ID: 981748021

View in Genome Browser
Species Human (GRCh38)
Location 4:148069381-148069403
Sequence CCTTCCAGGGAGGGGAGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 823
Summary {0: 1, 1: 0, 2: 9, 3: 93, 4: 720}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981748008_981748021 27 Left 981748008 4:148069331-148069353 CCTTGGTCGCCTCTGTAAAGCAG 0: 1
1: 0
2: 0
3: 9
4: 115
Right 981748021 4:148069381-148069403 CCTTCCAGGGAGGGGAGGGCTGG 0: 1
1: 0
2: 9
3: 93
4: 720
981748006_981748021 29 Left 981748006 4:148069329-148069351 CCCCTTGGTCGCCTCTGTAAAGC 0: 1
1: 0
2: 0
3: 6
4: 60
Right 981748021 4:148069381-148069403 CCTTCCAGGGAGGGGAGGGCTGG 0: 1
1: 0
2: 9
3: 93
4: 720
981748009_981748021 18 Left 981748009 4:148069340-148069362 CCTCTGTAAAGCAGTGACATCTC 0: 1
1: 0
2: 1
3: 12
4: 144
Right 981748021 4:148069381-148069403 CCTTCCAGGGAGGGGAGGGCTGG 0: 1
1: 0
2: 9
3: 93
4: 720
981748012_981748021 -9 Left 981748012 4:148069367-148069389 CCTACTGGCTTCTGCCTTCCAGG 0: 1
1: 1
2: 3
3: 64
4: 721
Right 981748021 4:148069381-148069403 CCTTCCAGGGAGGGGAGGGCTGG 0: 1
1: 0
2: 9
3: 93
4: 720
981748011_981748021 -8 Left 981748011 4:148069366-148069388 CCCTACTGGCTTCTGCCTTCCAG 0: 1
1: 0
2: 5
3: 48
4: 619
Right 981748021 4:148069381-148069403 CCTTCCAGGGAGGGGAGGGCTGG 0: 1
1: 0
2: 9
3: 93
4: 720
981748007_981748021 28 Left 981748007 4:148069330-148069352 CCCTTGGTCGCCTCTGTAAAGCA 0: 1
1: 0
2: 0
3: 5
4: 81
Right 981748021 4:148069381-148069403 CCTTCCAGGGAGGGGAGGGCTGG 0: 1
1: 0
2: 9
3: 93
4: 720
981748005_981748021 30 Left 981748005 4:148069328-148069350 CCCCCTTGGTCGCCTCTGTAAAG 0: 1
1: 0
2: 0
3: 5
4: 86
Right 981748021 4:148069381-148069403 CCTTCCAGGGAGGGGAGGGCTGG 0: 1
1: 0
2: 9
3: 93
4: 720

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981748021 Original CRISPR CCTTCCAGGGAGGGGAGGGC TGG Intronic
900033446 1:387855-387877 CCTTCCACCGGGGGAAGGGCTGG + Intergenic
900054284 1:617744-617766 CCTTCCACCGGGGGAAGGGCTGG + Intergenic
900142495 1:1144577-1144599 CCTGGCAGGGAGGGGAGCGCTGG - Intergenic
900469831 1:2848282-2848304 CTCTGCAGAGAGGGGAGGGCTGG - Intergenic
900493944 1:2967684-2967706 CCTTTTAGGCAGGAGAGGGCAGG - Intergenic
900619915 1:3581929-3581951 GCTTCCTGGGAGGGCAGGGAGGG - Intronic
900642150 1:3692828-3692850 CATTCCCGGGAGGGGTGGGGAGG + Intronic
900889604 1:5440176-5440198 CTTCCCAGGGTGGGGATGGCAGG + Intergenic
901395398 1:8977376-8977398 ACTTTCAGGGGTGGGAGGGCTGG - Intergenic
901772191 1:11536173-11536195 CCTCCCAGGGTTGGGAGGGTAGG - Intronic
902333555 1:15742593-15742615 CACTCGAGGGAGGGGAGGCCGGG - Exonic
902531899 1:17096003-17096025 CCTGCCAGGCAGGGCAGGGCAGG + Intronic
903035558 1:20490462-20490484 CCTTTCAAGGAGGGTAGGGAAGG - Intergenic
903217297 1:21850333-21850355 GCTCTCAGGGAGGGCAGGGCTGG - Intronic
903573571 1:24323706-24323728 AGTTCCAGAGAGGGGAGGGAAGG - Intronic
903767982 1:25747026-25747048 CCTTGCAGGGAGGGGATGGATGG - Intronic
903859725 1:26357332-26357354 TCTTCCAGGCGGGGGCGGGCAGG + Intergenic
903941949 1:26938092-26938114 CCAACCAGGGTGGGGAGGGCTGG - Intronic
904336439 1:29801148-29801170 CTCTCCAGGGTGGGGTGGGCAGG + Intergenic
904358712 1:29958803-29958825 CCTGAAAGCGAGGGGAGGGCTGG + Intergenic
904470591 1:30733714-30733736 CCTGCCAGGGAGGGGCGGGAGGG + Exonic
904659789 1:32075805-32075827 CCTACCAGGGAGGTGTGGGAGGG - Exonic
904896723 1:33823259-33823281 CCTTCCAGGGAGGACTGAGCAGG + Intronic
904918152 1:33985243-33985265 CTTCCCAGGGAGGGGTGGGGTGG - Intronic
905028135 1:34865289-34865311 CCTTCCAGGGATGGGCCAGCTGG - Intergenic
905795333 1:40812949-40812971 TCTTTCAGAGAGGGGATGGCTGG + Intronic
905871123 1:41405154-41405176 CCTACCAGAGAGGTGAAGGCTGG + Intergenic
906032349 1:42731820-42731842 CCTTCTGGGGTGGGGGGGGCGGG + Intergenic
906145485 1:43557983-43558005 CCTAGGAGGGAGGGGAGGGGTGG - Intronic
906405574 1:45539340-45539362 CCTTCCTGGAGGGGGAGGGGGGG + Intergenic
906545738 1:46618024-46618046 CCTGCTTGGGAGTGGAGGGCGGG + Intergenic
906549763 1:46654688-46654710 CCTGTCAGGGGGTGGAGGGCTGG - Intronic
906607824 1:47183823-47183845 ACTTCAAGGGCGGGTAGGGCCGG + Exonic
906693834 1:47810929-47810951 CCTGCCAGGGAGGACAAGGCGGG + Intronic
906800625 1:48734040-48734062 CCTACCAGGCAGGGCAGGGCAGG + Intronic
906948939 1:50318773-50318795 CCTGCCAGGGAGGCCAGGACAGG + Intergenic
907305234 1:53509470-53509492 CCCTGCAGGGAGGGGAGGGCAGG + Intronic
907773114 1:57485997-57486019 CCTTCCTGGAAGGGGTGAGCAGG - Intronic
908793121 1:67802780-67802802 CCAACCAGGGAGTGGTGGGCAGG - Intronic
909260327 1:73480856-73480878 GCTACCAGGGAGGCTAGGGCAGG - Intergenic
910077618 1:83299092-83299114 GCTACCAGGGTGGGGAGGGGAGG - Intergenic
910200068 1:84690310-84690332 CCCGCCAGGGAGGGGCGGGCGGG - Intronic
910333322 1:86100719-86100741 TCTGCCAGGGAGGGGAGAGAGGG + Intronic
910943972 1:92568262-92568284 GCTACCAGGGAGGGTAAGGCGGG + Intronic
912386329 1:109272950-109272972 CCTTCCCTGGAGAGCAGGGCTGG + Exonic
912459571 1:109821876-109821898 TCTGCTAGGGAGGGGAGGCCTGG - Intergenic
912665881 1:111579159-111579181 ACCTCCAAGGAGGGGAGGGAGGG - Intronic
913151333 1:116046972-116046994 GCTACCAGGGTGGGGAGGGAAGG - Intronic
913971821 1:143422405-143422427 ACTTCCAGGCAGGGGAAGGACGG - Intergenic
914066200 1:144248018-144248040 ACTTCCAGGCAGGGGAAGGACGG - Intergenic
914112953 1:144718336-144718358 ACTTCCAGGCAGGGGAAGGACGG + Intergenic
914171203 1:145225556-145225578 CCTTTCAGGGGGTGGGGGGCTGG - Intergenic
914440370 1:147700311-147700333 CCAGTCAGGGAGGGGAGGGATGG - Intergenic
914884665 1:151575039-151575061 GGTTGCAGGGAGGGGAGGGCAGG + Intronic
915528623 1:156490755-156490777 CTTGCCAGGGAGAAGAGGGCGGG - Intronic
915571380 1:156747054-156747076 CCTTCCTGGGGGGGAAGGGCTGG - Intronic
915597610 1:156904464-156904486 CCATACAGGGAGGAGAGGGCAGG + Intronic
915955174 1:160214856-160214878 CTTTAATGGGAGGGGAGGGCTGG + Exonic
916722504 1:167495015-167495037 GATCCCAAGGAGGGGAGGGCTGG + Intronic
916812312 1:168316407-168316429 TCATCCAGGGAAGGGAGGGCTGG - Intergenic
919204603 1:194405899-194405921 CTTTTCAGGGAGTGGAGGGTGGG + Intergenic
919564006 1:199160961-199160983 CCTTCCAAGGAAGGAAGGGAGGG + Intergenic
920057696 1:203204920-203204942 ACTGGCAGGGAGGGGAGGTCTGG + Intergenic
920176849 1:204107490-204107512 CATCCCAGGGAGGGGAGCGACGG - Intronic
920384618 1:205561689-205561711 CCTACAGGGGAGGGGAGGGGAGG + Intergenic
920388194 1:205582540-205582562 CTTTCCAGGGAGGTGGGTGCTGG - Intronic
920640885 1:207751453-207751475 CCCTCCAGGGAGGGGAGCAAAGG + Intergenic
920823717 1:209404793-209404815 GATTCCAGGGAGGCGTGGGCAGG - Intergenic
921177908 1:212609365-212609387 CCTTCCCGGGTGGGGGGGGGGGG + Intronic
921213902 1:212921462-212921484 CCTTCCAGGGAGGAGAGCCGTGG - Intergenic
922255802 1:223892009-223892031 CCTTCCACTGGGGGAAGGGCTGG + Intergenic
922353046 1:224750478-224750500 GCTTTCAGGGAGAGCAGGGCAGG - Intergenic
922779388 1:228239871-228239893 TGGTCCAGGGAGGGGAGGGCCGG + Intronic
922824814 1:228510425-228510447 CCTTTCAGGGAGGAGGGGGCTGG + Intergenic
923345326 1:233046053-233046075 CCTTTCAGGGAGAGGAAGACAGG + Intronic
923551040 1:234963592-234963614 CCTCCAGGGGAGGGGAAGGCTGG - Intergenic
923558951 1:235023768-235023790 CCTTCGGGGGAGGGGTGGGAGGG + Intergenic
923624491 1:235602950-235602972 TCTAAAAGGGAGGGGAGGGCCGG + Intronic
923715161 1:236418970-236418992 CATGACTGGGAGGGGAGGGCAGG - Intronic
923791615 1:237116147-237116169 CCCTGCAGGGAGGGGAGAGCAGG + Intronic
924508171 1:244705478-244705500 ACTGCCAGGGAGTGGAGGGTGGG - Intronic
