ID: 981749660

View in Genome Browser
Species Human (GRCh38)
Location 4:148081852-148081874
Sequence ATTGGTGAGGGGCCTTCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 153}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981749654_981749660 -4 Left 981749654 4:148081833-148081855 CCTACACGTGTATCTTTGTATTG 0: 1
1: 0
2: 0
3: 9
4: 110
Right 981749660 4:148081852-148081874 ATTGGTGAGGGGCCTTCCCAGGG 0: 1
1: 0
2: 0
3: 16
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981749660 Original CRISPR ATTGGTGAGGGGCCTTCCCA GGG Intronic
901766111 1:11501180-11501202 ATTGGTGAAGGCCCAGCCCAGGG - Exonic
903781525 1:25823125-25823147 TGTGGTAAGGGGCATTCCCAGGG + Exonic
903972808 1:27130053-27130075 ATGGGTGAGTGACCTGCCCAAGG - Intronic
905453902 1:38074497-38074519 ATTGGGAAGGGACTTTCCCAAGG + Intergenic
906108677 1:43309270-43309292 ATTGGTGAGGGGGCTGCCACTGG + Intronic
906256689 1:44355789-44355811 ATTTGTGAAGGGCCGTCCTAAGG + Intergenic
913085321 1:115431693-115431715 AGTGGTGACGGGCCCTCCCAAGG - Intergenic
914958139 1:152183096-152183118 ATTGCTGAGGAGCCAGCCCATGG - Intergenic
915065516 1:153221193-153221215 AGTAGGGAGGGGCCTTACCAAGG + Intergenic
917751540 1:178057934-178057956 CTTGGTGGGGGGCCTTGCAAAGG - Intergenic
920275412 1:204800795-204800817 AGTGGTGAGGGAGCTTTCCAGGG + Intergenic
920302746 1:204998949-204998971 ATGGTTGAGGGGTGTTCCCAAGG - Intronic
921931440 1:220757580-220757602 ATTGGTGAGGTCCCTTTTCAGGG + Intronic
921968888 1:221122921-221122943 ATTGAGGAGGGGCCTTCCTGGGG + Intergenic
1063488505 10:6441987-6442009 ATTGGTCAGTCGCCTTTCCACGG - Exonic
1066727739 10:38410104-38410126 CTAGGTGAGGGGCCTGCCAAGGG - Intergenic
1067478496 10:46581033-46581055 CTTGGTGAGTGTCCTTGCCAGGG + Exonic
1067616241 10:47760768-47760790 CTTGGTGAGTGTCCTTGCCAGGG - Intergenic
1067943915 10:50678788-50678810 ACAGGTGAGGGGCCTACCCCAGG - Intergenic
1070742063 10:78909740-78909762 AGTGGAGAAGGGCCTTGCCAGGG + Intergenic
1070865405 10:79705657-79705679 ACAGGTGAGGGGCCTACCCCAGG - Intronic
1070879197 10:79843788-79843810 ACAGGTGAGGGGCCTACCCCAGG - Intronic
1071477121 10:86034623-86034645 CCTGGTAAGGGGCCTTCCCTGGG + Intronic
1071521221 10:86332457-86332479 AGGGGTGAGAGGCCATCCCAGGG - Intronic
1071632304 10:87227878-87227900 ACAGGTGAGGGGCCTACCCCAGG - Intronic
1071645757 10:87360096-87360118 ACAGGTGAGGGGCCTACCCCAGG - Intronic
1074497914 10:113996169-113996191 TTTGGTGAGAGAACTTCCCAGGG - Intergenic
1075674431 10:124286529-124286551 ATCTGTGAGGGGCCACCCCAGGG - Intergenic
1075973007 10:126671173-126671195 GGTGGTGAGGGAACTTCCCATGG - Intergenic
1076298452 10:129405542-129405564 CTTGGGAAGGGGCCTTCCCGAGG + Intergenic
1077145038 11:1040916-1040938 ACAGGTGAGGGCCCTCCCCAAGG + Intergenic
1077879651 11:6338817-6338839 ATAGGTGTGGGGTTTTCCCAAGG + Intergenic
1079078206 11:17396601-17396623 AATGGTCAGGGGCTTTCCCTAGG - Intronic
1080030586 11:27656530-27656552 ATTTCTGAGTGGCCATCCCAAGG - Exonic
1081488211 11:43547774-43547796 ACTGGGGAGGGGGCTTCCCCGGG + Intergenic
1081990551 11:47335138-47335160 ACTGGTGAAGGACCTGCCCACGG - Exonic
