901768152 1:11516843-11516865 TCTGCAGTGTGACCTTGGGCAGG + Intronic
901945952 1:12703872-12703894 TCATCTGTGTGAGCTGTGGCAGG - Intergenic
902211319 1:14906784-14906806 TCTTCTGTGTAGCCTGGGGGTGG - Intronic
902405570 1:16181694-16181716 TCTTCTGGGTTAGCTGGGATGGG - Intergenic
902449037 1:16485098-16485120 TCGACTGTGTGACCTGGGGCAGG - Intergenic
902505712 1:16938186-16938208 TCGACTGTGTGACCTGGGGCAGG + Intronic
902623207 1:17662421-17662443 ACTTCTGTGTGAACTTGGACGGG - Intronic
902660168 1:17895513-17895535 ACTCCTGTGTCACCTGGGGCAGG + Intergenic
902784527 1:18724450-18724472 TTTTCTGGGTGACCTGGTAATGG - Intronic
902926138 1:19696965-19696987 TGAGCTGTGTGACCTTGGACAGG + Intronic
903227597 1:21902526-21902548 TTTGCTGTGTGACCTGGAGCAGG - Intronic
903606193 1:24576659-24576681 CTTTCTGTGTGACCTGGGGCAGG - Intronic
903972807 1:27130041-27130063 TTTGCTGTGTGACCTTGGGCAGG + Intronic
904214833 1:28911039-28911061 TCTGCAGGGTGAGCTGGGACTGG + Intronic
904337438 1:29807187-29807209 CCTGCTGTGTGACTTGGGGCAGG + Intergenic
906309064 1:44740064-44740086 CCATCTGTGTGTCCGGGGACGGG - Intronic
906695460 1:47820419-47820441 CGTGCTGTGTGACCTTGGACAGG - Intronic
907373297 1:54016682-54016704 CCTGCTGTGTGACCTTGGCCTGG + Intronic
907515912 1:54993371-54993393 TCTTCAGAGTGCCCTGCGACAGG + Intergenic
908074781 1:60503814-60503836 TCTGCTCTGTGAACTGGCACTGG + Intergenic
908878732 1:68707094-68707116 TCTTATGTGTGACCTTAGAAAGG + Intergenic
911194559 1:94980549-94980571 TCTTCAGTTTGAGTTGGGACTGG + Exonic
915737371 1:158093613-158093635 ACGTCTTTGCGACCTGGGACGGG - Exonic
915814076 1:158948733-158948755 TTTTGAGTCTGACCTGGGACAGG + Intronic
916371976 1:164108482-164108504 TCCTCTGTGTGAACTAGTACTGG - Intergenic
916390427 1:164324796-164324818 ACAGCTGTGTGACCTTGGACAGG + Intergenic
917028682 1:170666940-170666962 GCTTCTGTGAGACCTGAGCCTGG + Intronic
917974095 1:180228684-180228706 ACTTTTGTGTGTCCTGGTACTGG - Intergenic
918451245 1:184661257-184661279 TGTTCTGTGCCACCTGGGCCAGG - Intergenic
919733936 1:200932863-200932885 TCCTTTATGAGACCTGGGACTGG + Intergenic
919772816 1:201173524-201173546 CCCTCTGTGTGAGCTGAGACCGG - Intergenic
919977118 1:202619954-202619976 TCAACTGTGTGACCTTGGGCAGG - Intronic
919980227 1:202638264-202638286 TTTTCTCTGTGTCCTGAGACTGG - Intronic
921674931 1:217966449-217966471 TCTTCTGTGTCAGCTGAGTCTGG + Intergenic
922532069 1:226352357-226352379 TCTACTGTATGACCTTGGGCAGG + Intergenic
1063980588 10:11448682-11448704 TATTCTGTGTAACCTGAAACTGG + Intergenic
1065692036 10:28344293-28344315 TCTTCTGTGTCACATGGTATTGG - Intergenic
1066026329 10:31363075-31363097 TCTTTTGTGGGACCTGTGGCCGG + Intronic
1066058277 10:31701067-31701089 CCTTCTCTTTGACCTGGGGCAGG + Intergenic
1067443584 10:46326899-46326921 CTTTGTGTGTGACCTGGGGCAGG + Intronic
1067775784 10:49164000-49164022 TCTTCCATGGGACCAGGGACTGG - Intronic
1068065082 10:52120673-52120695 TCTTCTGTGCACACTGGGACAGG + Intronic
1069075036 10:64030379-64030401 TCTGTTGTGTGACCTAGGGCAGG - Intergenic
1069209291 10:65735567-65735589 TATTCTGTGTGACCTTGGCTGGG - Intergenic
1069537234 10:69263604-69263626 TATGCTGCGTGACCTGGGGCAGG + Intronic
1069604307 10:69730200-69730222 ACTGCTGTGTGACCTTGGACAGG - Intergenic
1069642767 10:69966553-69966575 CCTCATGTGTGACCTGGGGCAGG + Intergenic
1069796011 10:71052448-71052470 CCTACTGTGTGACCTTGGCCTGG + Intergenic
1070828774 10:79406200-79406222 TTTGCTTTGTGACCTTGGACAGG - Intronic
1070917142 10:80162076-80162098 TCTCCTGGGTGACCTGGGCCTGG - Intronic
1072030841 10:91520811-91520833 ACAGCTGTGTGACCTTGGACAGG - Intergenic
1072655356 10:97326253-97326275 TCGGCTGTGTGATATGGGACAGG + Intergenic
1072756346 10:98023744-98023766 TCTTCTGTGTGTCCTGAAGCAGG - Intronic
1073518766 10:104104891-104104913 TCTTCTTTGTGAACTAAGACAGG + Intergenic
1073596812 10:104808854-104808876 TCTGCTGTGTGACTTTTGACAGG - Intronic
1074185046 10:111093787-111093809 TCTGTTGTGTGGCCTGGGTCGGG + Intergenic
1074258692 10:111830220-111830242 ACAGCTGTGTGACCTGGGGCAGG - Intergenic
1074302483 10:112245192-112245214 TCTTCTGAAGGACCTGGAACAGG + Intergenic
1074450462 10:113555253-113555275 TCAGCTGTATGACTTGGGACAGG - Intronic