924520235 1:244799981-244800003 TCTTCCCGGGAGAGGAGGGTGGG + Intergenic
924681178 1:246235716-246235738 TCCTCTAGGAAGGGGAGGGCTGG + Intronic
924707353 1:246511090-246511112 GCTTGCAGGGAGGGGTGGGGGGG + Intergenic
924779192 1:247131350-247131372 CGTTCCAGGGTTGGGACGGCAGG - Intronic
1063364328 10:5480662-5480684 CCCTCCAGGGAGGGGAAGGCAGG - Intergenic
1063564475 10:7161002-7161024 CGTGCCAGGGAGGAGATGGCTGG - Exonic
1063606982 10:7531301-7531323 CCTGCGAGAGTGGGGAGGGCAGG + Intergenic
1065024274 10:21526210-21526232 CCTGCGAGGGAGGGGAGGGACGG + Intergenic
1066145494 10:32553910-32553932 CCTACCAGGGTGGGTAGGGAAGG + Intronic
1066703867 10:38157030-38157052 CCTCCCAGGGAGTGGCGTGCAGG - Intergenic
1067080722 10:43210855-43210877 CCTTGCAGGGAGTGGGGGACAGG + Intronic
1067080751 10:43210983-43211005 CCTTGCAGGGAGTGGGGGACAGG + Intronic
1067087899 10:43252489-43252511 CCTGCCTGGGAAGGAAGGGCAGG + Intronic
1067479154 10:46584231-46584253 CCTTCCTGGGGGTGGTGGGCTGG - Intronic
1067615585 10:47757570-47757592 CCTTCCTGGGGGTGGTGGGCTGG + Intergenic
1067832864 10:49620473-49620495 CCTGCCGGGGAGGGCAGGGAAGG - Exonic
1067850365 10:49750485-49750507 TCTTCCAGGGAAGGGAGGGCAGG - Intronic
1069819411 10:71218118-71218140 GTTTGCAGGGAGGGGAGGGTGGG + Intronic
1069837127 10:71316590-71316612 GACTCCAGGGAGGGGAGGGATGG - Intergenic
1071410978 10:85394979-85395001 CTTTCTAGGGAGAGAAGGGCAGG - Intergenic
1072179961 10:92972361-92972383 CATTCAAGAGAGGGGAGTGCAGG + Intronic
1072518251 10:96208025-96208047 CCTTGCAGGGTGGAGAGGGATGG + Intronic
1072764110 10:98082159-98082181 CCTGCTAGAGAGGAGAGGGCAGG - Intergenic
1072801961 10:98398359-98398381 CCCTCCAGGGAAAGGAGGGTGGG - Intronic
1072948791 10:99834767-99834789 GCTTCCAGGGAGTGAAGGGTGGG - Intronic
1073321669 10:102619670-102619692 CCTGGCAGGGGGAGGAGGGCTGG - Intronic
1073435731 10:103514600-103514622 CCCTGCAGAGAGGGCAGGGCTGG + Intronic
1073493492 10:103871188-103871210 TCATCCAGGGAGGGGTGGGGAGG - Intergenic
1073665427 10:105527129-105527151 CCTACCAGAGAGTGGAGGGTTGG + Intergenic
1074081374 10:110170541-110170563 CCTTCCAGGGGTGGGGGGGGCGG - Intergenic
1075683921 10:124350889-124350911 CCTGCCGGGGAGGGTAGGGATGG - Intergenic
1076526326 10:131114692-131114714 CCTGCCCGGGAAGGGAAGGCCGG + Intronic
1076567745 10:131410492-131410514 CCTTCCACGCAGGGCAGGGAAGG + Intergenic
1076635095 10:131876431-131876453 ACTCCCTGGGAGGGGAGGGGCGG + Intergenic
1076686998 10:132202662-132202684 TCTTCGAGGGAGTGGAGTGCCGG + Exonic
1076805632 10:132857237-132857259 AGCCCCAGGGAGGGGAGGGCAGG - Intronic
1076883443 10:133250903-133250925 GCTTCCAGGGACCGGAGGGTCGG + Intergenic
1076883515 10:133251149-133251171 GCTTCCAGGGACCGGAGGGTCGG - Intergenic
1077053825 11:580367-580389 CCTTGCAGAGTGGGAAGGGCAGG + Intronic
1077108878 11:853435-853457 CCTACCTGGGAGGGGAAGGGAGG + Intronic
1077144921 11:1040495-1040517 CCTTGGAGGGAGGGTGGGGCAGG - Intergenic
1077530675 11:3093401-3093423 CCTGGCAGGGAGGGCAGGCCTGG - Intronic
1078263746 11:9737195-9737217 CCTTCCTGGGAGGGGCAGGCTGG - Intronic
1078317678 11:10306115-10306137 CTGTCCAGGGACGGGAGGGAAGG + Intronic
1079240769 11:18720983-18721005 CCTTCGAGGAAAGGGAGGGATGG - Intronic
1080086466 11:28288655-28288677 CCTACCAGAGTGGGGAGGGTGGG + Intronic
1080119441 11:28660182-28660204 CCTTCCAGGGTGGGAAGAGGTGG + Intergenic
1080458481 11:32435083-32435105 CCACCCAGGGAGGGGACGGCGGG + Exonic
1081188072 11:40069850-40069872 ACTACTAGAGAGGGGAGGGCAGG + Intergenic
1081967128 11:47176903-47176925 CAATCCACGGCGGGGAGGGCGGG + Exonic
1082723654 11:56709560-56709582 CCTGTCAGGGAGTGGTGGGCTGG - Intergenic
1082812097 11:57484593-57484615 CCTTCCAGGGCCAGGAGGGCAGG - Exonic
1083327431 11:61879888-61879910 GCCCCCTGGGAGGGGAGGGCAGG + Intronic
1083502831 11:63127126-63127148 CCTGTCAGGGAGTGGGGGGCTGG - Intronic
1083763239 11:64830045-64830067 TCTTCCAGGTGGGGGAGTGCCGG - Exonic
1084153519 11:67302097-67302119 CCTTCCAGGCAGGGCAGGGGAGG - Exonic
1084363468 11:68683917-68683939 CCGTCGATGGCGGGGAGGGCAGG - Intronic
1084440450 11:69169838-69169860 GATTCCAGGGAAGGGAGGACAGG - Intergenic
1084691922 11:70732565-70732587 GCTTCTAGGGAGGGGAGGGTCGG - Intronic
1084740688 11:71137630-71137652 CCTTCCAGGGAGTGGGTGGCGGG - Intronic
1084778953 11:71396355-71396377 AGATCCAGGGAGGGGAGGGGAGG + Intergenic
1085025486 11:73234135-73234157 CCCTGCAGGGAAGGGAGGGGTGG - Exonic
1085205110 11:74726990-74727012 CCTGCCAGGGAGGAGTGGACAGG - Intronic
1085293672 11:75418149-75418171 CATTCCAGGGATGGGCAGGCTGG + Intronic
1085305445 11:75483068-75483090 CCTGGCAGGAAGGGGAGGGGAGG - Intronic
1085693651 11:78686027-78686049 CCTGCCTTGGAGAGGAGGGCAGG - Intronic
1085817850 11:79760004-79760026 CCTTCCAGGGAAACCAGGGCAGG + Intergenic
1086657884 11:89382133-89382155 CTTTCCTGAGGGGGGAGGGCAGG + Intronic
1086760538 11:90625052-90625074 CCTACCAGAGAGTGGAGGGTAGG + Intergenic
1089047537 11:115516184-115516206 CCTCCCAGGCTGGGGAGGGAAGG - Intergenic
1089189633 11:116644499-116644521 CCATCCGGGGAGGGGCGGGTGGG + Intergenic
1089292296 11:117444545-117444567 CCGTCCAGGGAGGAGGGGGCGGG + Intronic
1089573098 11:119422953-119422975 CTTTCCAGGCAGGGGCGGGAGGG - Intronic
1089702109 11:120251556-120251578 TCTTCCAGAGAGGTGAGGGATGG - Intronic
1090184169 11:124725445-124725467 CCTTCCTGGCAGGGCAGGCCTGG - Intergenic
1090235950 11:125147207-125147229 CCTGCCTGGCAGGGGAGGGAGGG - Intergenic
1090440998 11:126725683-126725705 CCTTGCAGCGAGGGCAGAGCGGG - Intronic
1090464965 11:126925568-126925590 ACTGCCAAGGAGGAGAGGGCAGG - Intronic
1090608844 11:128452068-128452090 CCGTCCAGGGCTGGGAAGGCGGG + Intergenic
1091036268 11:132236927-132236949 CCTTCAAGAGAGGGGAGACCAGG + Intronic
1091600187 12:1913276-1913298 TTGTCCAGGGAGGAGAGGGCTGG - Intronic
1092060625 12:5547620-5547642 CTCTCCAGGGTGGGGTGGGCAGG + Intronic
1092236977 12:6816413-6816435 CAGGCCAGGGAGGGGTGGGCAGG + Intronic
1092532341 12:9354956-9354978 CCTGTCAGGGAGTGGGGGGCTGG - Intergenic
1092659586 12:10723365-10723387 CCGGCCCGGGAGGGAAGGGCGGG + Intergenic
1093329236 12:17814689-17814711 CCTGTCAGGGAGTGGAGGGCCGG - Intergenic
1093816069 12:23548996-23549018 TCTTTCAGAGAGGGGATGGCTGG - Intronic
1094176412 12:27546308-27546330 CCTCCCAGTGAGGGCTGGGCTGG - Intronic
1094480173 12:30875170-30875192 CCAGGCAGGGAGGGGAGGGCTGG + Intergenic
1094498614 12:31004743-31004765 CCTCCCATGCAGTGGAGGGCAGG + Intergenic
1096182504 12:49558489-49558511 CCTTTGAGGGAGGATAGGGCTGG - Intronic
1096537864 12:52286965-52286987 ACTTCCGGTGTGGGGAGGGCTGG - Intronic
1096678845 12:53241745-53241767 CCGGCCTGGAAGGGGAGGGCTGG + Intergenic
1096758604 12:53820687-53820709 CCTGCCAGATAAGGGAGGGCAGG - Intergenic
1097520355 12:60661311-60661333 CCTTTCAGAGAGGGGAGGGAAGG - Intergenic
1097761758 12:63474279-63474301 GATTCCAGAGGGGGGAGGGCTGG - Intergenic
1098416111 12:70237163-70237185 ACCTCCAGGGAGGGGAGAGGGGG + Intergenic
1099833932 12:87882581-87882603 CCTACCAGAGAGTGGAGGGTGGG + Intergenic
1100267691 12:92993350-92993372 CTTTCCTGGCAGGGGAGGGTTGG - Intergenic
1100542829 12:95574077-95574099 GCTGCCGGGGAGGGGAGGGCTGG + Intergenic
1101263918 12:103064615-103064637 CCTTGAAGGAAGGGGAGGCCGGG + Intergenic
1101420303 12:104545251-104545273 CGTTTGAGGGTGGGGAGGGCAGG + Intronic
1101446619 12:104741354-104741376 GCTTCCAGTGAGAGGAAGGCTGG - Intronic
1101613128 12:106310147-106310169 CCTTCCAGGGAAGGGCCGTCAGG - Intronic
1101615296 12:106330420-106330442 CCATCCTGGCAGGGCAGGGCGGG + Intronic
