ID: 981749661

View in Genome Browser
Species Human (GRCh38)
Location 4:148081859-148081881
Sequence AGGGGCCTTCCCAGGGTGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 196}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981749654_981749661 3 Left 981749654 4:148081833-148081855 CCTACACGTGTATCTTTGTATTG 0: 1
1: 0
2: 0
3: 9
4: 110
Right 981749661 4:148081859-148081881 AGGGGCCTTCCCAGGGTGTAAGG 0: 1
1: 0
2: 1
3: 15
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981749661 Original CRISPR AGGGGCCTTCCCAGGGTGTA AGG Intronic
901019371 1:6248199-6248221 AGGGGTCTGCCCAGGATGGAAGG + Exonic
901882125 1:12200057-12200079 AAGGGCCTTTCCTGGGTGTCTGG - Intronic
902738224 1:18415228-18415250 AGAGTCCTTCCCAGGTGGTATGG - Intergenic
905913536 1:41670035-41670057 AGAGGCCCTCCCAGGGAGTGAGG - Intronic
906517413 1:46447944-46447966 AGGAGCATTCCCAGGGTGAGGGG + Intergenic
907930729 1:58997444-58997466 ATGGCCCTCCCCAGTGTGTATGG - Intergenic
910219421 1:84875543-84875565 AAGGGCCATCCCATGGTGGAGGG - Intronic
912468088 1:109887702-109887724 AGGGGACATCCAAGGGTGAATGG + Intergenic
919638843 1:200029925-200029947 ACGGTCGTTCCCAGGGTGAATGG + Intronic
920685002 1:208102538-208102560 AGGGTCCTCCCAAGGGTATAGGG + Intronic
1063605980 10:7523407-7523429 AGTGGTCTTCCCAGCTTGTAAGG - Intergenic
1065976252 10:30845386-30845408 AGGGACCTTCCCAGGAAGCAAGG - Exonic
1067043303 10:42970019-42970041 GGGGGACTTCGCAGGGTGCAAGG - Intergenic
1067119093 10:43458573-43458595 AAGGGGCTTTCCAGGGTGAAAGG - Intronic
1067797365 10:49330469-49330491 AGGGGCCATGCCAGGGTCTTGGG + Intergenic
1069637001 10:69930998-69931020 AGGGGCCTTCTCTGGGTCTCAGG + Intronic
1069749609 10:70736817-70736839 AGTGGCCTTCCTGGGGTGCAGGG + Intronic
1069939189 10:71942672-71942694 AGGGTCCTTCCCAGGCTGGCTGG - Intergenic
1070913528 10:80137978-80138000 AAGGGCCTTCTCAGGATGTGGGG + Intronic
1071505084 10:86227263-86227285 AGGGGCCCTTCTGGGGTGTATGG + Intronic
1071516042 10:86298609-86298631 AGGGGCCTTTCCAGGGAGGTGGG - Intronic
1074366147 10:112859039-112859061 TGTGGCCTTCCCGGGGTGTGGGG + Intergenic
1075712139 10:124536461-124536483 GGGGGCTTTCTCAGGGTGGAGGG - Intronic
1077088069 11:764575-764597 TGAGGCCATCCCAGGGTGGAGGG + Intronic
1077339090 11:2018089-2018111 AGGGTCCTCACCAGGGTGTCTGG + Intergenic
1077390592 11:2299091-2299113 AGGGGGCTGCCCAGGCAGTAGGG + Intronic
1077717401 11:4595487-4595509 AGGGTCCTTCCCAAGCTGTATGG + Intergenic
1079345312 11:19646603-19646625 GGGGAGCTTCCCAGGGTGTGGGG + Intronic
1081577504 11:44328345-44328367 AGGGGCCAGGCCAGGGTGAAGGG - Intergenic