1075336215 10:121610491-121610513 TTTGCTGTGTGACCTGGGGTAGG + Intergenic
1076144114 10:128103402-128103424 TCTTCAGTGTGACCTGCTGCTGG + Exonic
1077094284 11:792754-792776 TCTTCTGTGCGAACTGGGCAGGG + Intronic
1077366163 11:2162199-2162221 TCTTCCGTGTGATCTGGGGGTGG + Intergenic
1078582331 11:12548083-12548105 CTTTCTGTGTGACCTTGAACAGG + Intergenic
1079241552 11:18725802-18725824 TAGTCTGAGTGACCTTGGACAGG - Intronic
1079368526 11:19830425-19830447 ACTTATTTGTGACCTTGGACAGG + Intronic
1079639531 11:22787232-22787254 TATGCTGTGTGACCCTGGACAGG + Intronic
1081802784 11:45871154-45871176 TCTTCTGTGTCACTTGAGATTGG + Intronic
1081907625 11:46679612-46679634 TCTTCTGTTGGGCCTGGGGCTGG - Intronic
1082996766 11:59261559-59261581 TCAGCTGTGTGACTTTGGACAGG + Intergenic
1083881178 11:65548999-65549021 TCAGCTGTGTGACCTGGGGCAGG + Intronic
1083898428 11:65632015-65632037 ACCTCTCGGTGACCTGGGACTGG - Intronic
1084755909 11:71238476-71238498 GTTGCTGTGTGACCTTGGACAGG - Intronic
1085451341 11:76635877-76635899 AGCTCTGTGTGACCTGGGACAGG + Intergenic
1085706181 11:78788466-78788488 TGAGCTGTGTGACCTGGGGCAGG + Intronic
1085795932 11:79539899-79539921 TCCTCTGTGTGACCTGGTATGGG - Intergenic
1086039311 11:82456227-82456249 TCTACTGTGAGACCTTGGCCAGG + Intergenic
1086136861 11:83450449-83450471 TGTTCTGTGTGTCCTGGGACAGG - Intergenic
1086283009 11:85212751-85212773 TTTGCTGTGTGACCTTGGGCAGG - Intronic
1088118814 11:106343504-106343526 TCATCTCTGTGAGCTGGGGCTGG + Intergenic
1089078717 11:115759570-115759592 TCTTTTCTGCGACCAGGGACGGG + Intergenic
1090034316 11:123235242-123235264 CCTTCTGTGCGATCTGGGCCTGG + Intergenic
1090655798 11:128844211-128844233 TCTTCTGTGTGACCCAGGCAGGG + Intronic
1091443018 12:526392-526414 TCTTCTTTCTGGCCTGGGACAGG - Intronic
1092237126 12:6817284-6817306 TCTGCTGAGTGACTCGGGACAGG + Exonic
1092446057 12:8558645-8558667 TCTTGTGTCTGACCTGGAACAGG + Intergenic
1093401610 12:18753298-18753320 TCTCATGTGTCACCTGGGAAGGG - Intergenic
1094310465 12:29075066-29075088 TCTTCAGTGAGACCTGGAACAGG + Intergenic
1094666091 12:32522547-32522569 TCCTTTGTGTGACCTGGCAGGGG + Intronic
1095344388 12:41132461-41132483 TCTTCAGGGTGATTTGGGACAGG + Intergenic
1095637042 12:44447109-44447131 TGTTCTGGGTGATCTGGGCCAGG - Intergenic
1097026883 12:56063305-56063327 TCTTCTTTTTCACCTGGAACAGG - Intergenic
1097288870 12:57897449-57897471 TCTTCTGTTTAGCCTGGAACAGG - Intergenic
1097557547 12:61158181-61158203 TGTTCTGTGTGATCTTGGATTGG + Intergenic
1098156781 12:67607674-67607696 TCTTCTATGTGGCCTGTTACTGG - Intergenic
1098517403 12:71393412-71393434 TTAACTGTGTGACCTGGGATAGG - Intronic
1100684292 12:96969386-96969408 CCTTCTGTGGAACCTGAGACTGG - Intergenic
1100815234 12:98380636-98380658 TTATCTGTGTGACCTTGGACAGG - Intergenic
1100994566 12:100289801-100289823 TTTTCTGTGTGACATGGGAATGG + Intronic
1101266131 12:103089730-103089752 TCTACTGTGTGACATTGGTCAGG + Intergenic
1101419592 12:104539245-104539267 CCTGCTGTGTGACCTTGGGCAGG + Intronic
1102046247 12:109832157-109832179 CCTGCTGTGTGACCTTGGCCTGG - Intronic
1102232236 12:111270904-111270926 TGTGCTGTGTGACCTTGGCCAGG + Intronic
1102612419 12:114124161-114124183 TCTCCTGGGTGACTTGGGAAAGG - Intergenic
1102752394 12:115306851-115306873 TTATCTGTGTGACCTGACACAGG - Intergenic
1103145316 12:118590373-118590395 TCCTCTGTGTGACCTTGGACAGG + Intergenic
1103998454 12:124844951-124844973 GCTGCTGTGTGACCATGGACAGG - Intronic
1104401007 12:128476143-128476165 TCCTCTGAGTTACCTGTGACTGG + Intronic
1104715559 12:131013783-131013805 TCAGCTGTGTGACCTTGGGCAGG - Intronic
1104759318 12:131287460-131287482 TGTTCTGTGTGATCGGGGATTGG + Intergenic
1104821294 12:131679036-131679058 TGTTCTGTGTGATCGGGGATTGG - Intergenic
1104843007 12:131833610-131833632 TGTGCTGTGTGACCGTGGACAGG + Intronic
1104858120 12:131911329-131911351 CCTGCTCTGTGACCAGGGACCGG + Intronic
1106460077 13:29960791-29960813 TCTGCTCTGTGACCTGGAGCAGG - Intergenic
1107883305 13:44852439-44852461 TCTTCTTTGACACCTGGGAATGG - Intergenic
1108251281 13:48570484-48570506 ACTTGCATGTGACCTGGGACAGG - Intergenic
1108435782 13:50400477-50400499 TCTTCTGTGTGCCCTTACACAGG - Intronic
1110626689 13:77661652-77661674 TCTTTTGTGGGACCTGTGGCCGG + Intergenic