1101672109 12:106885029-106885051 CTTTCTAGGGATGGGAGGACTGG + Intronic
1101881673 12:108630048-108630070 CCTTCCAGGAAGAGGAGAGGTGG - Intronic
1102077687 12:110073163-110073185 CCCGCCAGGGAGAGCAGGGCAGG - Intronic
1102101441 12:110281529-110281551 CCTTCTGGCGAGGGGAGGGAGGG + Intronic
1102524248 12:113500017-113500039 CCTTGCATGGAGGCCAGGGCTGG + Intergenic
1102635720 12:114321843-114321865 CATTCCAGGGTGGGGAGGACAGG - Intergenic
1103183826 12:118938628-118938650 CGTTCCAGGGAAGGGAGGCAAGG - Intergenic
1103500679 12:121399752-121399774 GTTTCCGGGGAGGGGAGCGCGGG - Intronic
1103692954 12:122790705-122790727 ACCTCCAGGAAGGGGAGGGAGGG - Intronic
1103960652 12:124607225-124607247 CCGTCCAGGCAAGGGAGGGCAGG - Intergenic
1104022601 12:125003346-125003368 CCTCCCATGGAGGCGATGGCTGG + Intronic
1104190747 12:126479942-126479964 GCTTCCAGGGAGGGGCAGGGAGG - Intergenic
1104338010 12:127918783-127918805 AATTCTGGGGAGGGGAGGGCAGG - Intergenic
1104674920 12:130705840-130705862 CCTTGCAGGGATGGGTAGGCTGG - Intronic
1104735487 12:131133587-131133609 CCTTCCGGGGAGGTGCAGGCAGG + Intronic
1104759096 12:131286469-131286491 GCTTCCTGGGAGAGGCGGGCAGG + Intergenic
1104821514 12:131680027-131680049 GCTTCCTGGGAGAGGCGGGCAGG - Intergenic
1105431358 13:20340324-20340346 CCTCCCAGGGGCTGGAGGGCAGG - Intergenic
1105585415 13:21738646-21738668 CCTTCCATGCAGGGCAGGGCTGG + Intergenic
1105704381 13:22960343-22960365 CTTTGCAGGCAGGGAAGGGCTGG + Intergenic
1105857332 13:24385395-24385417 CTTTGCAGGCAGGGAAGGGCTGG + Intergenic
1106181259 13:27371663-27371685 CCTTCTTGGGTGGGGAGGACTGG - Intergenic
1106504952 13:30363067-30363089 TTTGCCAGGGAGAGGAGGGCGGG - Intergenic
1106552661 13:30785385-30785407 CCTTCCTGGGTCGGGAGGACTGG - Intergenic
1106811827 13:33365499-33365521 CCTGCCAGGGAAGGTAAGGCGGG + Intergenic
1107769465 13:43774760-43774782 CCTTGCAGTGAGAGCAGGGCTGG - Intronic
1107835245 13:44407613-44407635 CCTTGCAGGGAGGTGATGACAGG + Intergenic
1108478563 13:50843995-50844017 CCTTCGAAGGAGGTGGGGGCGGG - Intergenic
1108482713 13:50890980-50891002 CATTCCAGGCAAGGGAAGGCTGG - Intergenic
1109560764 13:64047220-64047242 GCTACCAGGGTGGGGAGGGGAGG - Intergenic
1110842797 13:80161983-80162005 CCTTCCAGGGAAGGCAGGGCAGG + Intergenic
1111677894 13:91409859-91409881 ACTTCTAGAGAGGGGAGGGAGGG - Intronic
1112035350 13:95492253-95492275 CCTACCAGGGCGGGTAGGGAAGG + Intronic
1112065039 13:95783932-95783954 CCATCCAGGAAGAGGAGGGAGGG + Intronic
1112344183 13:98576803-98576825 ACTTCCTGGGACGGGACGGCCGG + Intronic
1113476954 13:110590754-110590776 CATTCCAAGGAGGGCAGGGCGGG - Intergenic
1113768199 13:112893983-112894005 CCTTCCAGAGGGGAGAGGGCTGG - Intergenic
1113924123 13:113930827-113930849 CCTCCCAGGGAGCTGAGGCCCGG + Intergenic
1114252284 14:20971574-20971596 CCTTCCAGCCAGCAGAGGGCAGG - Intergenic
1114265231 14:21069750-21069772 CCTAGCAGAGAGCGGAGGGCCGG - Intronic
1114665391 14:24374474-24374496 CCTGCTGGGGAGGGGAGGGCAGG + Intronic
1114831568 14:26148774-26148796 CTGTCCAGGGATGGGAGGGAGGG + Intergenic
1115475878 14:33812303-33812325 CCCACCAGGGAGGGGATGGGCGG - Intergenic
1115936425 14:38558316-38558338 CCTGTCAGGGAGTGGGGGGCTGG + Intergenic
1115947368 14:38677147-38677169 CCTGACAGGGGGTGGAGGGCTGG + Intergenic
1117783853 14:59262012-59262034 CCTTCAAGAGATGGAAGGGCAGG - Intronic
1118550532 14:66944885-66944907 CCTGGCAGGGAGAGGAGTGCAGG + Intronic
1118600637 14:67469605-67469627 CCTTCCAGGAAGAGGATGGAGGG - Intronic
1118741454 14:68742330-68742352 GTTGACAGGGAGGGGAGGGCAGG - Intergenic
1119330172 14:73787407-73787429 CCTCCCAGGGCGGGGGGTGCAGG - Intronic
1119562471 14:75602229-75602251 CACTCCAGGGAGGGGAGGGGAGG - Intronic
1119784569 14:77302801-77302823 CATCCCCGGGAGGGGAGGGTTGG - Intronic
1120337662 14:83178916-83178938 ACTTCCAGAGAGTGAAGGGCAGG + Intergenic
1120568286 14:86086234-86086256 CCTGTCAGGGAGTGGGGGGCTGG - Intergenic
1121315294 14:92957824-92957846 CCTTCCAGGGAAGCCAGGGCAGG - Intronic
1121448359 14:93992605-93992627 TATTCCAGGGAGGTGAGGGGTGG + Intergenic
1121492249 14:94369000-94369022 CTTTGCGGGGAGGAGAGGGCTGG + Intergenic
1122125620 14:99576997-99577019 CTGATCAGGGAGGGGAGGGCAGG - Intronic
1122299193 14:100722491-100722513 CCACCCAAGGAGGGGAGGGCAGG + Intergenic
1122307110 14:100773231-100773253 CTTGCCAGGGATGGGAGGGTGGG - Intergenic
1122750398 14:103928601-103928623 CCTTCCCGGCAGGGGCGGCCAGG + Exonic
1122783241 14:104152563-104152585 CCCTGAAGGGAGGGGACGGCGGG + Intronic
1122783522 14:104153644-104153666 GCATCCTGGGAGGGGTGGGCGGG + Intronic
1122881164 14:104691007-104691029 CAGTCCAGGGATGGGAGGGCAGG - Intronic
1123036509 14:105474066-105474088 CCTCCCAGGCAGGGAAGGGGCGG - Intronic
1124202027 15:27686867-27686889 TCTTCCAGGGAGAGCGGGGCTGG - Intergenic
1124383944 15:29190574-29190596 CCTTCCAGGTATGGGAGGGGAGG + Intronic
1124811363 15:32942163-32942185 CCTTCCAGAGTGGGAAAGGCAGG + Intronic
1125200339 15:37096806-37096828 CCTTCTTGGGAGGTCAGGGCTGG - Intronic
1125421936 15:39512697-39512719 CCCTCCAGGGAGAGGAGAGTTGG - Intergenic
1125721401 15:41846828-41846850 CCTTCCAGGTTGGGAAGGGTGGG + Exonic
1126668601 15:51095422-51095444 TCTGCCAGCGAGGGCAGGGCAGG + Intronic
1126786221 15:52179698-52179720 ACTTCCCGGGCGGGGACGGCGGG - Intronic
1127359107 15:58229394-58229416 CCTACCAGGGAGGGGGGTGGGGG + Intronic
1127421519 15:58811004-58811026 GCTTCCAGGGAGGGAAGGGTAGG - Intronic
1128813811 15:70591012-70591034 CCTTTCAGAGAGTGGAGGGCGGG + Intergenic
1128945515 15:71817462-71817484 CCTCCCAGGAAAGGGAGGGGAGG - Intronic
1128999376 15:72319922-72319944 CGGTCCAGGGAGGGGACGGCGGG - Exonic
1129060253 15:72855326-72855348 CCTTCATGGGGAGGGAGGGCAGG + Intergenic
1129233522 15:74209719-74209741 CCCTCTAGGAAGGGGAGGGAGGG - Intronic
1129272539 15:74427017-74427039 CAATCCAGGGAGGGGAGAACAGG - Intronic
1129297020 15:74605092-74605114 CCAGCCAGGGAGGGCAGGCCAGG - Intronic
1129328057 15:74812481-74812503 CCTAACTGGGAGGGGAGGCCAGG + Intergenic
1129379125 15:75154477-75154499 TCTGCCGGGGAGGGGAGGGGTGG - Intergenic
1129657962 15:77537185-77537207 CCTTCCAGAAAGCTGAGGGCAGG - Intergenic
1130139858 15:81216082-81216104 CCTTCCAGCCAGGAGAGAGCAGG - Intronic
1130274351 15:82468802-82468824 CCTTCCAGCTAAGGGAGGGGTGG - Intergenic
1130322611 15:82853511-82853533 CCCTCCAGGTCGGGCAGGGCAGG + Intronic
1130466697 15:84196176-84196198 CCTTCCAGCTAAGGGAGGGGTGG - Intergenic
1130497567 15:84477360-84477382 CCTTCCAGCTAAGGGAGGGGTGG + Intergenic
1130588993 15:85200769-85200791 CCTTCCAGCTAAGGGAGGGGTGG - Intergenic
1131098621 15:89671411-89671433 CCTCTCAGGGAGGAGAGGGCAGG - Intronic
1131396433 15:92090487-92090509 CCTCCCAGGGATGAGATGGCTGG - Intronic
1131464696 15:92645829-92645851 CCACCCAGGTAGGGGAGGGTGGG + Intronic
1131671769 15:94627358-94627380 TCTTCAAGGGTGGGGTGGGCTGG + Intergenic
1131714812 15:95096853-95096875 CCGTCCGCGGAGAGGAGGGCTGG - Intergenic
1132163705 15:99565528-99565550 CCTCCCAGGGCGGGGCGGCCCGG - Intronic
1132602805 16:781528-781550 CCTCCCTGAGAGGGGTGGGCCGG - Intronic
1132655023 16:1038208-1038230 CCTTCCAGGGAGCAGAGGGCTGG - Intergenic
1132656208 16:1043006-1043028 CTTTCCAGGGAGGCAAGGACCGG - Intergenic
1132688752 16:1172979-1173001 CCTGGGAGGGAGGGGAGGGGTGG + Intronic
1132693128 16:1190549-1190571 CTCTCCAGGGCAGGGAGGGCTGG + Intronic
1133023283 16:2976302-2976324 CCTGCCAGCCTGGGGAGGGCTGG + Intronic
1134656355 16:15950492-15950514 TGTTGCAGGGAAGGGAGGGCAGG - Intronic
1135461726 16:22649847-22649869 CCTTTCAGAGAGTGGAGGGTGGG - Intergenic
