ID: 981756520

View in Genome Browser
Species Human (GRCh38)
Location 4:148146077-148146099
Sequence AAGAAGAAGGGGAAGTGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1428
Summary {0: 1, 1: 0, 2: 7, 3: 133, 4: 1287}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981756512_981756520 15 Left 981756512 4:148146039-148146061 CCCAGTGAGCCAAGGAGAAGTAA 0: 1
1: 0
2: 0
3: 13
4: 168
Right 981756520 4:148146077-148146099 AAGAAGAAGGGGAAGTGGGCTGG 0: 1
1: 0
2: 7
3: 133
4: 1287
981756514_981756520 6 Left 981756514 4:148146048-148146070 CCAAGGAGAAGTAAGAAATCTTA 0: 1
1: 0
2: 1
3: 24
4: 254
Right 981756520 4:148146077-148146099 AAGAAGAAGGGGAAGTGGGCTGG 0: 1
1: 0
2: 7
3: 133
4: 1287
981756513_981756520 14 Left 981756513 4:148146040-148146062 CCAGTGAGCCAAGGAGAAGTAAG 0: 1
1: 0
2: 1
3: 18
4: 207
Right 981756520 4:148146077-148146099 AAGAAGAAGGGGAAGTGGGCTGG 0: 1
1: 0
2: 7
3: 133
4: 1287

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981756520 Original CRISPR AAGAAGAAGGGGAAGTGGGC TGG Intronic
900279845 1:1859674-1859696 GAGAGGAAGGAGAAGTGGGGTGG + Intronic
900498521 1:2987977-2987999 AATTAGAAGTGGAGGTGGGCTGG - Intergenic
900508055 1:3039436-3039458 AATAAGAAGGGGGAGGGGGGAGG - Intergenic
900790078 1:4674166-4674188 AAGAAGGCAGGGCAGTGGGCAGG + Intronic
901144334 1:7054940-7054962 AAGATGAAGGGGAAGTAGGCTGG + Intronic
901291428 1:8127225-8127247 AAGAAGAACGTGAAGTAGACAGG + Intergenic
901319288 1:8329932-8329954 AAGTGGAAGGGGATGTAGGCAGG + Intronic
901395906 1:8981409-8981431 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
901489836 1:9591013-9591035 AAGATGTAGAGGGAGTGGGCAGG + Intronic
901520342 1:9779040-9779062 AAGAAGAAGAAGAAGAAGGCTGG + Intronic
901806776 1:11743540-11743562 AAGAAAAAGGGCAGATGGGCTGG - Intronic
901975588 1:12941705-12941727 AAAAAAATGTGGAAGTGGGCAGG - Intronic
902009586 1:13260060-13260082 AAAAAAATGTGGAAGTGGGCAGG + Intronic
902030371 1:13417607-13417629 AAAAAAAAGTGGAACTGGGCAGG + Intronic
902228423 1:15011856-15011878 AAGAGGAAGGAGGAGTGGGAAGG + Intronic
902636918 1:17740747-17740769 AAGAGGAAGGGGGTGTGGGCAGG - Intergenic
902726702 1:18340959-18340981 AAGAAGAAGGAGAAGAAGGAGGG - Intronic
902928445 1:19713392-19713414 AGGAAGAAGGGGAAGGGGTGGGG + Intronic
903036070 1:20493374-20493396 CAGAAGACGGGGAAGTGAGAAGG + Intergenic
903196850 1:21696447-21696469 AAGAAGAAGGGAAAGAAAGCGGG + Intronic
903337793 1:22636576-22636598 CTGAAGAAGGGGAAGTAGGAAGG + Exonic
903559227 1:24215511-24215533 AAGCAGAAGGAGAGGAGGGCAGG + Intergenic
903613411 1:24633717-24633739 TATAAGAAGGGGAAATTGGCTGG - Intronic
903649119 1:24912338-24912360 AGGAAGAAGTGGTAGTGGGTGGG - Intronic