1111501154 13:89121558-89121580 TGTTATGTGTGCCCTGGAACAGG - Intergenic
1111650951 13:91090717-91090739 CCAGCTGTGTGACCTGGGGCAGG + Intergenic
1112352691 13:98649834-98649856 TCTTCTGTTTGACTTGGCATGGG + Intergenic
1113961275 13:114127584-114127606 TCTTCTCTGTGATCTTGGATTGG - Intronic
1115353421 14:32422036-32422058 TCTTCTGTCTGAACTGGGGGTGG + Intronic
1115361426 14:32507700-32507722 AATTCAGTGTGGCCTGGGACAGG + Intronic
1117520354 14:56545522-56545544 TCTTTTGTGTTAGCTGGGAGAGG + Intronic
1119211541 14:72835874-72835896 GCTTCTGGGTGTCCTGGGCCTGG - Intronic
1120798635 14:88665117-88665139 TTTTCTGTGTGACTTGAGCCAGG - Intronic
1121159497 14:91724243-91724265 TGGTCTGTGTGTCCTGGGGCAGG - Intronic
1121336190 14:93078833-93078855 TCTGCTGTGTGTCCTGGGTCAGG - Intronic
1121522254 14:94594118-94594140 GCTTCCCTGTGACCTTGGACTGG - Intronic
1121570567 14:94943705-94943727 TTAGCTGTGTGACCTTGGACAGG - Intergenic
1121631074 14:95422402-95422424 CTATCTGTGTGACCTTGGACTGG - Intronic
1121760033 14:96436885-96436907 TGTCCAGTGTGGCCTGGGACTGG + Intronic
1121809623 14:96871927-96871949 TCTTCTGCCTCAGCTGGGACTGG + Intronic
1122272850 14:100576097-100576119 CCTTCTGTGTGACTCTGGACAGG - Intronic
1122809236 14:104279871-104279893 TCTGCTGTGTGAACTTGGACAGG + Intergenic
1123204815 14:106701957-106701979 TTTTGTGTCTGACCTGGGACAGG - Intergenic
1123209817 14:106748398-106748420 TTTTGTGTCTGACCTGGGACAGG - Intergenic
1124492780 15:30168338-30168360 TCAACTGTGTGACCTTGGGCAGG - Intergenic
1124629958 15:31330434-31330456 TCCTCTATGTGACCAGGGACCGG + Intronic
1124680994 15:31730694-31730716 TCAACTGTGTGACCTTGGGCAGG + Intronic
1124697793 15:31880627-31880649 TCATCTGGATGACCTGGGATAGG - Intergenic
1124750754 15:32369987-32370009 TCAACTGTGTGACCTTGGGCAGG + Intergenic
1127960822 15:63888986-63889008 CCAGCTGTGTGACCTGGGGCAGG + Intergenic
1128695548 15:69759336-69759358 TCTTCTCCGTGACCTTGGGCAGG + Intergenic
1128780403 15:70355309-70355331 CCTGCTGTGTGACCTTGGGCAGG + Intergenic
1129264152 15:74385026-74385048 TATGCTGTGTGACCTTGGGCTGG - Intergenic
1129436268 15:75543226-75543248 TGGTCTGTGTGAACTGGGAGGGG - Intronic
1129612353 15:77070877-77070899 TCTTCTGGGTGAGCGGGGCCGGG - Exonic
1129709203 15:77811615-77811637 ACTGCTATGTGACCTTGGACAGG + Intronic
1130972966 15:88749011-88749033 TCATCTCTGTGACCTGGGACAGG - Intergenic
1131003481 15:88956776-88956798 CCATCTGTGTGACCTTGGGCAGG - Intergenic
1132032079 15:98446447-98446469 CCTGCTGTGTGTCCTGGCACTGG - Intronic
1132490399 16:226096-226118 TCTGCTGTTTGGCCTGGGATGGG - Intronic
1132921181 16:2394472-2394494 TCTTCTATGTGTCCTGTGTCTGG - Intergenic
1133050897 16:3116699-3116721 TGTTCTGTGTGTGCTAGGACGGG + Intronic
1135012765 16:18897251-18897273 TGTTCTGTTTTGCCTGGGACAGG - Intronic
1135188174 16:20332881-20332903 TCTGCTGTGTGACCTTAGATAGG - Intergenic
1135987278 16:27193213-27193235 TCAGCTGTGTGACCTCGGGCAGG + Intergenic
1136006591 16:27334547-27334569 TCTGCTGTGTGACTTTGGACAGG + Intronic
1136863800 16:33723678-33723700 TCTACTTTGTGTCTTGGGACTGG + Intergenic
1137420506 16:48329312-48329334 TGCTCTGTGTGACCCTGGACAGG + Intronic
1137718315 16:50612352-50612374 TCTGCTGTGTGACCCTGGACAGG - Intronic
1138601577 16:58058194-58058216 CTTGCTATGTGACCTGGGACAGG - Intergenic
1138631101 16:58294814-58294836 ACAGCTGTGTGACCTTGGACTGG - Intronic
1139306240 16:65988593-65988615 GCTCCTGTGAGACCTGGGACTGG + Intergenic
1139366255 16:66435274-66435296 TCTTCTCTGTGACCTTGGATGGG + Intronic
1140016509 16:71192093-71192115 GCTACTGTGTGAACTGGGGCAGG - Intronic
1141426823 16:83949651-83949673 TGTGCTGTGTGACCTGGGGGGGG - Intronic
1141692891 16:85606578-85606600 GCTTCTGGGTGACCCGGGAGAGG + Intergenic
1142351201 16:89581276-89581298 TGTTCTGTGTGACTGGTGACAGG - Intronic
1203125286 16_KI270728v1_random:1571825-1571847 TCTACTTTGTGTCTTGGGACTGG + Intergenic
1142761207 17:2042798-2042820 CCTTGTGTGTGCCCTGGGCCAGG + Exonic
1142814764 17:2416518-2416540 TCTGCTGTGTGTCCTGGGCAGGG - Exonic
1142870282 17:2815270-2815292 TACTCTGGGTGACCTGGGGCAGG + Intronic
1143031914 17:3972717-3972739 TCTTCGGGGTCACCTGGGCCTGG + Intergenic
1143389412 17:6551483-6551505 TCTACTGTGTATCTTGGGACGGG - Intronic