1135524744 16:23205787-23205809 TCTGCCAGGGAGGGGACAGCAGG - Intronic
1136045281 16:27610258-27610280 CCAGCCTGGGAGGGGAGAGCAGG + Intronic
1136114578 16:28086735-28086757 CCTTCCAAACAGGGGAGGCCGGG + Intergenic
1136413719 16:30091403-30091425 CCTCCCGGGGTGGGGAGGGAGGG - Intronic
1136569916 16:31090604-31090626 CCTTCCCAGGAGAGGAGGCCTGG + Intronic
1136630582 16:31487412-31487434 CCTACCAGGGAGGGGCGCGGAGG + Intronic
1137389084 16:48066624-48066646 GCTTCCAGGAAGAGGAGGCCTGG + Intergenic
1138164689 16:54790102-54790124 CCTGTCAGGGAGTGGGGGGCTGG - Intergenic
1139325067 16:66146131-66146153 CCTCCCAGGATGGGGAAGGCAGG - Intergenic
1139839692 16:69868357-69868379 CCTTTCTGGGAAGGGAGGGCAGG + Intronic
1141576379 16:84966585-84966607 CCTCCCAGGGAAGGAGGGGCTGG + Intergenic
1141605636 16:85151907-85151929 CCAGCCGGGGAGAGGAGGGCGGG - Intergenic
1141627001 16:85266654-85266676 CTCTCCAGGGAGGGAAGGGGTGG + Intergenic
1141688561 16:85583860-85583882 GCTCCCAGGGAGGGGAGTGAGGG + Intergenic
1142137502 16:88458401-88458423 ACCTCCAGGGAGGGGCTGGCGGG - Intronic
1142150973 16:88512448-88512470 CCTTTCAGAGAGGGAAGGGGTGG - Intronic
1142211588 16:88811150-88811172 CCACCCAGGGAAGGGAGGCCTGG - Intronic
1142273927 16:89105792-89105814 TCTCCCAGGGAGCTGAGGGCAGG + Intronic
1142426926 16:90006442-90006464 TCGTCCAGGAAGGGGAGCGCAGG + Exonic
1142484431 17:237418-237440 CCTTCCCCAGAGGGGAGTGCAGG - Intronic
1142574950 17:900552-900574 CCTCCCAGGGTGGGAAGGGAGGG + Intronic
1142696862 17:1638714-1638736 CCTTGTGGGGTGGGGAGGGCTGG - Intronic
1142869395 17:2810202-2810224 CCTCCCAGGGAGGGAAGGCCGGG - Intronic
1142874549 17:2843650-2843672 CCTTGCAGGGTGGGGCGGGGTGG + Intronic
1143329774 17:6124984-6125006 CCTTCTAGGGAGGGTAGGTGTGG + Intergenic
1143388087 17:6543845-6543867 CCTCCAAGGAAGGGGTGGGCAGG + Intronic
1143513347 17:7407607-7407629 CCTCCCAGGGAGGTGGGAGCTGG + Intronic
1143613994 17:8038999-8039021 CGTTTCAGGGCGGGGAGGGGCGG - Exonic
1143649752 17:8256234-8256256 CGATGCAGGGAGGGGAAGGCAGG - Intronic
1143844839 17:9766252-9766274 ACTTCCAGGAAGGGGTGGGGAGG + Intergenic
1144581394 17:16461445-16461467 CCTGGCGGGAAGGGGAGGGCCGG - Intronic
1144669088 17:17121810-17121832 CCTTTCAGAGTGGGGAGGGTGGG - Intronic
1145238647 17:21226580-21226602 CCTAGCAGGGAGGCGAGGGCTGG - Intergenic
1145268762 17:21393122-21393144 CCTTTCCAGTAGGGGAGGGCAGG - Intronic
1145282621 17:21478669-21478691 CCTTCAAGGGAAAGGTGGGCTGG - Intergenic
1145791823 17:27632249-27632271 CCTTCCTGGGTGGGGAGGCAGGG + Intronic
1145924039 17:28632844-28632866 CCCTCTGGGGAGGGGAGGGGAGG - Intronic
1145966015 17:28917834-28917856 CCTTCCTGGGAAGGGAGTGTGGG - Intronic
1146005135 17:29156052-29156074 CCTACCAGGGAGGAGAGAGTGGG - Intronic
1146123717 17:30216245-30216267 TGTTCCAGGGAGGGGAGGGGAGG + Intronic
1146308109 17:31746156-31746178 CCTTCCTTGGAGGCCAGGGCTGG - Intergenic
1146873231 17:36388753-36388775 CCACCCTGGGCGGGGAGGGCTGG - Intronic
1146885096 17:36465098-36465120 CCTTCCAGCTGCGGGAGGGCAGG + Intergenic
1147032812 17:37654352-37654374 AATTCCAGGGAGGCTAGGGCTGG + Intergenic
1147314422 17:39612740-39612762 CGTTGCCGGGAGGTGAGGGCTGG + Intergenic
1147948917 17:44096146-44096168 CCAGCCAGGAAGGGGAAGGCAGG + Intronic
1147972594 17:44227640-44227662 CCTTTCTGGGAGAGGAGGGGTGG - Intergenic
1148181983 17:45612743-45612765 CATGGCAGGGAGGGGATGGCGGG + Intergenic
1148266876 17:46232957-46232979 CATGGCAGGGAGGGGATGGCGGG - Intergenic
1148540439 17:48476073-48476095 CCTTCCAGACAGGGGAGTTCAGG + Intergenic
1148865754 17:50627725-50627747 CCTTCACGGCTGGGGAGGGCAGG - Intergenic
1148895268 17:50835827-50835849 CCTGCTGGGGTGGGGAGGGCAGG + Exonic
1149571986 17:57678577-57678599 TCTTCCAGGGGAGGGAGGGAGGG - Intronic
1149626207 17:58082842-58082864 CCTTCCCGGAAGGTGAGGGGAGG + Intergenic
1149649404 17:58267599-58267621 TCAGCCAGGGAGGGAAGGGCAGG + Intronic
1149894532 17:60419356-60419378 CCTACCAGAGAGTGGAGGGTGGG + Intronic
1150286231 17:63955757-63955779 CCTTTCAGGGACAGGAGGCCTGG + Intronic
1150479624 17:65499312-65499334 CCCTCCAGGGGAGAGAGGGCTGG - Intergenic
1150682536 17:67294982-67295004 CCATCCATGGCGGGGAGGGGAGG - Intergenic
1150794759 17:68228515-68228537 CCTCCCAAGGAGGGGAGGCAAGG - Intergenic
1151167758 17:72219641-72219663 AGTTCGAGGGAGGGGACGGCAGG + Intergenic
1151539571 17:74758224-74758246 CAGTCCAGGGAGCGGATGGCGGG - Intronic
1151817774 17:76479628-76479650 CCTTCCAGAGAGGGGACGCAGGG + Intronic
1152009240 17:77700725-77700747 CCTACCAGGCAGGGGAGGTCAGG + Intergenic
1152095278 17:78268716-78268738 CCTTGCAGGGAGGGCTGTGCAGG + Intergenic
1152141989 17:78541901-78541923 CGTGGCAGGGAGGGGAGGGATGG + Intronic
1152234140 17:79129856-79129878 CATGCCAGGGAGGGGAGGAATGG + Intronic
1152252535 17:79219492-79219514 CCTCACAGTGAGGGGAGGACCGG - Intronic
1152287738 17:79422400-79422422 CCGGCCTGGGAGTGGAGGGCCGG - Intronic
1152352848 17:79793008-79793030 CCTTTAAGGGCGGGGAGGGCAGG + Exonic
1152799050 17:82322657-82322679 GCTTGCAGGAAGGGCAGGGCGGG + Intronic
1153810092 18:8744854-8744876 ACTTCCGGGGGGTGGAGGGCAGG - Intronic
1154319132 18:13330809-13330831 CCCTCCAGGGAGGGGAGAACAGG + Intronic
1154399299 18:14020103-14020125 GCTTCCATGGTGGGGAGGGGGGG + Intergenic
1155085117 18:22451157-22451179 CCTTTCAGAGGGGGGAGGGTGGG + Intergenic
1155822378 18:30394489-30394511 GCTGCCAGGGAAGTGAGGGCAGG + Intergenic
1157337020 18:46748064-46748086 CCTGTCAGGGGGTGGAGGGCTGG + Intronic
1157533775 18:48443505-48443527 CCCTCCAGGGAGGCCAGGGGTGG + Intergenic
1157807013 18:50665671-50665693 CCAGCCAGGGAGGGTAGGACAGG - Intronic
1158592578 18:58790107-58790129 CCTTCTTGGGAGGGGAGAGCTGG + Intergenic
1160021362 18:75184284-75184306 GCTTACAGGGCGGGGAGTGCAGG - Intergenic
1160231602 18:77053256-77053278 GCTTCAGGGGAGGGGTGGGCAGG + Intronic
1160409550 18:78666659-78666681 CCTTCGAGGGTGGGGTGTGCAGG + Intergenic
1160429771 18:78803472-78803494 CTTTCCAGGGAGGTGACTGCTGG - Intergenic
1160535588 18:79589802-79589824 ACATGCAGGGTGGGGAGGGCAGG - Intergenic
1160748785 19:723948-723970 CAGACCAGGGAGGGGAGGGGAGG + Intronic
1160875234 19:1293714-1293736 CCAACCAGGTAGGGAAGGGCTGG + Intronic
1161230472 19:3172505-3172527 CACCCCAGGGAGGGCAGGGCTGG - Intronic
1161316516 19:3619942-3619964 CCTGCCCAGCAGGGGAGGGCAGG + Intronic
1161743849 19:6042753-6042775 TGTTTCAGAGAGGGGAGGGCAGG - Intronic
1161751728 19:6102645-6102667 CCTTCCAGGAAGGGGGCAGCAGG - Intronic
1162128614 19:8512236-8512258 CCATCCAGGGAGTTGAGGGCGGG + Intronic
1162330745 19:10027744-10027766 GATCCCAGGGAGGGGAAGGCGGG + Intergenic
1162637477 19:11981323-11981345 CCTTCAAGGGAGGATAAGGCAGG - Intergenic
1162745012 19:12793169-12793191 CGGTGCAGAGAGGGGAGGGCAGG - Exonic
1162793668 19:13075809-13075831 TCTTCCAGGGAGGGCAGAGCAGG + Intronic
1162816551 19:13198802-13198824 CATTCCAGGCAGGGCAGGGGCGG + Intergenic
1163255419 19:16153197-16153219 CCCTGCAGGCAGGTGAGGGCGGG + Exonic
1163393647 19:17046075-17046097 CCATCCAGGGCAGGGAGGGAGGG - Intergenic
1163727243 19:18929634-18929656 CCTGCCAGGAAAGGGTGGGCAGG + Exonic
1163847094 19:19643869-19643891 CCATTCAGGGAGGAGGGGGCTGG - Intergenic
1164527586 19:29023156-29023178 CTTTTCAGGGAGGAAAGGGCAGG + Intergenic
1164601369 19:29565958-29565980 CGTTCCAGGGGATGGAGGGCTGG + Intergenic
1164684677 19:30158949-30158971 CCACCCAGGGAGGGGAGAGGAGG - Intergenic
1164748175 19:30631164-30631186 ATGGCCAGGGAGGGGAGGGCCGG - Intronic
1165109501 19:33493628-33493650 CCTTGGAGGGTGGGTAGGGCTGG - Intronic