1084109901 11:67007316-67007338 GTGGGCGAAGGGCCTTCCCAGGG + Exonic
1085001769 11:73043940-73043962 ATTGGTGAATGGCCTTCCAAGGG - Intronic
1088551644 11:111019444-111019466 AATGGTGAAGGGCATTCACAAGG + Intergenic
1089692772 11:120197268-120197290 ACTGTTTATGGGCCTTCCCAGGG - Intergenic
1094427286 12:30328384-30328406 ATGAGGGAGGGGCCTTACCAGGG - Intergenic
1096292075 12:50351717-50351739 AAGGGTGAGGGGCGATCCCAAGG + Exonic
1096292319 12:50352629-50352651 AGTGGTGAGAGGCATCCCCAAGG + Exonic
1096292337 12:50352701-50352723 AGTGGTGAGAGGCATCCCCAAGG + Exonic
1096292354 12:50352773-50352795 AGTGGTGAGAGGCATCCCCAAGG + Exonic
1097182801 12:57180619-57180641 CTGGGTGTGGGGCCTTCCCAAGG + Intronic
1101774594 12:107782060-107782082 TCTGGTGAGGGGCCTTCTCTGGG - Intergenic
1103988061 12:124780439-124780461 AAAGGTGTGGGGCCTTCCCCAGG + Intronic
1104043110 12:125143439-125143461 ATTGTTGGGGGCACTTCCCAGGG + Intergenic
1104369477 12:128210913-128210935 ATTGGTCAGGGTCATTCACATGG + Intergenic
1105813473 13:24013411-24013433 AAGGGTGAGGGGGCTGCCCATGG - Intronic
1107657736 13:42609203-42609225 CTTGGTGAGGGAGCTTCTCATGG + Intergenic
1111721780 13:91955627-91955649 AGGGTTGAGGGGCTTTCCCATGG - Intronic
1112908942 13:104458521-104458543 ATTGGTGAGGTACGTTCTCATGG - Intergenic
1117341751 14:54797869-54797891 ATGGGTGAGGAGGCTTCCCCAGG - Intergenic
1121324677 14:93013018-93013040 CCTGGTGAGTGGCTTTCCCAGGG - Intronic
1124165378 15:27321190-27321212 CCTGGTGCGGGGCCTTCACAGGG + Intronic
1125143706 15:36440718-36440740 ATTGGTGATGAGCTTTCCTAGGG - Intergenic
1125971586 15:43916210-43916232 CTTGGTGAGAGGCCTGGCCATGG + Intronic
1126800498 15:52293463-52293485 AGGGGTGAGGGGGCTTCCAAGGG - Intronic
1126866379 15:52941632-52941654 ATTGGTCAGGGCGCTACCCAAGG - Intergenic
1126952971 15:53902738-53902760 ATTGGTAAGGGGTCTTCAGAAGG + Intergenic
1127638188 15:60891014-60891036 TGTGGTGTGGGTCCTTCCCACGG - Intronic
1128766306 15:70253182-70253204 CTTGGGGAGGGGCTTTCCCCAGG - Intergenic
1129160021 15:73742147-73742169 ATGGTTGAGGGGCCATCCCTAGG - Intronic
1129180489 15:73871438-73871460 ATTGATGAGAGGTCTTCCCCAGG + Intergenic
1129515577 15:76155136-76155158 AGTGGTGAGGAGCCTTCACTCGG + Intronic
1132669471 16:1096721-1096743 GCTGGTGCGGGGCCTCCCCAGGG - Intergenic
1133202489 16:4212712-4212734 AGTGGGGTGGGGCCTTCCCATGG - Intronic
1136118076 16:28108415-28108437 ATGGATGAGGGTCCTGCCCATGG - Intronic
1138081347 16:54093988-54094010 GTTGCTAAGGGCCCTTCCCAAGG + Intronic
1138193534 16:55035671-55035693 ACTGGTGAGGGGTCTCCCCAAGG + Intergenic
1138392060 16:56677115-56677137 GTGAGTGAGGGGCCTTCCCTGGG + Intronic
1142280613 16:89145802-89145824 ATTGGAGTGGGGCCTGTCCAAGG + Intronic
1142994411 17:3752140-3752162 ACTGGCCAGGGACCTTCCCAAGG + Intronic
1143303669 17:5929382-5929404 ATTGATGTGGGGCCTTGTCAAGG - Intronic
1144802841 17:17942838-17942860 AATGGTGATGGCCCATCCCAGGG - Intronic
1146378963 17:32314571-32314593 AGGGGTGAGAGCCCTTCCCAGGG + Intronic
1147453348 17:40519660-40519682 ATTGGAGAGGGTCCTCCCCTTGG - Intergenic
1149797350 17:59533016-59533038 ATTTGAGAGGGGCCTTCCTAGGG - Intergenic
1151370079 17:73642287-73642309 ATTGGTGAGCCACCTGCCCAGGG + Intronic