1143733393 17:8894067-8894089 TCTTCTGCGTGGCCTTGGCCAGG + Intronic
1144484704 17:15655179-15655201 TTTTCAGAGTGACCTGGTACTGG + Intronic
1145258704 17:21342161-21342183 CCTGCTGTGTGACCTTGGGCAGG - Intergenic
1145317925 17:21745843-21745865 CCTGCTGTGTGACCTTGGGCAGG + Intergenic
1145754532 17:27381065-27381087 TCTTCTGAGTGTCATGGGAACGG + Intergenic
1146082302 17:29791411-29791433 TCTTCTTTGTTACCTGGAACTGG + Intronic
1146624084 17:34422787-34422809 TTTCCTGTGTGACCATGGACAGG + Intergenic
1146795459 17:35777176-35777198 TCAGCTGTGTGGCCTGGGCCAGG - Intronic
1147038134 17:37697113-37697135 TCATCTGTGTGACCTTGGGCAGG + Intronic
1147513528 17:41094544-41094566 CCTTCTGTGGGACTTGTGACAGG - Intronic
1147598548 17:41732289-41732311 TGTTCTGTTTCACCAGGGACTGG + Exonic
1148219893 17:45853869-45853891 TCTGCTGTCTGACCTTGGGCAGG - Intergenic
1149284882 17:55151262-55151284 ACTACTGTGTGACCTTGGATGGG + Intronic
1149378402 17:56068549-56068571 CCTGCTGTGTGCCCTGGGGCTGG - Intergenic
1149499842 17:57144106-57144128 TGTTCTGTGTGACCTTGAGCAGG + Intergenic
1150108065 17:62477181-62477203 TCTTTTGTGTTGCCTTGGACCGG + Intronic
1150168122 17:62964592-62964614 CCTGCTGTGTGACCTTGAACAGG - Intergenic
1150223794 17:63511840-63511862 TTTGCTGTGTGACCTCGGGCTGG - Intronic
1151195302 17:72427017-72427039 TTTGCTTTGTGACCTGGGGCTGG - Intergenic
1151571165 17:74926161-74926183 TCTTCTGATTGAGCTGAGACAGG + Intronic
1152580003 17:81161709-81161731 CCTGCTGTGTGACCATGGACAGG - Intronic
1152738365 17:82008372-82008394 TGTTCTGTGTGAGGGGGGACGGG + Intronic
1153099957 18:1456049-1456071 TTTTCTGTATGATCTGGAACAGG + Intergenic
1153524527 18:5981831-5981853 GCTTTTGTGTGACTTGGAACTGG - Intronic
1154355967 18:13623468-13623490 TTTTCTGAGTAACCTGGAACTGG + Intronic
1155077171 18:22369200-22369222 TCTCCTAGGTTACCTGGGACTGG + Intergenic
1155867968 18:30990248-30990270 ACTTCTGTGTGACCTTTGAAAGG - Exonic
1156026084 18:32656217-32656239 TCATCAGTCTGACCTGGGCCCGG - Intergenic
1159258120 18:65975565-65975587 TGTTCTCAGTGACCTGGGGCTGG - Intergenic
1160188290 18:76693321-76693343 TCTTCTGTCTCTCCTCGGACGGG - Intergenic
1160462270 18:79048097-79048119 TCTTCTGTGTCACATGACACAGG + Intergenic
1160879382 19:1312647-1312669 CCTGCTCTGTGACCTGGGAGGGG + Intergenic
1160900611 19:1426188-1426210 CCCTCTGGGTGACCTGGGACTGG + Intronic
1161327195 19:3669634-3669656 CCTTCTGTGTGACCTCGGGTGGG - Intronic
1161927761 19:7313835-7313857 TCTTCTGTGTGGGATGGTACAGG - Intergenic
1162065502 19:8123013-8123035 TGTGCTGTGTGACCTAGGGCAGG - Intronic
1162830718 19:13282601-13282623 TCTGCTGTGTGACCCTGGACAGG + Intronic
1162959267 19:14116883-14116905 TCTTCTGTGTCACTTGGCATGGG - Intronic
1163262575 19:16199972-16199994 TCAGCTGTGTGACCTGGGACAGG + Intronic
1163611075 19:18301890-18301912 ATTGCTGTGTGACCTGGGGCAGG + Intergenic
1163736820 19:18986685-18986707 TGTGCTGTGTAACCTGGGGCGGG - Intergenic
1164576896 19:29410481-29410503 GGCTCTGTGTCACCTGGGACTGG + Intergenic
1164747582 19:30627560-30627582 TGTGCTGTGTGACCTTGGATAGG + Intronic
1165037228 19:33042392-33042414 TCATCTGTGTGACGTGAGAGAGG - Intronic
1165077752 19:33290271-33290293 CCTGCTGTGTGACCCGGCACAGG - Intergenic
1165411622 19:35665803-35665825 CCTGCTGTGTGACCTTGCACAGG - Intergenic
1165446697 19:35860660-35860682 TGTGCTGTGTGAGCTGGGGCCGG + Exonic
1165523396 19:36331815-36331837 TCTTCTGTGTTGCCTGGAAACGG - Intergenic
1165717196 19:38054002-38054024 TCTGCCGTGTGACCTTGGACAGG - Intronic
1165959285 19:39520869-39520891 GCGTCTCTGTGACCTGGGGCTGG + Intergenic
1165965117 19:39570883-39570905 GCTTCTGTCTGTCCTGGGAAAGG - Intergenic
1165983951 19:39751190-39751212 TCTTCTCTGGGAGCTGGGAGAGG + Intergenic
1166783818 19:45356054-45356076 TTTGCTGTGTGACCTTGGGCAGG - Intronic
1166936786 19:46338737-46338759 CTTGCTGTGTGACCTGGGGCAGG - Intronic
1167278539 19:48553138-48553160 TTTGCTGTGTGATCTGGGGCAGG - Intronic
1167552436 19:50170183-50170205 TGTTCTGTGTGACATTGGGCAGG + Intergenic
1167684370 19:50946908-50946930 TCTTCTCTGTGCCCTGGGTGTGG - Intronic
1168108422 19:54178728-54178750 TCTGCAGTGTCACCTGAGACTGG + Intronic
925427048 2:3758562-3758584 TCTTGTGTAGGACCTGAGACAGG + Intronic