1165309746 19:35022932-35022954 GGGTGCAGGGAGGGGAGGGCAGG - Intronic
1165316096 19:35056216-35056238 CCACCGAGGGAGGGGAGTGCCGG - Intronic
1165862916 19:38918526-38918548 CCTTCCTGGGGGAGGAGGCCAGG + Exonic
1166268613 19:41700272-41700294 CCCTCCAGGGAGGGGGCTGCAGG + Intronic
1166268626 19:41700308-41700330 CCCTCCAGGGAGGGGGCTGCAGG + Intronic
1166268639 19:41700344-41700366 CCCTCCAGGGAGGGGGCTGCAGG + Intronic
1166268652 19:41700380-41700402 CCCTCCAGGGAGGGGGCTGCAGG + Intronic
1166303763 19:41926530-41926552 CTCCCCAGGGAGGGGAGGACAGG - Intronic
1166423243 19:42654279-42654301 CCTTCCTGGGAGAGGACGGGAGG + Intronic
1166683624 19:44782134-44782156 GGTTTGAGGGAGGGGAGGGCTGG + Intronic
1167696230 19:51017039-51017061 GCCTCCAGGGAGGAGCGGGCAGG - Intronic
1168686762 19:58353550-58353572 CCTTCCCGGAAGGCGGGGGCAGG + Intergenic
925663828 2:6231828-6231850 CCATCCATGGAGGAGAGGCCAGG + Intergenic
925785946 2:7431440-7431462 CCTTCCGGGCAGGTGAGGCCAGG + Intergenic
925788515 2:7456920-7456942 CCTGCCTGGTAGGGAAGGGCAGG + Intergenic
925952429 2:8927662-8927684 TGTTCCAGGAAGGGCAGGGCAGG + Intronic
925959637 2:9003399-9003421 CCTTCCAGGGAGCGGCGGGTAGG + Intronic
927455702 2:23247501-23247523 GCTTCCAGGGAGGGCTGGGCAGG + Intergenic
927468092 2:23351786-23351808 CCTCCCCGGGAGAGGAGGGCAGG - Intergenic
927649811 2:24905583-24905605 CCAACCAGGGAGGCAAGGGCAGG + Intronic
927811008 2:26180103-26180125 GGTCCCAGGGCGGGGAGGGCAGG + Intronic
927850093 2:26493457-26493479 CCCTCCAGGAAAGGGATGGCAGG + Intronic
927986922 2:27418064-27418086 CCTTCCAGTGGGGGGTGGGGGGG + Intergenic
928177322 2:29043590-29043612 CCTGTCAGGTAGGTGAGGGCAGG - Intronic
928733749 2:34261791-34261813 CCTACCAGGGTGGGTAGGGAAGG - Intergenic
929601248 2:43206158-43206180 GTTTCCAGGGACAGGAGGGCTGG + Intergenic
929759833 2:44797943-44797965 CTTTCCCGGGAGGGAAGGACAGG - Intergenic
930016712 2:46975653-46975675 CCTCCCAGAAGGGGGAGGGCTGG - Intronic
930362008 2:50392870-50392892 GCTACCAGGGAGGGTAAGGCAGG + Intronic
930716212 2:54596228-54596250 CCTTGCTGGGTGGGGAGTGCAGG + Intronic
931643434 2:64400996-64401018 CCTGCTAGGAAGGGGAGGTCTGG + Intergenic
931668647 2:64627536-64627558 CCTGCCTGAGAGGGGAGGGAGGG + Intergenic
932594553 2:73086065-73086087 CCTTGCAGGGAGGGGAAGGCTGG - Intronic
932753929 2:74391867-74391889 CCCACGAGGGCGGGGAGGGCGGG - Intronic
933724503 2:85418909-85418931 CCTCGTAGGGAGGGCAGGGCGGG - Intronic
934176511 2:89583337-89583359 ACTTCCAGGCAGGGGAAGGACGG - Intergenic
934286821 2:91657698-91657720 ACTTCCAGGCAGGGGAAGGACGG - Intergenic
935179869 2:100679722-100679744 CTTTGCAGGTAGGGGTGGGCAGG - Intergenic
935281171 2:101519041-101519063 GCGCCCAGGGAGGGGAGGGAGGG - Intergenic
935314461 2:101817677-101817699 CTTTCCATGGAGAAGAGGGCGGG + Intronic
935346441 2:102112501-102112523 CAGTCCAGGGAAAGGAGGGCAGG + Intronic
935349540 2:102141888-102141910 CCTTGCAGGGAGAGGAGGGGAGG - Intronic
936042728 2:109161927-109161949 CCTCCTGGGGAGGGGAGGGTTGG + Intronic
936147762 2:109992637-109992659 CCTTCCAGGGAGGGAAGGAGAGG + Intergenic
936196929 2:110378810-110378832 CCTTCCAGGGAGGGAAGGAGAGG - Intergenic
936318230 2:111443913-111443935 GCTCCCAAGGAGGGGAGAGCAGG + Intergenic
936694224 2:114927978-114928000 CCTTCCCTGGTGGGGAGGGTTGG - Intronic
937451259 2:122003491-122003513 GCTGCCAGGGTGTGGAGGGCAGG + Intergenic
937957159 2:127427901-127427923 ACTGCCAGGGAGGACAGGGCCGG - Intronic
938291673 2:130153935-130153957 CCTGCAAGGGAGGCGCGGGCAGG + Exonic
938464878 2:131519028-131519050 CCTGCAAGGGAGGCGTGGGCAGG - Intergenic
938809740 2:134842345-134842367 CTTTCCAGGAAAGGGAGGGAGGG + Intronic
940657402 2:156505607-156505629 CATTACAGGCAGGGAAGGGCTGG - Intronic
940703325 2:157073595-157073617 CCTGTCAGGGAGTGGGGGGCTGG + Intergenic
942452710 2:176118181-176118203 CCTTGCAGGGAGGGCAATGCGGG - Intronic
942630516 2:177946480-177946502 CCTTCCCGGGACGGGGCGGCTGG - Intronic
943938614 2:193959946-193959968 GCTTGCAGGGAGCGGAGGTCGGG + Intergenic
944195422 2:197048337-197048359 CCTGTCAGGGAGTGGGGGGCAGG - Intronic
946015857 2:216603261-216603283 GCTTCCAGGGAGAGAAAGGCTGG + Intergenic
946200618 2:218068866-218068888 CGCTCCAGAGTGGGGAGGGCAGG - Intronic
946301703 2:218828061-218828083 CCCTGCAGGGAGGGGCGGGGAGG + Exonic
946351856 2:219160569-219160591 CCTCCGGGGGAGGGGTGGGCGGG - Intronic
947475948 2:230447840-230447862 ACCTCCAGGGAGGGGAGAGGAGG - Intronic
947516659 2:230811327-230811349 TCTTACTGGGAGTGGAGGGCAGG - Intronic
947745771 2:232506594-232506616 CCCTCCAGGGAGGGCCAGGCTGG + Intergenic
947753241 2:232543563-232543585 CCTGTCAGGGTGGGGTGGGCAGG - Exonic
947963284 2:234258015-234258037 CCTGCCAAGGATGGGAAGGCCGG + Intergenic
948273117 2:236688864-236688886 CCTCCCATGGGAGGGAGGGCAGG - Intergenic
948473738 2:238203455-238203477 CCGGCCAGGGAAGGGAGAGCAGG - Intronic
948623222 2:239249989-239250011 CCTTCCAGAGGCGGGAGGCCCGG - Intronic
948856857 2:240734272-240734294 CCTTGCAGGGAGAGGGGAGCGGG + Intronic
1168893858 20:1310640-1310662 CCTTGGAGGGAGGGGAAGGGAGG + Intronic
1169019773 20:2320964-2320986 CCTGCCAGGGAGGTGAAGTCAGG + Intronic
1169878648 20:10323959-10323981 CCCTCCAGTGTGGAGAGGGCAGG + Intergenic
1169908913 20:10631160-10631182 CCTTGCATGGAGGGCAAGGCAGG - Intronic
1170608900 20:17895495-17895517 CCTTCCAGGTGGGGGTGGGCAGG - Intergenic
1170859231 20:20087285-20087307 ACTTCTAGGGAGGGGAGAGAAGG - Intronic
1170859530 20:20089864-20089886 CTTGCCATGGAGGGGAAGGCTGG - Intronic
1171174373 20:23040432-23040454 CTTTTCAGGGAGGGGTTGGCAGG + Intergenic
1172028048 20:31962877-31962899 GCTGGCAGGGAGGGGTGGGCAGG - Intergenic
1172109901 20:32538572-32538594 CATTCCAGTGAGAGGAGGGGTGG + Intronic
1172146454 20:32761830-32761852 TCTTGAAGGGAGGGGAGGGCAGG - Intergenic
1172420026 20:34808227-34808249 AGTTCCAGGGAAGGTAGGGCAGG - Intronic
1172446185 20:34994642-34994664 GATTGCAGGGAGGGGAGAGCTGG - Intronic
1172840308 20:37898962-37898984 CCTCTCAAGGAGGGGAGGGAGGG + Intergenic
1173648935 20:44651061-44651083 CCTGCCAGAAAGGGGAGGGAGGG - Intronic
1174044595 20:47724510-47724532 CCTTCTAGGGAGCGGATGGCTGG - Intronic
1174102142 20:48135917-48135939 CTTTCTAGGGATGGGAGAGCTGG - Intergenic
1174266431 20:49335547-49335569 CATTCCAGGGAGCTGCGGGCAGG + Intergenic
1174352527 20:49979091-49979113 CTTTTCAGGGAGGTGAAGGCTGG - Intergenic
1174426318 20:50433991-50434013 CCTGCAGGGGAGGGGAGGGGAGG - Intergenic
1174846670 20:53949536-53949558 CCTTCCTGGGAGGGGAATGCTGG - Intronic
1175310866 20:58010907-58010929 GCTCCCAGGGAGGCGAGGGGAGG - Intergenic
1175873439 20:62218969-62218991 CCTTTGAGGGCTGGGAGGGCTGG - Intronic
1175891818 20:62319093-62319115 CCTGCCAAGGATGGCAGGGCTGG - Intronic
1175895528 20:62334110-62334132 GCTGGCAGGGAGGGGTGGGCAGG - Intronic
1176030085 20:63007536-63007558 CGTTGCAGGCCGGGGAGGGCGGG + Intergenic
1176117937 20:63441186-63441208 CCTGCGGGGGAGGTGAGGGCGGG + Intronic
1176653821 21:9572501-9572523 GCTTCCTGGGAAGAGAGGGCAGG + Intergenic
1176860200 21:14007789-14007811 CCCTGCAGGGAGGGTCGGGCGGG - Intergenic
1178232688 21:30804851-30804873 CCTGTCAGGGAGTGGGGGGCAGG + Intergenic
1179102733 21:38368765-38368787 CCTTTCAGAGCGGGGAGGGTGGG - Intergenic
1179411689 21:41167865-41167887 CCGGCGAGGGTGGGGAGGGCAGG + Exonic
1179786468 21:43733262-43733284 GTTTCCAGGGCGGGGGGGGCGGG - Intronic
1179873608 21:44256312-44256334 CCTTCCTGGGGGGGCAGTGCTGG - Intronic
1180158587 21:45989334-45989356 CCTGCCAGGGAGGGGCTGGGTGG + Intronic
1181015105 22:20064124-20064146 CCTTCCAGACAGAGGAGGCCTGG + Intronic