1083800477 11:65043789-65043811 AGGGGCCTTCCCAGGTGGTCAGG + Intronic
1084760524 11:71267899-71267921 AGGGGCCTGCCCTGGGTGGTGGG - Intergenic
1085128336 11:74017227-74017249 AAGGGCCTTCCCAGGGAACAGGG + Intronic
1088861280 11:113802042-113802064 AGGGCCCTTCCCAGGGATTCTGG + Intronic
1089309504 11:117548432-117548454 AGGGGCCTTGCTGGGGTGCAGGG - Intronic
1089833675 11:121351070-121351092 AAGGGCCTACCCAGGGGGAAGGG + Intergenic
1090251746 11:125256418-125256440 AGGTGCCTGCCCAGGGTTTAGGG - Intronic
1091209558 11:133844572-133844594 ACCACCCTTCCCAGGGTGTAAGG - Exonic
1202822074 11_KI270721v1_random:73271-73293 AGGGTCCTCACCAGGGTGTCTGG + Intergenic
1091918251 12:4284457-4284479 AGAGGCCGTCCCAGGGCCTAGGG - Intronic
1094812208 12:34149558-34149580 AGGGGCCTTCCCTAGGCTTATGG + Intergenic
1096634563 12:52949973-52949995 AGGAGCCAATCCAGGGTGTAGGG + Intronic
1096975174 12:55695658-55695680 AGGGGCATTCCTAGGGGGCAAGG + Intronic
1098232770 12:68389944-68389966 TGGGGCCCTGCCAGGGAGTAAGG - Intergenic
1101833135 12:108274828-108274850 ATGGGCCATCCCATGGTGGAAGG - Intergenic
1103610804 12:122123129-122123151 AGGAGCCTGCCCAGGGTTTCTGG + Intronic
1104812946 12:131629271-131629293 GGGGGGCTTCCCAGGGAGCAGGG - Intergenic
1106555407 13:30804409-30804431 ACGGGCCTTCACAGGGAGTCGGG + Intergenic
1107347570 13:39478637-39478659 ATGGCCCTTCCCAGGGTGGATGG + Intronic
1112302189 13:98240365-98240387 AGTGGCCTTCCCAGGCAGGAAGG + Intronic
1114615440 14:24065559-24065581 AGGGGGCTCCCCAGGCTGTGAGG - Intronic
1114625140 14:24123908-24123930 AGGGACCTTCCCAGAGGGCAGGG - Exonic
1121568605 14:94929619-94929641 AGGTGCCTTCACAGGGCGGACGG + Intergenic
1122100900 14:99408921-99408943 AGGGGCCTTCCAAGGCTGTAAGG + Intronic
1122430166 14:101635279-101635301 AGGGGGCTTCCCGGGATGCAGGG - Intergenic
1122929360 14:104926292-104926314 AGGCGCCCTCCCCGGGTGCAGGG - Intronic
1123121235 14:105918034-105918056 TTGGGCCTCCCCAGGGTGTGGGG + Intronic
1126096313 15:45093369-45093391 AGGGGCCTGCCCAGGGGTCAGGG + Exonic
1127704622 15:61534822-61534844 AGGGTCCTTACCAAGGTGGAAGG + Intergenic
1128240322 15:66096972-66096994 AGAGTCCTTACCAGGGTCTAGGG - Intronic
1128699737 15:69795425-69795447 AGGGGCCTGCCCTGGGTGTCAGG + Intergenic
1129264486 15:74386579-74386601 AGGGGCCTCCCCAGGGTGGCAGG + Intergenic
1132520111 16:383166-383188 AGTGTCCTTCCCAGGATGTGAGG + Intronic
1132829900 16:1922902-1922924 AGGGACCCTCTCAGGGTGCAGGG - Intergenic
1133202488 16:4212705-4212727 TGGGGCCTTCCCATGGTCTCTGG - Intronic
1133478313 16:6145189-6145211 AGGGCCTTTCCTAGGGTGGAGGG - Intronic