926142421 2:10375633-10375655 GCAGCTGTGTGACCTGGGACAGG + Intronic
926606028 2:14899220-14899242 TCTTCTGTCTGGGCTGGGCCTGG - Intergenic
926838277 2:17048943-17048965 TCTGCAGTGTGACCTTGGACAGG + Intergenic
927321884 2:21756620-21756642 TCTTTTGTGTTACCTGGAAATGG + Intergenic
927855805 2:26527338-26527360 TCTACTGTGTGACCCTGGAAAGG - Intronic
928319887 2:30274592-30274614 GCTTCATTTTGACCTGGGACAGG - Intronic
929938477 2:46312321-46312343 TGATGTGTGTGACCTAGGACAGG + Intronic
931836365 2:66102835-66102857 TTTTCTGTGTTCCCTGGGACAGG + Intergenic
931994791 2:67829599-67829621 TCCTCTGTGTGACCTTGGGCAGG - Intergenic
932320830 2:70820829-70820851 TCTTCTCTGGGGGCTGGGACTGG + Intergenic
932391512 2:71394667-71394689 TTTGGTGTCTGACCTGGGACAGG - Intronic
932844819 2:75124346-75124368 TCTGCTGAGTGATTTGGGACTGG - Intronic
934196852 2:89844432-89844454 TCTTCTGTGTGAACAGGGCCAGG + Intergenic
934628555 2:95888243-95888265 TCTACTTTGTGACTGGGGACTGG + Intronic
934630726 2:95918165-95918187 TCTACTTTGTGTCTTGGGACTGG + Intronic
934630869 2:95920043-95920065 TCTACTTTGTGTCTTGGGACTGG + Intronic
934804972 2:97213274-97213296 TCTACTTTGTGACTCGGGACTGG - Intronic
934832511 2:97544108-97544130 TCTACTTTGTGACTCGGGACTGG + Intronic
935223702 2:101035836-101035858 TCAGCTGTGGGACCTGGGTCAGG - Intronic
935413749 2:102793027-102793049 CCGTCTGTGTGACCTGGTTCAGG + Intronic
935757332 2:106286505-106286527 TCTTTTGTGTGGCCAGGGCCGGG + Intergenic
936252113 2:110874933-110874955 TCTCCTGTGTTATCTGGGAGCGG + Intronic
936941772 2:117891054-117891076 TGTTCAGCTTGACCTGGGACGGG + Intergenic
937053307 2:118909687-118909709 CATACTGTGTGACCTGGAACTGG - Intergenic
937744872 2:125400326-125400348 TGTGCTGTGTGACCTTGGATGGG + Intergenic
937866396 2:126754456-126754478 GATGCTGTGTGCCCTGGGACTGG - Intergenic
938109577 2:128554833-128554855 CCGTATGTGTGGCCTGGGACAGG + Intergenic
938343924 2:130553359-130553381 TCTCCTGTGTGAGCTGGGCTTGG + Intergenic
938345909 2:130567363-130567385 TCTCCTGTGTGAGCTGGGCTTGG - Intergenic
938683124 2:133712320-133712342 TGAGCTGTGTGACCTGGGGCAGG - Intergenic
938943313 2:136188300-136188322 TCTGCTGGGTGACCGTGGACAGG + Intergenic
940220847 2:151349714-151349736 TTTTCTGTGTGACCAGGTAGAGG - Intergenic
941815306 2:169790054-169790076 ACCGCTGTGTGAGCTGGGACTGG + Intergenic
941844363 2:170118594-170118616 TTTTGTGTCTGAACTGGGACAGG - Intergenic
942748540 2:179263986-179264008 TCCTTTGTGTGACCGGTGACCGG - Intronic
944125202 2:196284501-196284523 CCCACTGTGTGACCTTGGACAGG + Intronic
944861591 2:203820240-203820262 TCTTCTCTTTTACCTGGCACTGG + Intergenic
945190481 2:207182477-207182499 TCCTCTGTGGGGCCTGGGCCTGG - Intergenic
945212006 2:207393359-207393381 TCAGCTGTGTGACCTTGGGCAGG - Intergenic
945681012 2:212914511-212914533 TTTTAGGTGTGACCTGGGAAAGG + Intergenic
947555784 2:231092149-231092171 TTTTGGGTCTGACCTGGGACGGG + Intronic
947588334 2:231370569-231370591 GCTTCTGTTTGACCTGGGGGTGG - Intronic
1170904783 20:20503506-20503528 TCTTCTTTGTGACCTTTGTCAGG - Exonic
1171426115 20:25049765-25049787 GCCTCTGTGTGACCTTGGCCAGG - Intronic
1172950696 20:38721834-38721856 GATTCTGTGTGACCTTGGGCAGG + Intergenic
1173944878 20:46942646-46942668 TCTCCTGTGTGACTTGGGCAAGG + Intronic
1174077785 20:47950562-47950584 GCTTCTGGGTGTCCTGGGAACGG - Intergenic
1174116804 20:48231800-48231822 TCTTTTGTGGCACTTGGGACTGG + Intergenic
1174140130 20:48406906-48406928 GCTTCTGGGTGTCCTGGGAACGG + Intergenic
1174302797 20:49594557-49594579 TGTGCTCTGTGACCTGGGGCTGG - Intergenic
1174362665 20:50038727-50038749 TGTGCTCTGTGACCTGGGGCAGG - Intergenic
1174399254 20:50267219-50267241 CCTGCTGTGTGACCTCGGGCAGG - Intergenic
1174450410 20:50616696-50616718 TCTGCTGTGTGACCGGGGCTGGG - Intronic
1175328835 20:58148709-58148731 TCTTCTGTCTCATCTGGGGCTGG + Intergenic
1175335529 20:58193504-58193526 GCTCCTGTGAGACGTGGGACAGG + Intergenic
1175411982 20:58776441-58776463 TTCTCTGTGTGACCTTGGACAGG + Intergenic
1176030200 20:63007948-63007970 CCTTCTGTGTGACCTGGGAAGGG + Intergenic
1178304865 21:31483005-31483027 CCAGCTGTGTGACCTGGGGCAGG - Intronic
1178672715 21:34606007-34606029 TCACCTGTGTGACCTCAGACAGG + Intronic
1179498587 21:41791327-41791349 TGTTCTCTGTGTCCTTGGACAGG + Intergenic