1181111312 22:20604548-20604570 CCTGCAAGGGAGGCGAGGGCAGG + Intergenic
1181667409 22:24407651-24407673 CCTTGCAGGGAGAGGGGGCCAGG - Intronic
1182288307 22:29260595-29260617 CGGTCCAGGGATGGGAGGCCTGG + Exonic
1182297023 22:29315785-29315807 CCTTCCTGGGAGGGGCGTCCTGG - Intronic
1182522564 22:30892595-30892617 CCAGCAAGGCAGGGGAGGGCCGG + Intronic
1183191108 22:36322571-36322593 CCTTCCAGGCAGGGCAGGCTCGG - Intronic
1183277854 22:36912463-36912485 CCTACCAGGAAGGGCAGGGTTGG - Intergenic
1183323741 22:37180450-37180472 TCTTCCAGGGTGGGGTGGCCTGG - Exonic
1183357987 22:37369638-37369660 CCTTCCTGGGAGGGCACAGCAGG - Exonic
1183676247 22:39300408-39300430 GCTTCCAGAGAAGGGAGGGCGGG - Intergenic
1184034405 22:41911590-41911612 GGCTCCAGGGAGGGGAGGGGAGG - Intronic
1184109307 22:42385590-42385612 CCAGCCAGGGTGGGGAGGGAGGG - Intronic
1184296662 22:43529338-43529360 GCGCCCAGGCAGGGGAGGGCAGG + Intronic
1184599118 22:45532258-45532280 CTTTCTGGGGAGGGGAGAGCTGG + Intronic
1184693468 22:46127781-46127803 CCTTCCAGAGACGGAAGAGCAGG - Intergenic
1185022580 22:48387970-48387992 CCTAGCAGGGAAGGGAGGGAGGG + Intergenic
1185335848 22:50270535-50270557 CCCCCCGGGAAGGGGAGGGCTGG - Intronic
950077259 3:10195929-10195951 CCTGCCAGAGAGGGGAGGCTGGG + Intronic
950093146 3:10311731-10311753 GCTCCCAAGCAGGGGAGGGCTGG - Intronic
950451142 3:13066569-13066591 CCTTCCAGGCAGGGCTGGGCAGG + Intronic
950457599 3:13101934-13101956 CCTTGCAGGGGTGGGAGGGAGGG + Intergenic
950576055 3:13832746-13832768 CCTGACATGGAGGGGATGGCAGG + Intronic
950590991 3:13935650-13935672 CCTGCCAGGAAGAGGAGGGGAGG + Intergenic
950769649 3:15301303-15301325 ACTTCAAGGGAGGGCAGGGGAGG + Intronic
950796726 3:15516313-15516335 GCTTCCAGGCAGGGGAGCACGGG + Intronic
952278086 3:31896842-31896864 CCTTGGAGGGAGGGGAGGAAAGG + Intronic
953326462 3:42015536-42015558 TCTCCCAGAGAGGGGAGAGCAGG - Intronic
953446082 3:42968710-42968732 CTTTCTGGGGAGGGCAGGGCAGG + Intronic
954711541 3:52507461-52507483 CATTCCAGGCAGAGGAGAGCAGG - Intronic
954715335 3:52524010-52524032 CCTTCCAGGTAGGGCTGGGTTGG + Exonic
955680614 3:61497051-61497073 CCTTTCAGAGAGCGGAGGGTGGG + Intergenic
956920566 3:73924269-73924291 CATTCCAGGGAGTGGAAGTCAGG + Intergenic
957574064 3:81986557-81986579 CCTGGCAGGGAGAGGAGGGGAGG - Intergenic
958100277 3:88999758-88999780 CCTTACAGGAAGGGGAGCACAGG - Intergenic
958547882 3:95578828-95578850 CATTGCTGGGAGGGGAGGGAAGG + Intergenic
959078903 3:101779508-101779530 GGTGCCAGGGAGGGGAGGCCCGG + Intronic
959997289 3:112693528-112693550 GCTACCAGGGAGGGTAGGGAAGG - Intergenic
960394283 3:117117339-117117361 ACTTCCAGGGAGGTGAGCTCCGG - Intronic
960907974 3:122620718-122620740 GCTGCCTGGGAGGGGAGGGTGGG + Intronic
961467239 3:127089332-127089354 CCCTCCAGGCTGGGGAGGGGTGG - Intergenic
961468854 3:127098848-127098870 CCAGGCAGGGAGGGGAGGCCAGG - Intergenic
961488314 3:127233103-127233125 CCCTGTAGGGAGGGCAGGGCCGG - Intergenic
962272258 3:133986501-133986523 TCTTGCAGGGCAGGGAGGGCAGG + Intronic
962583890 3:136821881-136821903 GTTTCCAGGGACTGGAGGGCAGG - Intronic
963941963 3:151104619-151104641 ACATACAGGTAGGGGAGGGCAGG - Intronic
964264697 3:154880979-154881001 CCTGTCAGGGAGTGGGGGGCTGG + Intergenic
964790464 3:160449804-160449826 CCTTCGGGGCAGAGGAGGGCGGG - Exonic
968073466 3:195802496-195802518 CCTTCCAGGGCAGGCAGGGCAGG - Intronic
968199453 3:196739947-196739969 CACGCCAGGGAGGGGAGGGGAGG - Exonic
968319000 3:197749464-197749486 CGTGCCAGGGAGGGGGGAGCTGG + Intronic
968471782 4:785930-785952 CCTTCCAGAGAGGAGAGGAAAGG + Exonic
968506365 4:973105-973127 CTTTCGGGGGAGTGGAGGGCGGG - Intronic
968562021 4:1289271-1289293 CCTTGCAGGGCGGGCAGCGCTGG - Intergenic
968673409 4:1864301-1864323 GCCTCCAAGGAGGGGAGGGAAGG - Intergenic
968771494 4:2510438-2510460 CTTTCTAGGGAGGAGAGGCCTGG + Intronic
969240364 4:5893086-5893108 CGGCCCAGGGAGGGGAGGGGCGG + Intergenic
969345026 4:6564694-6564716 CCTTCCTGGGAGGGGAGGGTAGG - Intergenic
969690344 4:8700828-8700850 CCCACCAGGGAGGGGGTGGCTGG - Intergenic
971268413 4:25114680-25114702 CCTTCCTGGGATGGGAGAGGTGG - Intergenic
975358655 4:73440210-73440232 CCTGTCAGGGAGTGGAGTGCAGG - Intronic
976595645 4:86892479-86892501 CCCGCCAGGGAGGGGACGCCGGG + Intronic
976938345 4:90667490-90667512 CCTGTCAGGGAGTGGGGGGCTGG - Intronic
979240119 4:118440430-118440452 CCTTCCACTGGGGGAAGGGCTGG - Intergenic
979268518 4:118732032-118732054 TCTAGAAGGGAGGGGAGGGCGGG + Intronic
979546618 4:121947370-121947392 CCCTCCAGGGTTGGGAGGGAGGG + Intronic
979677992 4:123430391-123430413 TCTTCCAGGGAGGGGAAGTCTGG + Intergenic
980144297 4:128962055-128962077 CCTGCCAAGGAGGTCAGGGCTGG - Intronic
981312168 4:143307857-143307879 GCTTCCTGGGAGGTGAGGGCTGG + Intergenic
981748021 4:148069381-148069403 CCTTCCAGGGAGGGGAGGGCTGG + Intronic
982856745 4:160392404-160392426 CTTTCCAGAGAGAGCAGGGCTGG + Intergenic
983135416 4:164073489-164073511 CCTGTCAGGGAGTGGGGGGCAGG + Intronic
983247558 4:165305704-165305726 CCTTCCAGGAGGTGCAGGGCAGG + Exonic
983321809 4:166204276-166204298 CTTGGCAGGTAGGGGAGGGCTGG + Intergenic
983353495 4:166625148-166625170 CTTAAGAGGGAGGGGAGGGCAGG + Intergenic
983519937 4:168697580-168697602 CAGTCCATGGAGGGGAGAGCAGG - Intronic
983546529 4:168970635-168970657 CCTTGCAGGGAAGGGTGGGAGGG - Intronic
983935628 4:173500960-173500982 CCTTCCGGGGAGCAGAAGGCCGG + Intergenic
984858620 4:184217537-184217559 CTGGGCAGGGAGGGGAGGGCTGG - Intronic
985782547 5:1878678-1878700 CCGTCCAGGGAGTGGAAGGGCGG + Exonic
985926696 5:3024827-3024849 CCTTGAAGGGAGAGGACGGCTGG - Intergenic
986196966 5:5546221-5546243 ACAACCAGGGAGGAGAGGGCTGG - Intergenic
986437225 5:7746079-7746101 AGCTCCAGGGACGGGAGGGCAGG - Intronic
986444695 5:7811123-7811145 ACAGACAGGGAGGGGAGGGCAGG + Intronic
986737125 5:10676094-10676116 CCTTCACTGGAGGGGAGGGTAGG - Intergenic
987136835 5:14907657-14907679 CCTTCCATGGGGGGAAGGGTGGG - Intergenic
987762593 5:22185002-22185024 CCTTTCAGAGAGGGTAGGGTGGG - Intronic
988455229 5:31381634-31381656 CCATCCAGGCAGAGGAGGGATGG - Intergenic
988561920 5:32289380-32289402 CCTTGAAGGAAGGGGAGGCCGGG + Intronic
989586367 5:43076973-43076995 TCTTCCAGGTAGGGGAGAGGTGG - Intronic
990779448 5:59343102-59343124 CATACCAGAGAGGGGAGGGTGGG - Intronic
991036328 5:62131427-62131449 CCTCCCAGGGAAGGCAGGGCTGG + Intergenic
991422218 5:66453240-66453262 GGTTTCAGGGAGGGGAGGACAGG - Intergenic
991897384 5:71418387-71418409 CCTTTCAGAGAGGGTAGGGTGGG - Intergenic
992065633 5:73104996-73105018 GCATCCAGGGAGAGGAGGGCAGG + Intergenic
992154261 5:73939496-73939518 CCCTCAAGGCAGGGGAGGGGAGG - Intronic
992529851 5:77643491-77643513 CCTCCCAGGGCTGGGAGCGCAGG + Intergenic
992776475 5:80093515-80093537 ACTTCCAGGGAGCAGGGGGCAGG + Intergenic
993701473 5:91123868-91123890 CCTAGCAGGGAGTGGAGGGTGGG + Intronic
994500789 5:100574706-100574728 TCTACCAGGGAGGAGGGGGCGGG + Intronic
995957717 5:117798942-117798964 CCTTTCAGAGAGTGGAGGGTAGG - Intergenic
996457251 5:123698965-123698987 CCTGTCAGGGAGGTGAGGGCAGG - Intergenic
997867341 5:137476188-137476210 CCTACCAGAGAGTGGAGGGTGGG - Intronic
998207170 5:140166152-140166174 CCTTCCAGGCTGGGGAGGGGAGG + Intergenic
998912915 5:146980410-146980432 ACTAGCAGGGAGGGGAGGGATGG - Intronic
999144525 5:149383550-149383572 CCTACCAGGGAGGGAGGGGAGGG - Intronic
999715286 5:154355393-154355415 ACCTCCAGGGAAGAGAGGGCTGG - Intronic
1000023749 5:157341167-157341189 TCTTCTAGGCAGGGTAGGGCAGG - Intronic