1139472835 16:67187436-67187458 AGGGGCCCTACCAGGGTGGCTGG - Exonic
1142425355 16:89999653-89999675 TGGGGCATCCCCATGGTGTATGG + Intergenic
1142767180 17:2071515-2071537 AGGGGGCTTCCCTGGGTGTGGGG + Intronic
1143034049 17:3984306-3984328 AGGGGCCATCCCAGGGCTTGGGG - Intergenic
1143216535 17:5229306-5229328 AAGGGCATTTCCAGGGTGTCAGG + Intronic
1144727876 17:17510947-17510969 AGGGGCCCTTCCAGGATGTGAGG - Intronic
1145999634 17:29123349-29123371 TGGGGCCCTCCGAGAGTGTAGGG - Intronic
1148207857 17:45790978-45791000 AGGCACCTGCCCAGGGTGAAAGG + Intronic
1148587350 17:48790487-48790509 AGGAGCCTGGCCAGGGTGGAGGG + Intronic
1149654407 17:58302696-58302718 AGGGGCCTGCCCAGGGTCACAGG - Intronic
1151285416 17:73107594-73107616 GTGGGCCTTCCCAGGGAGGAGGG + Intergenic
1151858894 17:76743960-76743982 AAGGGGCTTCTCAGGGTCTAAGG + Intronic
1152160772 17:78667294-78667316 CGGGGCCTCCCCAGGATGTTTGG - Intergenic
1152942641 17:83181050-83181072 AGGGGCCTCCCCAGGTTTCAGGG - Intergenic
1153766919 18:8383881-8383903 AGGTGCCACCCCAGGATGTAAGG - Intronic
1157876267 18:51276512-51276534 AGGGGCCTCCCCTGAGTTTAAGG - Intergenic
1158449906 18:57554981-57555003 CGGGGCCTTCCCAGTGTTAATGG - Intronic
1160011978 18:75112939-75112961 AGGGCCATGCCCAGGGTGGATGG + Intergenic
1160107925 18:75995308-75995330 AGGTGACTTCCCAGGTGGTAAGG - Intergenic
1160879536 19:1313196-1313218 CGGGGCTTTCCCAGGGTGCTCGG + Intergenic
1160925464 19:1542877-1542899 CGGGGCCTTGCCAAGGTGCAAGG - Intergenic
1160939490 19:1613716-1613738 AGGCTCCTCCCCAGGGTGTGGGG - Intronic
1162021431 19:7870142-7870164 AGGGGCCTGCCCAGGGAATGAGG + Exonic
1163251429 19:16128428-16128450 AGGGGCCTCTCCAGGGTGAGTGG - Intronic
1163573609 19:18097908-18097930 CGGGGCCTTCACGGGCTGTAGGG + Intronic
1164827952 19:31298119-31298141 AGTGGCCTTCCCTGGGTGCAAGG - Intronic
1165073276 19:33267769-33267791 TCGGGACTTCCCAGGGTGGAAGG - Intergenic
1167851799 19:52207887-52207909 AGGCGCCTTCCCTGGGTTTAAGG - Intronic
1168098702 19:54129402-54129424 AGGGGCCTTGCCAAGGTCTCAGG - Intronic
1168113216 19:54206677-54206699 AGAGGCCTTCACAAGGTGTACGG - Intronic
925905301 2:8536457-8536479 AGGGGTCTGCCCAGGGAGGAAGG - Intergenic
929026537 2:37609840-37609862 ATGGTGATTCCCAGGGTGTAAGG + Intergenic
929761795 2:44813371-44813393 AGGCACCTTCCCAGCGTGAATGG - Intergenic
929780784 2:44955615-44955637 AGGGGACTTCCCTGGGTCTCTGG - Intergenic
930716427 2:54597703-54597725 ACAGACCTTCCCAGGGTGTTGGG + Intronic
932484929 2:72079017-72079039 AGGGGCCTTGCCAGGGAGCAAGG - Intergenic
932573567 2:72950862-72950884 AGGGGCCTTCTCCGGGGATAAGG + Intronic
932819780 2:74889653-74889675 AGGGGGCTTCCCACGGTGGGGGG - Intronic