1181771167 22:25126694-25126716 TTTGCTGTGTGACCTTGCACAGG - Intronic
1182014425 22:27027019-27027041 TCTCCTGTGTGACCTTGGGCAGG + Intergenic
1182028861 22:27141604-27141626 TCTGCTGTGTGAACTTGGCCAGG + Intergenic
1182103413 22:27672604-27672626 TCTTCTGGGAGAGCTGGGCCAGG - Intergenic
1182527736 22:30931998-30932020 TCTTCACTGTTGCCTGGGACAGG + Intronic
1182873194 22:33666619-33666641 TCTCCTGTCTGACCTGAGCCTGG - Intronic
1182930695 22:34171447-34171469 TTAACTGTGTGACCTTGGACTGG - Intergenic
1183985013 22:41564791-41564813 AGTGCTGTGTGACCTGGGGCAGG - Intronic
1183985455 22:41567636-41567658 CCTACTGTGTGAGCTGGTACAGG - Intronic
1184368912 22:44070211-44070233 TCTGCGGTGTGACCTTGGGCAGG - Intronic
1184467568 22:44677741-44677763 CATGCTGTGTGACCTTGGACAGG + Intronic
1184689944 22:46112963-46112985 CTTGCTGTGTGACCTTGGACAGG + Intronic
1184773791 22:46613248-46613270 ACAGCTGTGTGACCTCGGACAGG - Intronic
1184868726 22:47219661-47219683 CCTTCGGTGTGAGCTGGGCCTGG - Intergenic
1185164553 22:49253249-49253271 TCTACTGTCTGACCTTGGAATGG - Intergenic
949607631 3:5671836-5671858 GGTTCTGTGTGACCTAGAACAGG + Intergenic
950123777 3:10499059-10499081 ACTACTGTGTGACCTTGGGCAGG - Intronic
950168548 3:10819883-10819905 CCTGCTGGGTGACCTGGGATTGG + Intronic
950541432 3:13615521-13615543 CCTTCTGTGTGACCTGCCCCAGG - Intronic
950728803 3:14938027-14938049 TTTTGTGTGTGACCCTGGACAGG - Intergenic
952354677 3:32573019-32573041 TGATCTGTGTGACCTGGGGTAGG - Intergenic
952523642 3:34186859-34186881 TGAGCTGTGTGACCTGGAACAGG - Intergenic
953191308 3:40690686-40690708 TGTGTTGTGTGACCTGGGTCGGG - Intergenic
953209812 3:40865890-40865912 ACTTGTGTGTGACTTTGGACTGG + Intergenic
953883591 3:46703697-46703719 TCCTCTGGGTTACCTGGGACAGG + Intronic
954463359 3:50640254-50640276 TAAGCTGTGTGACCTGGGGCAGG + Intronic
954649770 3:52154056-52154078 ACTCATGTGTGACCTGGGGCCGG - Intronic
954710472 3:52502901-52502923 TGTTCTGTGTGACTTGGAGCAGG - Intronic
958475203 3:94571859-94571881 ACTTTTGTGTGATGTGGGACAGG + Intergenic
958477579 3:94604342-94604364 TCCTCTCTGTGAACTAGGACTGG - Intergenic
960173240 3:114487663-114487685 TCTTCCCTGTGTTCTGGGACAGG - Intronic
961211076 3:125126354-125126376 TCTTCTGTGAGACCAGACACTGG - Intronic
961380165 3:126491919-126491941 CCTGCTGTGTGACCTTGGGCAGG - Intronic
961653806 3:128430497-128430519 GCTTCTGTGCGAGCTGGGGCTGG - Intergenic
962637479 3:137345947-137345969 ACTTCTCTGTGACCTGAAACAGG - Intergenic
964726434 3:159818708-159818730 TTTGCTCTGTGACCTTGGACAGG - Intronic
965095168 3:164216761-164216783 TTTTGTGTCTGACCTGGGACAGG + Intergenic
966222751 3:177566777-177566799 CCTGCTGTGTGGCCTGGGGCTGG - Intergenic
969087676 4:4668546-4668568 CCTGCTGTGTGTCCTTGGACAGG + Intergenic
969403558 4:6973469-6973491 TATTCCGTCTAACCTGGGACCGG - Intronic
969841725 4:9887726-9887748 CCATCTGTGTGACCTTGGACAGG + Intronic
970347650 4:15169226-15169248 CCCTCAGTGTGAACTGGGACCGG + Intergenic
970414031 4:15838739-15838761 TCATCTGTGTGACCTCAGGCAGG + Intronic
970472275 4:16390816-16390838 TTTTCTCTGTGACCTTGGACAGG + Intergenic
970564312 4:17316550-17316572 ACTGCTGTGTGACCATGGACAGG - Intergenic
972988346 4:44792937-44792959 TCTTCTGTGTGTAATGGAACCGG - Intergenic
973960731 4:56107293-56107315 TTTTCTATGTGACCTTGAACAGG + Intergenic
977802725 4:101257057-101257079 TCTGCTATGTGACCTTGGATGGG + Intronic
980525956 4:133991680-133991702 TTTTGTGTCTGACCTGGGACAGG + Intergenic
980629203 4:135411300-135411322 TTTTGTATCTGACCTGGGACAGG - Intergenic
981747612 4:148066717-148066739 TCTTCTGTGTGACCTGGGACAGG + Intronic
983682489 4:170370042-170370064 TTATCTGTGTGACCTTGGAGGGG + Intergenic
985180566 4:187257025-187257047 CCTTCTGTGTGACCTTAGGCAGG - Intergenic
986241181 5:5961352-5961374 GCTTCTCCTTGACCTGGGACTGG - Intergenic
986961821 5:13222137-13222159 TCTTCTGTCTGCTCTGGGGCGGG - Intergenic
987378189 5:17257622-17257644 TCAGCTATGTGACCTGGGGCAGG - Intronic
988952775 5:36281404-36281426 TTATCTGTGTGACCTGAGACAGG - Intronic
989028575 5:37093074-37093096 TTTTGTGTCTGACCTGGGACAGG - Intergenic
990605261 5:57403425-57403447 TCATCTGTGTGAGCTAGGACAGG - Intergenic