1000535165 5:162470328-162470350 TCTTCCAGGGAGGAGATGGTAGG - Intergenic
1001037908 5:168311167-168311189 GCTGCCTGGGAGGGGAGGGGAGG - Intronic
1001191551 5:169637203-169637225 CCGGCGAGGGAGGAGAGGGCGGG + Intergenic
1001333215 5:170777005-170777027 GCTTCCAGGGAGGGGCGGCCTGG - Intronic
1001397279 5:171426418-171426440 CAGTGCATGGAGGGGAGGGCTGG + Intronic
1002307130 5:178290466-178290488 CCTTCCGGGGAGAGGTGGCCAGG - Intronic
1002313374 5:178328110-178328132 CCTGCCTGGGTGCGGAGGGCAGG + Intronic
1002350181 5:178577608-178577630 CCATCCAGGCAGCGGGGGGCAGG - Intronic
1002536044 5:179876111-179876133 CCTTGCAGGGAGGGGTGGCTGGG - Intronic
1002559386 5:180071445-180071467 CCCTCCACGGAGGTGAGTGCCGG - Exonic
1002721184 5:181262079-181262101 CCTCCCTGGGGAGGGAGGGCTGG + Intergenic
1002740374 5:181431013-181431035 CCTTCCACCGGGGGAAGGGCTGG - Intergenic
1002788876 6:424298-424320 GCTTCCTCGGCGGGGAGGGCGGG - Intergenic
1003497876 6:6679792-6679814 CCTGCCAGGGTGGGCAGGGAGGG + Intergenic
1006047226 6:31308261-31308283 TCTCCCAGGGATGGGGGGGCGGG - Intronic
1006398515 6:33802290-33802312 CCAAGCAGGGAGGGGAGGCCGGG + Intronic
1006431866 6:34002114-34002136 GCTTCCAGAGTGGGGCGGGCTGG + Intergenic
1006544939 6:34772772-34772794 TGAGCCAGGGAGGGGAGGGCAGG - Intronic
1006642376 6:35496077-35496099 CCTGCTAGGGGAGGGAGGGCTGG - Intronic
1006683166 6:35811729-35811751 CCTGCCAGGCACTGGAGGGCTGG + Intronic
1006830187 6:36963748-36963770 CCTTGCATGGTGGGGTGGGCGGG + Intronic
1006936641 6:37723348-37723370 CTCTCTGGGGAGGGGAGGGCTGG + Intergenic
1007398764 6:41591819-41591841 CCTGCCAGGGATGGCAGAGCTGG - Intronic
1007431726 6:41780654-41780676 CCAGCCGGGGAGGGGCGGGCGGG + Intronic
1007556522 6:42770976-42770998 CTGTTCAGAGAGGGGAGGGCCGG - Intronic
1007743734 6:44029490-44029512 GGTTCTAGGGAGGGGAGGGCAGG + Intergenic
1007748786 6:44059265-44059287 CCTGTCTGGGAGGAGAGGGCAGG - Intergenic
1007755140 6:44094581-44094603 CATTCCAGGTAGAGAAGGGCAGG + Intergenic
1007775794 6:44223704-44223726 CCTGCCACGGAGGGCAGGGAGGG + Exonic
1007816291 6:44527764-44527786 CAGCCCAGGGAGGGCAGGGCTGG + Intergenic
1007818141 6:44539288-44539310 CTTTCCTGGGAGAGGAGGGGAGG - Intergenic
1009688698 6:66997928-66997950 CCTGTCAGGGGGTGGAGGGCTGG + Intergenic
1011195139 6:84773420-84773442 CTTTCCAGGGAAGGGGGCGCGGG - Intergenic
1011568566 6:88708168-88708190 GGTTCCAGAGAGGGAAGGGCTGG + Intronic
1011620399 6:89237326-89237348 GCTTCCAGGGTGGGGAGGGAAGG + Intergenic
1011643245 6:89433793-89433815 TCGTCCAGGGCGGGGAGGGACGG - Intronic
1011657706 6:89566534-89566556 TCTCCCAGGGAGCGGAGGCCTGG - Intronic
1011693096 6:89887786-89887808 CCTTCCAGAGAAGGGAGCCCGGG + Intergenic
1011719765 6:90143482-90143504 CCTACCAGGGTGGGGAGGTGTGG - Intronic
1012506458 6:99951895-99951917 CCTGACAGGGAGATGAGGGCAGG + Intronic
1014304807 6:119727408-119727430 GCTTCCAGGGTGGGTAGGGAAGG + Intergenic
1014344682 6:120253191-120253213 CCTGTCAGGAAGTGGAGGGCAGG + Intergenic
1014531374 6:122563550-122563572 GCTACCAGGGAGGGTAGGGAAGG + Intronic
1015840652 6:137473412-137473434 CCTCAGAGGGAGGGGAGGGGCGG + Intergenic
1015841766 6:137484748-137484770 ACTACCAGTGAGGGGAGGGTGGG + Intergenic
1017118456 6:151001573-151001595 CCATCCAGCGAAGGGAGAGCTGG + Intronic
1017955911 6:159177515-159177537 CTAGCCAGGCAGGGGAGGGCAGG + Intronic
1018269887 6:162065718-162065740 CCTGCCATGGGGTGGAGGGCTGG - Intronic
1018987429 6:168648492-168648514 CCTCCCAGGGAGCCGAGGCCGGG + Intronic
1019140946 6:169942037-169942059 CCTTCCAGAAAAGTGAGGGCAGG - Intergenic
1019147199 6:169983094-169983116 CCTTCCAGGAGGGGCTGGGCAGG - Intergenic
1019149894 6:169998138-169998160 CATTCCATGGAGGGGACGGTTGG + Intergenic
1019245484 6:170706617-170706639 CCTTCCACTGGGGGAAGGGCTGG - Intergenic
1019337291 7:491431-491453 CCACCCAGGGAGGGGCGAGCAGG + Intergenic
1019356585 7:583047-583069 GCTGCCAGGGCCGGGAGGGCAGG + Intronic
1019429219 7:991027-991049 CCCTGCAGGGCCGGGAGGGCGGG - Intergenic
1019475812 7:1243795-1243817 CCCACCAGGGAGGGTGGGGCTGG + Intergenic
1019652217 7:2166137-2166159 CCCTCCTGGGAGGCGAGGTCTGG - Intronic
1019724827 7:2595724-2595746 CCCTCCAGGGAGGCAAGTGCAGG - Intronic
1019733140 7:2638345-2638367 CCTTGCACGAGGGGGAGGGCGGG + Intronic
1019912153 7:4107106-4107128 ACATCCAGGGTGGGGAGGGTGGG + Intronic
1021733286 7:23618268-23618290 ACTTCCAGGGAGGGGAGGAGGGG - Intronic
1022312839 7:29213275-29213297 CCTATCAGGGAGGGGAGGAGGGG - Intronic
1022334114 7:29406558-29406580 CATGCCAGGGCGGGGAGGGGAGG - Intronic
1023014895 7:35956978-35957000 CCTGTCAGGGGGTGGAGGGCTGG - Intergenic
1023481183 7:40636358-40636380 GCTTCCAGGGAGAGGTGGGGAGG + Intronic
1024004504 7:45215704-45215726 GCTTCCTGGGAGGTGGGGGCTGG + Intergenic
1024215659 7:47246162-47246184 CCTACCAAGGAGAGGAGGGATGG + Intergenic
1024257058 7:47547144-47547166 CCCTCCAGGGTGAGGAGGGAGGG + Intronic
1024476844 7:49821001-49821023 GCATCCTGGGCGGGGAGGGCTGG - Intronic
1025027901 7:55533333-55533355 CCTTCCTGAGTGGGGAAGGCAGG - Intronic
1025280165 7:57621167-57621189 GCTTCCTGGGAAGAGAGGGCAGG + Intergenic
1025304568 7:57844334-57844356 GCTTCCTGGGAAGAGAGGGCAGG - Intergenic
1026338432 7:69414566-69414588 CCTTTCAGAGAGTGGAGGGTGGG - Intergenic
1026457407 7:70584714-70584736 TGTTCCAGGGAGGCGAGTGCTGG + Intronic
1026931016 7:74223027-74223049 TCTTCCAGATAGGGCAGGGCAGG - Intronic
1027295388 7:76764288-76764310 GCTACCAGGGTGGGGAGGGGAGG - Intergenic
1028128893 7:87147249-87147271 CCATCCCGGGAGTGGTGGGCTGG - Intergenic
1028316221 7:89406066-89406088 CCTGTCAGGGAGTGGGGGGCAGG - Intergenic
1029367730 7:100127364-100127386 CCTGGCAGGGAGGGACGGGCTGG - Exonic
1029459582 7:100687241-100687263 CAGGCCAGGGAGGGGAGGCCTGG - Intronic
1029545283 7:101207308-101207330 CTGTCCAGGGAGGGGAGGGGAGG + Intronic
1029736744 7:102469453-102469475 CCCTCCGAGGCGGGGAGGGCGGG - Intronic
1029895469 7:103978887-103978909 GCCTCCAGGGTGGGGAGGGTAGG - Intronic
1030721962 7:112881608-112881630 CCCTCCATGGAGGGGAGACCCGG - Intronic
1031529317 7:122856994-122857016 CCTTATGGGGAGAGGAGGGCTGG - Intronic
1032080607 7:128856693-128856715 CCTTCTGGGGAGGGGAAGGATGG + Intronic
1032268581 7:130384713-130384735 CCCTGCAGTGAGGGGAGGGTTGG + Intronic
1032486341 7:132290258-132290280 GCTTCCAGGAAGGAAAGGGCTGG + Intronic
1032783723 7:135184596-135184618 CCAGCCAGGGAGGAGAGGGCAGG + Exonic
1034190633 7:149210727-149210749 CACACCAGGGAGGGGAGGGGAGG + Intronic
1034306717 7:150049326-150049348 CCTTCCCGGCCGGGAAGGGCTGG - Intergenic
1034730017 7:153378943-153378965 CCTTCCAGGGAGCAGAGTCCAGG - Intergenic
1034800128 7:154051317-154051339 CCTTCCCGGCCGGGAAGGGCTGG + Intronic
1034940045 7:155224791-155224813 CCATCCAGGGAGGGGCTGGGAGG + Intergenic
1035018819 7:155788579-155788601 CCTGCGAGGGCAGGGAGGGCAGG + Intergenic
1035243038 7:157544534-157544556 CCGTCCAGTGAGGAGGGGGCGGG + Intronic
1035403408 7:158583469-158583491 CCTGCCAGGGAGGGGAGGTGGGG - Intronic
1035502640 8:101588-101610 CCTTCCACCGGGGGAAGGGCTGG + Intergenic
1035826728 8:2653093-2653115 GCTACCTGGGAGGGGACGGCTGG - Intergenic
1037319589 8:17630639-17630661 CCCAGCAGGGAGGGGAGGGGAGG - Intronic
1038002751 8:23404733-23404755 CCTTCCTGGAATGGTAGGGCTGG + Intronic
1038450604 8:27636793-27636815 GCTGCCAGGGAGGGAAGTGCTGG - Intronic
1039060340 8:33567256-33567278 GCTTCCAGGGAAGGGAGGCTGGG - Intergenic
1039070468 8:33644888-33644910 TCTTCCATGGATGGGAGGGTAGG - Intergenic
1039475028 8:37835244-37835266 CCTTCCAGAGGAGGGAGGGAGGG + Exonic
1039598894 8:38816871-38816893 CCTTCCAGGGAGGGGAGAAAGGG - Intronic