1155868580 18:30997326-30997348 TTTGGCGAGGGCCCATCCCATGG + Intronic
1157576706 18:48748509-48748531 CTTCGGGAGGTGCCTTCCCAGGG - Intronic
1158808456 18:61003087-61003109 TATGGTGAGGGGCCTTGTCATGG - Intergenic
1159932808 18:74332009-74332031 ACTGATGAGGAACCTTCCCAAGG + Intronic
1160415348 18:78706086-78706108 AGAGGTGAGGGACCTGCCCAGGG + Intergenic
1160809661 19:1007945-1007967 AATGGCGAAGGGCTTTCCCACGG - Exonic
1161487282 19:4543165-4543187 GTTGGGGAGGGACCTTTCCAGGG + Exonic
1161768085 19:6217666-6217688 TCTGGTGAGGGCCCTGCCCATGG - Intronic
1164615242 19:29663793-29663815 AGTGGGGAGGGGGCTCCCCAAGG + Intergenic
1165115449 19:33525444-33525466 AGAGCTGAGGGGCCTTCCCAAGG + Intergenic
1167233353 19:48298623-48298645 AGTGGTGAGGGGCCTGCACTTGG + Intronic
1168148478 19:54432439-54432461 AGAGTTGAGGGACCTTCCCAAGG + Intronic
928212692 2:29335244-29335266 ATTAGTGAGGGTCCTTTCTACGG + Intronic
928216361 2:29364647-29364669 AGTGGTCAGGAGGCTTCCCAAGG + Intronic
937217226 2:120320501-120320523 AATGGTGACCTGCCTTCCCAGGG - Intergenic
942710597 2:178830753-178830775 ATGGGTCAGGAGGCTTCCCAGGG + Exonic
945866619 2:215182863-215182885 ATGGTGGAGGGGCTTTCCCATGG + Intergenic
947618807 2:231575761-231575783 ATAGGTGAGGGGCAGTGCCAAGG + Intergenic
948261594 2:236607939-236607961 ATTGTGGAGGGGGCCTCCCAGGG + Intergenic
948861660 2:240755509-240755531 ATCAACGAGGGGCCTTCCCAGGG + Intronic
1169190152 20:3653586-3653608 ATTGGTGAGGGCTGGTCCCAAGG - Intergenic
1173391727 20:42641280-42641302 ATGTGTGAGAGGCCTTCCTAAGG + Intronic
1174459404 20:50672202-50672224 CTTGGTGAGGGGCTTTCCTAGGG - Intronic
1179559151 21:42201861-42201883 TTTGGTGAGGGGCCAGCCCGAGG + Intronic
1179591872 21:42414453-42414475 AAGGGTGAAGGGCCTGCCCAAGG + Intronic
1181633204 22:24162187-24162209 AACGGTGAGGGGACTTCCTATGG - Intronic
1181750538 22:24986156-24986178 CTTGGAGAGGTGCCTGCCCAAGG + Intronic
1183948752 22:41341023-41341045 AGGCGTGAGGGGCCTTCCTAGGG - Intronic
1184650189 22:45916108-45916130 ATGGGTGGGGGCCCTGCCCACGG - Intergenic
949877931 3:8638823-8638845 GTGGGTGGGGGGCCATCCCAGGG - Intronic
954115399 3:48464433-48464455 AGTGGTGTGGGACCTTCCCAGGG - Intronic
957902433 3:86512291-86512313 CTTGGTGAGGGTCCTTCTCCTGG + Intergenic
961103605 3:124222399-124222421 AGTGGAGAGGGGTCTTCCCATGG + Intronic
962309422 3:134314685-134314707 CCTGCGGAGGGGCCTTCCCAAGG + Intergenic
963215394 3:142740460-142740482 AATGGTGATGGGCATTCCCATGG - Intronic
965685214 3:171295369-171295391 CTTGGGGAGGGGCCTGACCATGG - Intronic
967475289 3:189909359-189909381 ATTGGTAAAGGGCTCTCCCAGGG + Intergenic
967820110 3:193832333-193832355 AGTGCTCATGGGCCTTCCCAAGG + Intergenic
968510113 4:991846-991868 ATTGGTGCTGGGCCTTCTCCTGG + Intronic
968977047 4:3827524-3827546 AGTGGGAAGGGGCCTTCCTACGG + Intergenic
971980134 4:33741315-33741337 ATTGGTGAGGTGGCTGCCCATGG - Intergenic
972492243 4:39598908-39598930 AATGGTGAAGGGACATCCCAGGG - Intronic
977050889 4:92127949-92127971 ATGGCTGAGGGGCTCTCCCATGG - Intergenic
979254723 4:118598397-118598419 CTAGGTGAGGGGCCTGCCAAGGG - Intergenic