991453442 5:66777468-66777490 TCCACCGTGTGACCTTGGACAGG - Intronic
992424462 5:76642249-76642271 ACTGCTGTGTGACCTGAGACTGG - Intronic
995651443 5:114373532-114373554 TCAGCTGTGTGACCTTGGACAGG + Intronic
997193087 5:131958172-131958194 TACTCTGTGTGCCCTGGGACAGG + Intronic
997211753 5:132080995-132081017 CTTGTTGTGTGACCTGGGACAGG + Intergenic
997365619 5:133323433-133323455 TTTACTGTGGGGCCTGGGACAGG + Intronic
997370166 5:133354497-133354519 TCCTCAGTGAGACCTGGGCCTGG - Intronic
997517631 5:134502178-134502200 ACTTCTGTGTGGCCTAGGGCAGG - Intergenic
997726076 5:136120715-136120737 TGATCTGTGTGAGCAGGGACAGG + Intergenic
999191338 5:149749734-149749756 TTTGCTGTGTGACCTTGGACAGG + Intronic
999423465 5:151465316-151465338 TAAGCTGTGTGACCTGGGGCTGG + Intronic
999665778 5:153911324-153911346 TCTTGTTTCTGACCTTGGACAGG - Intergenic
1001423960 5:171611342-171611364 TCTTATTTGTCACCTGGGGCAGG + Intergenic
1001492295 5:172164504-172164526 CCTGCTGTGTGACCTTGGGCCGG - Intronic
1001529362 5:172451623-172451645 TCTGCTGTGTGACCTCGGACTGG - Intronic
1002607140 5:180390143-180390165 TCTTCTGAGTGCCCTGTGCCTGG - Intergenic
1004341619 6:14812978-14813000 TCCTCTGTGTCACCTAGAACCGG + Intergenic
1006893715 6:37452219-37452241 TTTGCTGTGTGACCTTGGCCCGG + Intronic
1007413736 6:41679930-41679952 TCTTCTGTGAGGCCGGAGACCGG - Intergenic
1007495413 6:42257020-42257042 CCTTGTGTGTGTCCTGGGCCAGG + Exonic
1007713355 6:43838681-43838703 TCTTCTGGCTGCCCTGGGCCTGG - Intergenic
1008043379 6:46826672-46826694 TCTTTTGTGTGCCCAGAGACTGG - Intronic
1009818708 6:68771800-68771822 TCTTCTGTCTGACCTGCAAGGGG + Intronic
1010626306 6:78139537-78139559 TTTTATGTCTGACCTGGTACAGG - Intergenic
1010947543 6:81995646-81995668 TCTTCTCTCTGATCTGGCACAGG + Intergenic
1017693861 6:156994724-156994746 TCTTCTGTCTGGTCTTGGACAGG - Intronic
1017860410 6:158392618-158392640 TCAGCTGTGTGACCTGAGGCTGG - Intronic
1019448498 7:1083814-1083836 TCTGCTGTGTCGCCTGGCACTGG - Intronic
1019518695 7:1450976-1450998 CCCGCTGTGTGACCTGGGGCAGG - Intronic
1021038514 7:15831438-15831460 CCTTCTTTGTAACTTGGGACAGG - Intergenic
1021067660 7:16197042-16197064 TATTCTGTTTGACCTGGGTTTGG - Intronic
1021932098 7:25591599-25591621 ATTTCTGTGGGACCTGGCACAGG - Intergenic
1022391136 7:29945443-29945465 CCCTCTGTGTGACCTTGGGCAGG + Intronic
1022482142 7:30751369-30751391 TCTTCTCTTTGAAATGGGACTGG - Intronic
1022789642 7:33674049-33674071 CCCTCTGTGTGCCCTGGCACTGG + Intergenic
1023648695 7:42345811-42345833 TTTTCTATGTGACTTGGGAAAGG - Intergenic
1024241291 7:47438552-47438574 TCTTGTCTGTGACCTGGCAGTGG - Intronic
1026442635 7:70457493-70457515 GCTTCTGTGTGATTTGTGACTGG - Intronic
1026978209 7:74511687-74511709 TGTGCTGCGTGGCCTGGGACAGG - Intronic
1028020449 7:85764900-85764922 TTTTGTGTCTGACCTGGGACAGG - Intergenic
1028573017 7:92313339-92313361 TCTTCAGTCTGACCTGTGAATGG - Intronic
1029940159 7:104471646-104471668 TCTACTGTGTGGCCTTGGGCAGG + Intronic
1030494417 7:110279962-110279984 TATTCTGTGGCACCTGGTACTGG + Intergenic
1031402635 7:121343966-121343988 CCTTCTGTGTGACCTTGGGCTGG - Intergenic
1032037111 7:128529713-128529735 TCTTTTGTGTTGCCTTGGACCGG + Intergenic
1032165036 7:129538808-129538830 ACTCCTCTGTGACCTTGGACAGG - Intergenic
1032839691 7:135704149-135704171 TTTCCTGGGTCACCTGGGACAGG + Intronic
1032852996 7:135811115-135811137 TCTGCTGTGTGACCTCTGGCAGG - Intergenic
1034556951 7:151856238-151856260 TTGGCTGTGTGACCTTGGACAGG - Intronic
1034798376 7:154034358-154034380 TCCTCTGTGTGAACTTGAACAGG - Intronic
1035101189 7:156398183-156398205 TCAACTGTGTGACCTGGAGCAGG - Intergenic
1035215004 7:157359081-157359103 GCATCTGTGTGACCAGGGCCTGG + Intronic
1036550496 8:9811210-9811232 TTTTGGGTCTGACCTGGGACAGG - Intergenic
1037307394 8:17519897-17519919 TCTTCTGTGAACCCTGGGAATGG + Intronic
1037506973 8:19540335-19540357 TCTTTAGTGTTACCTGGGTCGGG + Intronic
1038440270 8:27566476-27566498 TTGTCTGTGTAACCTGGGGCAGG + Intergenic
1038681272 8:29670601-29670623 ACTGCTGTGTGGCCTGGTACTGG - Intergenic
1039742407 8:40394704-40394726 TCTGCTTTGTGACCTGAGATAGG - Intergenic
1040878262 8:52175517-52175539 CCTGCTGTGTGACCTTGGACAGG + Intronic
1041096458 8:54355273-54355295 TCTTCTGCCGGACCTGGGCCTGG - Intergenic