933284905 2:80375272-80375294 AAGGGCCTCCCCAGGAGGTAGGG + Intronic
933856595 2:86420100-86420122 AGGGGCCAGCCCATGCTGTAAGG - Intergenic
935830171 2:106994091-106994113 AGGAGGCTTCCCAGGGTACAGGG + Intergenic
938764792 2:134453610-134453632 AGGGGCCACCCCAGCCTGTAGGG - Exonic
939514483 2:143149338-143149360 ATGGGAATTCCCTGGGTGTATGG + Intronic
941318983 2:164031162-164031184 AAGGGCTTGGCCAGGGTGTATGG - Intergenic
941527923 2:166628951-166628973 ATGGGCATTCCCAGGGTAGAGGG + Intergenic
944928386 2:204490015-204490037 AGGGGCATTCCCAGGGTTCCAGG + Intergenic
946172833 2:217905626-217905648 AGGGGCCAGCACAGGGAGTACGG + Intronic
947346741 2:229199367-229199389 AGAGCCCTTCCCATGGTGGAAGG - Intronic
948034367 2:234846458-234846480 AGGCTCCTGCCCAGGGTGTGGGG - Intergenic
948593521 2:239065664-239065686 AGAGGCCTTGCCAGGGGGCAGGG - Intronic
949016158 2:241712279-241712301 AGGGACCTGCCCAGGCTTTAGGG + Intronic
1176111159 20:63411395-63411417 AGGGGCCTGTCCAGGGGGCACGG + Intronic
1176116201 20:63432692-63432714 TGGGGCCTTCCCAGAGGGTGGGG - Intronic
1178701936 21:34841190-34841212 AGGGGCCTGCACAGGGAGTGTGG - Intronic
1180913235 22:19468066-19468088 ACGGGCCTGCCCAGTGTATAGGG - Intronic
1180964048 22:19776462-19776484 AGGGGCCTGCACGGGGTGGAGGG + Intronic
1181115700 22:20631576-20631598 TGTGGCCTTCCCAGGCTGGATGG - Intergenic
1182353706 22:29712772-29712794 AGGTGCCTTCCTAGGGGGTGGGG - Intergenic
1183509208 22:38225246-38225268 AGGGCCTTTCCCAGGGGCTAGGG - Intronic
1184303520 22:43578300-43578322 AGAGGGCTTCCCAGGGTGCTGGG - Intronic
1184784252 22:46664185-46664207 AGGCACCTTCCCAGGGTGGGAGG + Intronic
951663331 3:25094837-25094859 AGAGTCCTTCCCAGGGTGAAAGG - Intergenic
952889423 3:38030436-38030458 AGGGACCCTCCCAGGGTCTGTGG - Intergenic
953881110 3:46691918-46691940 AGGGGGCTTCTCTGGGTGTGGGG + Intronic
953980752 3:47411813-47411835 AGGGGCCAGCCCATGGTGCACGG + Exonic
954683483 3:52358390-52358412 CTGGGCCTTCCCAGGCTGGATGG - Intronic
958158224 3:89783529-89783551 AGGAGACATTCCAGGGTGTATGG + Intergenic
960912045 3:122658992-122659014 AGTGGCCTTCCTTGGGTGCAAGG - Intergenic
961594421 3:128005825-128005847 AGGCTCCTTCCCAGGGAGTGGGG + Intergenic
962322420 3:134402864-134402886 AGAGGCCTTCCCAGGATTTCTGG - Intergenic
963060234 3:141219770-141219792 AAGGGCCTTCCCAGCCTGGAGGG + Intergenic
964362401 3:155912382-155912404 GGGGACCTTCCCAGGATGTTGGG - Intronic
967196024 3:187026300-187026322 AGGAGCCTGCCCAGGCTGTCTGG - Intronic
969115327 4:4867444-4867466 CGGGGGCTTCCCAGGGAGTCCGG - Intergenic