979334238 4:119447634-119447656 CTAGGTGAGGGGCCTGCCAAGGG + Intergenic
981749660 4:148081852-148081874 ATTGGTGAGGGGCCTTCCCAGGG + Intronic
984542710 4:181060443-181060465 GTGGGTGAGGGTGCTTCCCAGGG - Intergenic
985578375 5:684171-684193 GTTGCAGAGGGGCCATCCCAGGG - Intronic
985593308 5:776311-776333 GTTGCAGAGGGGCCATCCCAGGG - Intergenic
986774207 5:10998917-10998939 ATTGGTTACAGGACTTCCCAAGG - Intronic
987323092 5:16788239-16788261 ATTGCTGAGGGGCCTGGCCAGGG + Intronic
989514321 5:42324204-42324226 CTTGGTGCTGGGGCTTCCCATGG - Intergenic
990696149 5:58419757-58419779 ATGTGGGAGGGGACTTCCCAGGG - Intergenic
997605062 5:135169041-135169063 AGTGCTGAGGGACCTTCCCCTGG + Intronic
998664540 5:144281664-144281686 ATTGTTGAGGGGAGTTCCTAAGG + Intronic
999710523 5:154314416-154314438 AATGAGGAGGGACCTTCCCAGGG - Intronic
1001951487 5:175819798-175819820 AGAGGTGAAGGGCCTGCCCAAGG + Intronic
1002826367 6:777725-777747 ATGGGAGAGGGGACTTCCCCTGG + Intergenic
1005666852 6:28066299-28066321 ATTGTTGAGGGACATTCCTAAGG + Intergenic
1006336296 6:33422572-33422594 ATAGGTCAGGAGCCTTCTCAAGG - Intronic
1017665887 6:156720000-156720022 ACTGGTGTGTGGCTTTCCCAGGG - Intergenic
1019671717 7:2283481-2283503 ACAGGGCAGGGGCCTTCCCAAGG + Intronic
1021932774 7:25598067-25598089 AGTGGTGAGTGACCTGCCCAAGG - Intergenic
1024069817 7:45776063-45776085 CTAGGTGAGGGGCCTGCCAAGGG - Intergenic
1025835154 7:65086541-65086563 CTAGGTGAGGGGCCTGCCAAGGG - Intergenic
1025904926 7:65776020-65776042 CTAGGTGAGGGGCCTGCCAAGGG - Intergenic
1026155546 7:67822694-67822716 AATGGGGTGGAGCCTTCCCATGG - Intergenic
1032047207 7:128620349-128620371 CTAGGTGAGGGGCCTGCCAAGGG - Intergenic
1034285138 7:149879248-149879270 AGGGGTGAGGGGGCTTTCCAGGG + Intronic
1036838294 8:12093573-12093595 AGTAGTGAGGGGCCTCCCCTTGG - Intergenic
1036860084 8:12339821-12339843 AGTAGTGAGGGGCCTCCCCTTGG - Intergenic
1037804954 8:22053961-22053983 AGAGGTCAGAGGCCTTCCCAGGG + Intronic
1038602845 8:28964823-28964845 AGAGGTGAAGTGCCTTCCCAAGG - Intronic
1040897702 8:52385927-52385949 ATTTGTGAGGGCCCTTCCCTAGG - Intronic
1047489246 8:125360913-125360935 AGTGCAGAGAGGCCTTCCCAGGG - Intronic
1049255238 8:141610244-141610266 AGTGGTGAAGGGGCTTGCCAAGG - Intergenic
1049391667 8:142374870-142374892 ATGTGTGTGGGGTCTTCCCAGGG - Intronic
1049419058 8:142508877-142508899 AGAGGGGAGGGGGCTTCCCAGGG + Intronic
1052693282 9:31843956-31843978 AGTGGTTAGGTGGCTTCCCAAGG + Intergenic
1056234820 9:84584289-84584311 ATTGGTGAGGGTCTGTGCCATGG + Intergenic
1056304126 9:85272454-85272476 AATAGTGAAGGGGCTTCCCATGG - Intergenic
1057725371 9:97564573-97564595 ACAGGGGAGGGGCCTGCCCAGGG - Intronic
1062039741 9:134398785-134398807 AAAGGTGGGCGGCCTTCCCAGGG + Intronic
1062573507 9:137196087-137196109 GTCGGTGAGGGGCCTGCCCCAGG - Intronic
1187586041 X:20662904-20662926 AGTGGTGAGGGAGCTTCACACGG + Intergenic
1189554331 X:42126450-42126472 ATTGGTCAGGGGCTTCCCCATGG + Intergenic
1195429175 X:104768996-104769018 ATTGGTGAGTGGCAGTACCAGGG - Intronic
1195695650 X:107665208-107665230 GTTGGTGAGGGTCCTTCCTATGG + Intergenic
1200000645 X:153058178-153058200 TTTGATGCGAGGCCTTCCCAGGG + Exonic