1041332926 8:56747973-56747995 CCTGCTGTGTGACCTGGTACTGG - Intergenic
1041402635 8:57461351-57461373 TTTTATGTCTGACCTGGGACAGG - Intergenic
1041476798 8:58276587-58276609 TCTTCTCTGTGTCCTAGGCCTGG - Intergenic
1041855806 8:62453488-62453510 TCTTCTGTTAGACCTGGGGCTGG - Intronic
1044604026 8:94033473-94033495 TGTGCTGTGTGACCTTGGACAGG - Intergenic
1045416886 8:101976342-101976364 TCTCCTGAGGGACCTGGGATTGG + Intronic
1047435621 8:124833517-124833539 TCCTCTGTGTGGCCCTGGACAGG + Intergenic
1048488320 8:134868914-134868936 CTTGCTGTGTGACCTGGAACAGG - Intergenic
1049158896 8:141084776-141084798 CCTTCAGCGTGGCCTGGGACAGG - Intergenic
1049207733 8:141371241-141371263 TTTGCTGTGTGACTTTGGACAGG - Intergenic
1049402485 8:142435704-142435726 TCTTCTGTGTGAGTTGGAGCAGG + Intergenic
1049817855 8:144616292-144616314 CCTGGTCTGTGACCTGGGACAGG + Intergenic
1049992325 9:1001698-1001720 GCTTACATGTGACCTGGGACAGG + Intergenic
1049995704 9:1031967-1031989 CCTTCTCTGTGGCCTGGCACGGG + Intergenic
1050925148 9:11255560-11255582 TTTTTTATCTGACCTGGGACAGG + Intergenic
1052320667 9:27164145-27164167 TATGCTGTGTGATCTTGGACAGG + Intronic
1053161881 9:35818957-35818979 TCCTCTGTGCGGCCTGTGACCGG - Exonic
1053204060 9:36171664-36171686 TCCTCTCTCAGACCTGGGACGGG - Intergenic
1053305145 9:36979642-36979664 TCTGCTGTGTGACCCTGGGCAGG - Intronic
1055327894 9:75150995-75151017 TCTGCTGAGTGACCTGCGACAGG + Intergenic
1055668067 9:78571997-78572019 CTTTCTGTGTGACCTAGGACAGG - Intergenic
1057817050 9:98303593-98303615 GCTTGTGTGTGACCTGGGGCAGG + Intronic
1057872153 9:98726452-98726474 TCTGCTGTGTGACCTTGGACTGG + Intergenic
1058554705 9:106154692-106154714 AGTTCAGTGTGACCTGGGAGTGG + Intergenic
1059219475 9:112600163-112600185 TCTTTTCTGTGACTTGGAACTGG + Intronic
1059404031 9:114089039-114089061 TGTGCTGTGTGACTTGGGGCAGG - Intronic
1059404515 9:114091816-114091838 ACTGCTGTGTGACCTCAGACTGG - Exonic
1061009419 9:127946309-127946331 GCTTATGGGTGACTTGGGACAGG - Intronic
1061133239 9:128719913-128719935 TCCTCTGTGTCCCCTGGGAACGG - Exonic
1061326234 9:129866469-129866491 TGTGCTGTGTGACCTGGGTGAGG - Intronic
1061373442 9:130210716-130210738 ACCTGTGTGTGACCTGGGGCAGG - Intronic
1061870288 9:133516778-133516800 CCCACTGTGTGACCTGGGGCAGG - Intronic
1186726627 X:12365285-12365307 CCTTCTGTGGGACCTTGGGCCGG + Intronic
1188085857 X:25899989-25900011 TTTTGTGTCTGACCTGGGACAGG - Intergenic
1188311593 X:28623895-28623917 TCTTCAGTGTCATCTGGCACTGG + Intronic
1189987027 X:46562569-46562591 TCTTCAGTATGACCTGGTGCTGG + Intergenic
1190726671 X:53194558-53194580 TCTGCAGTGTGACCTGTGTCAGG - Exonic
1190824432 X:54004074-54004096 TCTACTGTGTGCCCTGGTATTGG - Intronic
1191210322 X:57877596-57877618 TTTTGTGTCTGACCTGGGACAGG - Intergenic
1191634235 X:63359142-63359164 TTTTGGGTCTGACCTGGGACAGG + Intergenic
1192206108 X:69097479-69097501 ACTTCTACGTGACCTGGGCCAGG + Intergenic
1192717455 X:73659453-73659475 TTTTGTGTCCGACCTGGGACAGG + Intronic
1195570680 X:106395458-106395480 TCCTCTATGTGGCCTGGGACTGG + Intergenic
1195995158 X:110724348-110724370 TCTTCTGAGTAACCTGGCACTGG + Intronic
1196689531 X:118544593-118544615 TTTGCTGTATGACCTTGGACTGG - Intronic
1197346138 X:125327197-125327219 TCATGTGTGTGACCTGTGCCCGG - Intergenic
1198694241 X:139318917-139318939 TCTTCTTTCTGACCTGACACTGG - Intergenic
1199030000 X:142986547-142986569 TTTTCTGTGTGACCTTGGTAAGG - Intergenic
1199618294 X:149676746-149676768 TTTTGCGTCTGACCTGGGACAGG + Intergenic
1199624348 X:149726503-149726525 TTTTGCGTCTGACCTGGGACAGG - Intergenic
1200823937 Y:7619899-7619921 TTTTGTGTCTGACCTGGGACAGG + Intergenic
1201055031 Y:9979918-9979940 TTTTGTGTCTGACCTGGGACAGG - Intergenic
1201963509 Y:19707566-19707588 TCTGCAGTGTGACCTGTGTCAGG - Exonic
1202053511 Y:20805219-20805241 TTTTGTGTCTGATCTGGGACAGG - Intergenic
1202117715 Y:21487998-21488020 TGTTCTGTGTGAACTGTGTCAGG - Intergenic
1202191369 Y:22249537-22249559 TTTTGTGTCTGACCTGGGACAGG + Intergenic
1202236118 Y:22711189-22711211 TTTTGTGTCTGACCTGGGACAGG - Intergenic
1202307045 Y:23484979-23485001 TTTTGTGTCTGACCTGGGACAGG + Intergenic
1202563760 Y:26185607-26185629 TTTTGTGTCTGACCTGGGACAGG - Intergenic