903911041 1:26725430-26725452 AATCAGAAGGGGAGGTGAGCAGG - Intronic
904138012 1:28329027-28329049 GAGAAGAGGAGGAAGTTGGCTGG + Exonic
904209630 1:28878317-28878339 AAAAAAAAGAGGAAATGGGCTGG + Intergenic
904306565 1:29593921-29593943 AAGAGGGAGGAGAAGGGGGCAGG + Intergenic
904352382 1:29917249-29917271 AAGGGGAAGGGGAAGTGGAGGGG - Intergenic
904434692 1:30486723-30486745 TATAAGAAGAGGAAGAGGGCTGG + Intergenic
904486966 1:30831515-30831537 AAAAAGAAGAGAATGTGGGCCGG + Intergenic
904560682 1:31395206-31395228 AAGAAGAAGAAGAAGAAGGCGGG - Intergenic
904585292 1:31576640-31576662 AAGAAACAGGGGGAGGGGGCAGG + Intronic
904911475 1:33937454-33937476 ATGGGGAAGTGGAAGTGGGCAGG + Intronic
905120793 1:35680242-35680264 AAGAAAAAGGTGAAGTTGGCCGG - Intergenic
905653007 1:39668952-39668974 AAGGAGCAGGTGAAATGGGCTGG + Intronic
905707702 1:40074423-40074445 AAGAAGAAGAAGAAGCGGGGGGG - Intronic
905980545 1:42221965-42221987 AAGAAGAAGGGGGAGGGGGAGGG + Intronic
906390326 1:45409794-45409816 AAGAAGAAAGGGAATGCGGCAGG + Intronic
906509163 1:46401077-46401099 GGGAAGAGGGGGAAGTGGGGAGG + Intronic
906933675 1:50193300-50193322 AGGAAGAAGGGGATGGGGGTAGG + Intronic
906977989 1:50596047-50596069 AAAAAAAAAGGGAAGTGCGCAGG + Intronic
907197695 1:52699936-52699958 AAGATGAATGGGAAGTCAGCCGG - Intergenic
907261057 1:53218987-53219009 AAGAACAGTGGGAGGTGGGCAGG + Intronic
907381822 1:54096972-54096994 GGGAAGAAGGGGTAGTTGGCTGG - Exonic
907638961 1:56166345-56166367 AAGAAGAGAGGGAAGGGGACAGG + Intergenic
908138485 1:61157693-61157715 TAAAACAAGGGAAAGTGGGCCGG - Intronic
908207945 1:61870229-61870251 AAGGAGATGGGGAGGTGGGTAGG + Intronic
908262447 1:62349514-62349536 GAGAGGAGGGGGAAGTGGGGAGG + Intergenic
908314043 1:62915374-62915396 AAGTAGGAGAGGAAGTTGGCTGG - Intergenic
908553461 1:65233165-65233187 CAAAAGAAGGGAAAGTGGCCAGG - Intergenic
908960785 1:69694741-69694763 AGGAGGAAGAGGAAGTGGGGGGG - Intronic
909207970 1:72784334-72784356 ATGAAGCAGGGGAACTGGACAGG + Intergenic
909427942 1:75549418-75549440 AAGAAGAAGGAAGAGTGGGGCGG - Intronic
909710203 1:78640674-78640696 AAGAAAAAGAGGAAGTGAGGAGG - Intronic
911483949 1:98482352-98482374 AAGAGGGAGGGGAATGGGGCTGG - Intergenic
911583037 1:99657455-99657477 AACAAGAAGGAGCAGAGGGCAGG - Intronic
911620571 1:100063341-100063363 AAAAAGGTGGGGAAGTGGCCAGG + Intronic
911733049 1:101309707-101309729 AAGAACAAAGGGAAGTCGGAAGG - Intergenic
911820315 1:102411265-102411287 AAGGAGAAGGAGAAGGGGGGTGG + Intergenic
911964400 1:104348327-104348349 GAAGAGAAGGGAAAGTGGGCTGG + Intergenic
912035044 1:105301799-105301821 AAGGAGAGGGGAAAGTGGGGAGG - Intergenic
912228633 1:107766232-107766254 AAGAAGAAGGAGGAGGGGGAAGG - Intronic
912519541 1:110235607-110235629 AAGAGGAGGGGGCAGTGTGCAGG + Intronic