1039746206 8:40430423-40430445 ACTACCAGAGAGGGGAGGGAGGG + Intergenic
1039755595 8:40518788-40518810 CCTGGCAGGGAGGAGAGGGCTGG - Intergenic
1039766412 8:40633052-40633074 TCTTCCAGGGCTGGGAGGGTAGG + Intronic
1039984576 8:42436724-42436746 GCTTCCAGGGAAGGGCTGGCCGG - Intronic
1040567778 8:48582607-48582629 CGCTCCGGGGAGGGGAGGGAGGG + Intergenic
1040866341 8:52052305-52052327 ACTACCAGGGTGGGGAGGGAAGG - Intergenic
1040944957 8:52874397-52874419 CCTTGCAGGGCTGGGTGGGCTGG + Intergenic
1041214583 8:55587005-55587027 CCTTCCAGGGAGTGAAGAGCAGG - Intergenic
1041757971 8:61334696-61334718 CTTTCCACTGAGGGGAGGGGTGG + Intronic
1045039804 8:98212715-98212737 ACTTCCAGGGAGGTTAGGACTGG - Intronic
1045524925 8:102933424-102933446 GCTTCCTGGGAGGGGAGGAATGG - Intronic
1047693127 8:127376979-127377001 TCTTTTGGGGAGGGGAGGGCGGG - Intergenic
1048224920 8:132575845-132575867 CAGTCCAGTGAGGGTAGGGCTGG + Intronic
1048334613 8:133493126-133493148 CCTCCCAGGGGTGGGAGGACTGG + Intronic
1048445524 8:134490036-134490058 CCCTCTGGGGAGGGGAGGACTGG - Intronic
1048496773 8:134942166-134942188 CCTTCCATGGAGGTGAGGGCTGG + Intergenic
1049178041 8:141206112-141206134 CCTGCCAGGGACGGCGGGGCGGG + Intergenic
1049218884 8:141419966-141419988 CCACCCAGGGTGTGGAGGGCAGG + Intronic
1049237156 8:141518168-141518190 CCCGGCAGGGCGGGGAGGGCCGG - Intronic
1049292556 8:141812386-141812408 GCCTCCAGGGCGGGGAGGGCGGG + Intergenic
1049306041 8:141904828-141904850 CCTGCCAGGCAGGGAGGGGCAGG + Intergenic
1049403698 8:142442390-142442412 TCTCCCAGAGAGGGCAGGGCTGG + Intergenic
1049433691 8:142576662-142576684 CCTGCCAGGGACAGGAGGACAGG + Intergenic
1049473052 8:142784735-142784757 CCTTCCAGGGTGGGGACGGACGG + Intergenic
1049595098 8:143479782-143479804 CCCCCCAGGGAGGAGAGGGGAGG - Intronic
1049653302 8:143786710-143786732 GCTACCAGGGCGGGCAGGGCTGG + Intergenic
1049697002 8:143989157-143989179 CCCTCCAAGGGCGGGAGGGCAGG + Intronic
1051511986 9:17888389-17888411 ACTTCCAGGGACGGGATAGCTGG - Intergenic
1052903890 9:33817454-33817476 CCCTCCGGGGGGGGGAGGCCCGG + Intergenic
1053149230 9:35732299-35732321 CCTGCCAGGGAGGGGCTGCCGGG - Exonic
1053200621 9:36149463-36149485 CCTTGGAGGGAGGGGTGGGTAGG - Intronic
1053293343 9:36896577-36896599 CTTCTCAGGGAAGGGAGGGCTGG - Intronic
1053310003 9:37011856-37011878 CCTCCAAGGGAGGCAAGGGCTGG + Intronic
1053401241 9:37825565-37825587 CCTTCCAGAGAGTGGAGGGTGGG + Intronic
1053479512 9:38405581-38405603 CCGTCCCTGGAGGAGAGGGCAGG + Intergenic
1054890541 9:70246309-70246331 CCTGCCAGGGGGTGGGGGGCTGG + Intergenic
1055658742 9:78479447-78479469 CTTTCTGGGGAGGGCAGGGCTGG + Intergenic
1056449848 9:86706433-86706455 TCTTCCAGGGAGGTTTGGGCTGG - Intergenic
1056715241 9:89023074-89023096 CCTTCTTTGGAAGGGAGGGCAGG + Intronic
1056932327 9:90889535-90889557 ACTCCCAGGGTGGGGAGGGGAGG - Intronic
1057297810 9:93859691-93859713 CTTTTCTGGGATGGGAGGGCAGG - Intergenic
1057314587 9:93960334-93960356 CCGTCCAGGGCCTGGAGGGCTGG - Intergenic
1057558464 9:96108286-96108308 CCTTCCAGGGAGGAGTAGGATGG - Exonic
1059409834 9:114124893-114124915 GCCTCCAGAGTGGGGAGGGCAGG - Intergenic
1059656866 9:116365334-116365356 CCTTCCCGGGAGGCGCGGGGAGG - Intronic
1059718374 9:116934607-116934629 CCTTTCAGGGAGTGGAAGGTGGG + Intronic
1059745248 9:117193936-117193958 CCATGCAGGGAGCAGAGGGCAGG + Intronic
1059758485 9:117316471-117316493 CCTCCCAGGGTGGGGAGCGATGG + Intronic
1060232154 9:121833371-121833393 CCTTCCCGGGAGTGGAGAGCAGG - Intronic
1060355538 9:122904606-122904628 CCTCCCAGGATGGGGACGGCCGG - Intronic
1060401815 9:123353977-123353999 CCTTCCCAGGTGGGGAGGACAGG + Intergenic
1060729447 9:126027828-126027850 TCTTGCAGGGAGGGGAGAGGAGG + Intergenic
1060771831 9:126337595-126337617 CCTTCCAGGAATGGGACGGCTGG - Intronic
1060790767 9:126484042-126484064 CCATCAGGGGAGGGGAGGGCAGG + Intronic
1060884533 9:127141068-127141090 CTGTCCAGGGAGTGGAGGGATGG + Intronic
1061043738 9:128153484-128153506 CCTTCGAGGAAGGGGAGGGGCGG + Intergenic
1061296720 9:129680755-129680777 CCTTCCAGAGAGGGGATCCCAGG - Intronic
1061429269 9:130520951-130520973 GCTTCCAGGGGCGGGAGGGGTGG + Intergenic
1061623272 9:131825171-131825193 GGTTCCAGGGAGGGGCTGGCGGG + Intergenic
1061842096 9:133364751-133364773 CCAACCAGGGAGGGGTGAGCAGG + Intronic
1062049442 9:134439473-134439495 GCTTCCAGGGTGCGGAGGGCCGG - Intronic
1062091562 9:134681153-134681175 CCTTGCAGGGAGGGCTGGGGTGG + Intronic
1062103645 9:134740981-134741003 CCTTCCAGTGAGAGGGGTGCTGG + Intronic
1062118605 9:134822175-134822197 CATTCCTGGGAGGGCAGGGAGGG + Intronic
1062208170 9:135348638-135348660 CCTGCCAGGGAGGGGGGGGCGGG - Intergenic
1062250569 9:135591801-135591823 CCTGCCTGGGGAGGGAGGGCAGG - Intergenic
1062392123 9:136338057-136338079 CCTTCTGGGGAGGGGAGGGGAGG - Intronic
1062406214 9:136397849-136397871 CCATCCTGGGAGGAGGGGGCAGG - Intronic
1062621009 9:137422720-137422742 TCTCCCGGGGAGGGCAGGGCGGG + Intronic
1062626796 9:137446951-137446973 ATTTCAAGGGAGGCGAGGGCGGG + Intergenic
1062737729 9:138147598-138147620 CCGTCAAGGCAGGGGATGGCGGG + Intergenic
1203605683 Un_KI270748v1:55821-55843 CCTTCCACCGGGGGAAGGGCTGG - Intergenic
1203631542 Un_KI270750v1:75953-75975 GCTTCCTGGGAAGAGAGGGCAGG + Intergenic
1185581459 X:1213418-1213440 CCATCCATGGAGGGGAGGGGAGG - Intergenic
1185586107 X:1243101-1243123 CCTTCCTGGGCGGGGAGGGTGGG - Intergenic
1185615599 X:1419782-1419804 CCACCCACGCAGGGGAGGGCCGG - Intronic
1185908417 X:3959587-3959609 CCTTTCAGAGAGTGGAGGGAGGG - Intergenic
1185953602 X:4464529-4464551 CTTTCTAGGAAGGGCAGGGCGGG + Intergenic
1186064633 X:5748987-5749009 CCTTCCAGAGGGTGGAGTGCTGG + Intergenic
1186516051 X:10166815-10166837 CATCCCAGGGACAGGAGGGCTGG - Intronic
1187033178 X:15509604-15509626 CCTTCCCTGGAGGGAAGGGAAGG + Intronic
1188178287 X:27021933-27021955 CCTGTCAGGGAGTGGGGGGCTGG - Intergenic
1189783961 X:44542868-44542890 AGTGCCAGGGAGAGGAGGGCGGG - Exonic
1189879167 X:45471300-45471322 ACTTCCAGGGTGGGTAGGGAAGG + Intergenic
1190325584 X:49205081-49205103 CCTGCTGGGGAGGGGAGGGCAGG + Exonic
1191043590 X:56112325-56112347 CCTGCCATGGAGTGGGGGGCTGG + Intergenic
1191702326 X:64055948-64055970 TCTTCCAGGGAAGTGAGGGAGGG - Intergenic
1192031204 X:67514307-67514329 CCTGTCAGGGAGAGGGGGGCTGG + Intergenic
1194245491 X:91506535-91506557 ACTTCTAGAGAGGGGAGGGAGGG + Intergenic
1195065953 X:101238476-101238498 CCTTTGTGGGAGGGGAGGGAGGG + Intronic
1195705163 X:107733195-107733217 CCTGCCAAGGTGGGTAGGGCAGG - Intronic
1195721243 X:107871328-107871350 CCTTGCAGGAGGGGGAGCGCAGG + Intronic
1197576356 X:128216937-128216959 CCTGTCAGGGAGTGGGGGGCTGG + Intergenic
1198299793 X:135324073-135324095 CTTTCTGGGGAGAGGAGGGCAGG + Intronic
1198482759 X:137056081-137056103 CTTTCTTGGGAGGGCAGGGCAGG + Intergenic
1199674737 X:150178467-150178489 CCTTTTAGAGAGGGGAGGGTGGG + Intergenic
1199677303 X:150199344-150199366 CCTGCCTGTGAGGGGAGGGAAGG + Intergenic
1199991881 X:152992036-152992058 CCCTCCAGGCAGAAGAGGGCAGG + Exonic
1200079612 X:153569533-153569555 GCTATCACGGAGGGGAGGGCTGG - Intronic
1200110420 X:153738027-153738049 CATGCCAGGGAGGAGGGGGCCGG + Intronic
1200151076 X:153951779-153951801 GCACCCAGGGAGGTGAGGGCAGG - Intronic
1200179326 X:154140827-154140849 CCTTCCTGGGATGTGGGGGCTGG + Intergenic
1200564461 Y:4747787-4747809 ACTTCTAGAGAGGGGAGGGAGGG + Intergenic
1202387860 Y:24342259-24342281 CCTTCCACTGGGGGAAGGGCTGG - Intergenic
1202482927 Y:25327869-25327891 CCTTCCACTGGGGGAAGGGCTGG + Intergenic