969538184 4:7769503-7769525 AGAGGCCTTCCTAGTGTTTACGG + Intronic
969619036 4:8269784-8269806 AGGGGCATCCCCAGGGCGCAGGG - Exonic
977995815 4:103496627-103496649 GGGGGACTTCCAGGGGTGTATGG + Intergenic
978287432 4:107095233-107095255 AGGGATCTTCCCAGAGAGTAGGG - Intronic
978314121 4:107417244-107417266 AGGGTCCTTCCCAGGCTGGCTGG - Intergenic
981749661 4:148081859-148081881 AGGGGCCTTCCCAGGGTGTAAGG + Intronic
982399733 4:154953511-154953533 AGGTGCCTTGCAAGGGTGCATGG + Intergenic
983070775 4:163265492-163265514 AGGTGACATCCCAGGGTGTGAGG + Intergenic
986914927 5:12607816-12607838 TGGGGCCTGTCCAGGGTATAGGG - Intergenic
988551539 5:32204867-32204889 AGGGGCAGTCCCAGGGAGCAAGG + Intergenic
988930720 5:36033437-36033459 AGGGACTTCCCCAGGGTGGATGG - Intergenic
995867379 5:116706180-116706202 AGGGTCCTTCCCAGGCTGACTGG - Intergenic
996255625 5:121399372-121399394 TGGGGCCTTCTGAGGGTGGATGG + Intergenic
996636199 5:125692440-125692462 AGGTGGCTTCCCATGGTCTAGGG - Intergenic
997265414 5:132491945-132491967 AGGGGCCTTACCAAGGAGCATGG - Intergenic
998106639 5:139473133-139473155 GGGGGCCTTCCCAGGGCCCAAGG + Intergenic
1002759330 6:189814-189836 AGGGGGCTGCCCAGGGGGAAAGG - Intergenic
1003403596 6:5810445-5810467 AGGGCCCTCCCCAGTGTGTGTGG + Intergenic
1003656040 6:8009745-8009767 TGGGGCCTTCCTAGGCTGCAGGG - Intronic
1006022028 6:31122939-31122961 CTGGGCCGTCCCAGGGTGTGAGG + Intronic
1006088826 6:31615930-31615952 AGGGGCCCCGCTAGGGTGTAAGG - Intronic
1006418523 6:33919328-33919350 AGGGGCCTTTCCAGGGAGGGAGG - Intergenic
1007982663 6:46175073-46175095 AGTGGCCTTTCCTGTGTGTACGG + Intergenic
1008647212 6:53527132-53527154 GAGATCCTTCCCAGGGTGTAAGG - Intronic
1011870065 6:91882029-91882051 AGCTGCCTTCCCAGGGGGCAGGG - Intergenic
1015114679 6:129635011-129635033 CGGGGCCTTCCAAAGGTTTATGG + Intronic
1018474333 6:164124776-164124798 AGGACCCTTCACTGGGTGTAAGG + Intergenic
1019371923 7:666533-666555 AGGTGCCGTCCCAGGGGATAAGG + Intronic
1021795026 7:24245812-24245834 AGGGGCATTGCAATGGTGTATGG + Intergenic
1022518371 7:30989636-30989658 GGGGGCCCTCACAGGGTGGAGGG + Intronic
1023134086 7:37033570-37033592 ATGTCCCTTCCCAGGGAGTAGGG + Intronic
1023436399 7:40144517-40144539 AGGGTCCTTCCCAGGGTGGCTGG + Intronic
1026746970 7:73021455-73021477 GTGGGTCTTCCCAGGGAGTAGGG + Intergenic
1026750622 7:73049598-73049620 GTGGGTCTTCCCAGGGAGTAGGG + Intergenic
1026754269 7:73077708-73077730 GTGGGTCTTCCCAGGGAGTAGGG + Intergenic
1026757921 7:73105741-73105763 GTGGGTCTTCCCAGGGAGTAGGG + Intergenic
1027033074 7:74906026-74906048 GTGGGTCTTCCCAGGGAGTAGGG + Intergenic