914215971 1:145628752-145628774 AAGAAGAATGGGAAGAAAGCTGG + Intronic
914468540 1:147951384-147951406 AAGAAGAATGGGAAGAAAGCTGG + Intronic
914918133 1:151830804-151830826 AGGAGCAAGGGGAGGTGGGCGGG - Intronic
915253936 1:154611081-154611103 AAAAACATGGGGAAGTGGACTGG - Intronic
915381040 1:155441044-155441066 TAGAAGAAAGGAAAGTGGACAGG - Intronic
915606161 1:156952530-156952552 AAGGACAAGGGGAAATGGGGAGG + Intronic
916030753 1:160875751-160875773 AAGAAGAAGGGAAAGAGGAAGGG - Intergenic
916030759 1:160875775-160875797 AAGAAGAAGGGAAAGAGGAAGGG - Intergenic
916604661 1:166328821-166328843 AAGAAGAAGGGGAGGGATGCTGG - Intergenic
916720521 1:167481996-167482018 AGGCAGAAGAGGGAGTGGGCAGG - Intronic
916957431 1:169853731-169853753 AAGAAGAAGGGGAGCTGAACTGG - Exonic
917070171 1:171141899-171141921 GAGAAGAAGGAGAGGTGGGAAGG - Intronic
917367605 1:174249937-174249959 ATGAAGAAGGGCAAGAGGGCCGG - Intronic
917409333 1:174742053-174742075 AAGAAGAAGAGGAAGAGGAGGGG + Intronic
917409357 1:174742134-174742156 AAGAAGAAGAGGAAGAGGAGAGG + Intronic
917448491 1:175126839-175126861 AAGAAGGAGGAGAAATGGGAGGG + Intronic
917518276 1:175726891-175726913 ACAAAGAGGTGGAAGTGGGCAGG + Intronic
917917091 1:179712913-179712935 AAGAAAAAGGGGGGGTGGGTGGG + Intergenic
918083776 1:181227988-181228010 ATGAAGAAGGAGAAATGGGATGG - Intergenic
918101650 1:181381492-181381514 GAGAAGATGAGGAAGTGGGGAGG + Intergenic
918200067 1:182258343-182258365 AAGAAGAAGGGGAAGAAGGAAGG - Intergenic
918373697 1:183887187-183887209 AAGAAGGAGGGGAAGGAGGGAGG - Intronic
918516959 1:185374055-185374077 CATCAGAAGGGGAAGTGAGCTGG - Intergenic
918533882 1:185552858-185552880 AAAAAGAAGGGGTGGTAGGCCGG - Intergenic
918662462 1:187106426-187106448 AAGAGGAAGGAAAAGTGGACTGG - Intergenic
919016770 1:192048516-192048538 AAGGAGAAGGGGAAGGGGAAGGG + Intergenic
919375513 1:196788935-196788957 AAGGAAAAGGGTAAGTGGGTGGG + Intronic
919384687 1:196905828-196905850 AAGAAAAAGAGTAAGTGGGTGGG + Intronic
919406981 1:197197523-197197545 AAAAGGAAGGGGAAGGGGACAGG + Intronic
919491021 1:198204925-198204947 AAGAAGAAGGAAAATTGGGAGGG - Intronic
919572263 1:199263584-199263606 AAGAAAAAAAGGAAATGGGCAGG + Intergenic
919595845 1:199561519-199561541 AAGAAGAAGGAGAAGGAGGAGGG - Intergenic
919691383 1:200531356-200531378 AAGAGGGAGGGGAAAGGGGCAGG + Intergenic
919710429 1:200722018-200722040 AAGGAGAAGGTGAAATAGGCTGG + Intergenic
919745909 1:201009047-201009069 AAGCAGCAGGGGAACCGGGCTGG - Intronic
920024033 1:202978896-202978918 CAAAATAAGGGGTAGTGGGCAGG - Intergenic
920063269 1:203244069-203244091 AAGAAGAAGGGGAGGAAGGAGGG + Intronic
920077856 1:203350178-203350200 AAGAAGAGGCTGAAGTGGGCAGG - Intronic