1027089482 7:75287743-75287765 GTGGGTCTTCCCAGGGAGTAGGG - Intergenic
1027093127 7:75315671-75315693 GTGGGTCTTCCCAGGGAGTAGGG - Intergenic
1027096770 7:75343638-75343660 GTGGGTCTTCCCAGGGAGTAGGG - Intergenic
1027322577 7:77024042-77024064 GTGGGTCTTCCCAGGGAGTAGGG + Intergenic
1029397881 7:100320614-100320636 GTGGGTCTTCCCAGGGAGTAGGG - Intronic
1034416802 7:150969580-150969602 AGGAGCCTTCCCTGGGAGTCAGG - Intronic
1034458678 7:151186320-151186342 AGAGGCCTTCTCAGGGAGGATGG - Intronic
1034549761 7:151813069-151813091 CGGAGCCTGCCCAGGGTGTGTGG + Intronic
1035203435 7:157280359-157280381 GGGGACGCTCCCAGGGTGTAAGG + Intergenic
1035294761 7:157860805-157860827 AGTGGCCTTCCCTGGTTGGACGG - Intronic
1039337399 8:36607132-36607154 AGGGACCTGGCCAGGGTGTCAGG - Intergenic
1040901980 8:52427080-52427102 AGGGGAGTTCCCAGGCTGTGAGG - Intronic
1043320088 8:78973648-78973670 AGAGGCCTTAACAGGGTGCAGGG + Intergenic
1047294719 8:123560602-123560624 AGGGGCCTTCCCAGGCTCACTGG - Intergenic
1048986125 8:139736014-139736036 ACGGCCTTTCCCAGGGTGAAGGG - Intronic
1049213251 8:141396284-141396306 AGGGTCCTTCCCTGGCTCTAGGG - Intronic
1049473162 8:142785198-142785220 AGGGGCCTTCCCTGGGGGGAAGG + Exonic
1049989500 9:977715-977737 AGGTGCCTTCCCAGGTTGAAGGG + Intronic
1056842334 9:90008499-90008521 ATGGCCCTTCCCAAGGTGGAGGG - Intergenic
1057273874 9:93665921-93665943 AGAGGTCTTCCCAGGGTGGCTGG + Intronic
1058699230 9:107587283-107587305 GAGGGCCTTGCCAGGATGTAGGG + Intergenic
1060917210 9:127398263-127398285 AGGATCCTTCCCAGGGTCGACGG - Intronic
1061137103 9:128741304-128741326 AGGGGCTTTCCCTGGGAGTGGGG + Intronic
1061191769 9:129086362-129086384 TGGGGCCTTCCCAGGGAGACAGG - Intronic
1061569510 9:131468145-131468167 TGGGGTCCTCCCAAGGTGTAAGG + Intronic
1061834245 9:133318320-133318342 AGGGGCCTTCTCCAGGTGTCAGG + Intergenic
1062238052 9:135522032-135522054 AGGGGCCTTCTCCAGGTGTCAGG + Exonic
1186436751 X:9549696-9549718 AGGGGCCTGCCCAGGAAGGAAGG - Intronic
1186776875 X:12873646-12873668 AGGGGCCTTCCCTGGGAAGAGGG - Intronic
1187936321 X:24339664-24339686 ATGTGCCTTCGCATGGTGTAAGG + Intergenic
1188216933 X:27490118-27490140 AGTGGCCTTCCCAAGGTGGGAGG - Intergenic
1189034507 X:37482134-37482156 AGGGTCCTTCCCAGGCTGGCTGG - Intronic
1190925747 X:54902224-54902246 AGGAGGGTTCCCAGGATGTAAGG - Intergenic
1200009030 X:153107713-153107735 TGGAGCCTTCCCAGGGAGCACGG + Intergenic
1200030570 X:153292209-153292231 TGGAGCCTTCCCAGGGAGCACGG - Intergenic
1202124759 Y:21557725-21557747 AGGTGCCTTCCCAGCCTGGATGG - Intergenic
1202154249 Y:21871655-21871677 AGGTGCCTTCCCAGCCTGGATGG + Intergenic