920106301 1:203555912-203555934 GAGAGGAGGGGGCAGTGGGCTGG + Intergenic
920311977 1:205053959-205053981 AAGGAGAGGGTGAAGAGGGCAGG + Intronic
920336487 1:205248700-205248722 AAGAAGAGGGAGAAGAGGGTGGG - Intronic
920706429 1:208254171-208254193 AAGATGAAGGTGAAGTGCCCCGG - Intergenic
920832994 1:209481976-209481998 AAGAAGATGGGGATTTGGGGTGG + Intergenic
921052386 1:211520133-211520155 AAGAACAAGGGGAATTGGCTGGG + Intergenic
921252814 1:213313392-213313414 AAGGAGTAGGGGAGGTGGGGAGG - Intergenic
921261547 1:213388933-213388955 AGGATGAAGGGGAAGGGGACTGG + Intergenic
921434776 1:215105728-215105750 AAGAAGGAAGGGAGGAGGGCAGG - Intronic
921756667 1:218864683-218864705 AGGAAGAAAGGGAAGGGGGAAGG - Intergenic
922531309 1:226347346-226347368 AAGAAAGAGGGCAAGGGGGCTGG + Intergenic
922546239 1:226459364-226459386 AAGAAGAAGGTGAGATGAGCTGG + Intergenic
922574912 1:226655054-226655076 AGGAAGAAGAGGAGGTGGGGAGG + Intronic
922720838 1:227899479-227899501 AAGAAGAGGGGACAGAGGGCAGG - Intergenic
922919528 1:229290339-229290361 AAGAGGTAGGGGAGGTGGGTTGG - Intronic
922975416 1:229779728-229779750 AAGGAGAAGGTGAAGTGGTGGGG + Intergenic
923072421 1:230577853-230577875 AAGAAGGAGGGGAAGGGGAAGGG - Intergenic
923072431 1:230577877-230577899 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
923072434 1:230577883-230577905 AAGAAGAAGGAGAAGGGGAAGGG - Intergenic
923092363 1:230750237-230750259 ATGAAGAAGGGACAGAGGGCTGG - Intronic
923332967 1:232942622-232942644 AAGAAGAGAGGGAAGGAGGCAGG + Intergenic
923432483 1:233936652-233936674 AAGAAGAAGGGGAAGAAAGGAGG - Intronic
924161497 1:241237679-241237701 AAGAAGAAAGGGGCGTGGCCAGG + Intronic
924489151 1:244518089-244518111 AAGGAGAAGGGGAATTGAGTTGG - Intronic
924554745 1:245108796-245108818 AGGAAGGAGGGGATGAGGGCTGG - Intronic
924583602 1:245342719-245342741 AAGAAGAAGGGGAGGGAGGGAGG + Intronic
924761397 1:246990132-246990154 AAGGAGAAGGGGAAGGAGGGAGG + Intronic
1062767175 10:74702-74724 AAGGAGAAGGGGAAGGGAGAAGG + Intergenic
1063057224 10:2518964-2518986 AAGAAGAAGAAGAAGGGGGGGGG + Intergenic
1063130477 10:3173093-3173115 GATAGGAGGGGGAAGTGGGCAGG + Intergenic
1063207576 10:3849122-3849144 AAGGGGAAGGGGAAGGGGGAGGG - Intergenic
1063348057 10:5329623-5329645 TAGAGGAAGGGGAAGGGGGTTGG - Intergenic
1063447340 10:6127642-6127664 AAACAGAAGAGGAGGTGGGCAGG + Intergenic
1063641676 10:7836568-7836590 AAGAAAATGTGGAAATGGGCCGG - Intronic
1063790978 10:9447521-9447543 GAGAGGAAGGGGAAGGGGGAAGG - Intergenic
1063857924 10:10275594-10275616 AAGAACAAGGGGAAGGGGGAAGG - Intergenic
1064029966 10:11877434-11877456 AAGAGGAAAGGGAGGTGGGGGGG + Intergenic
1064119622 10:12607223-12607245 AAGAAGAAAGGGAGGGAGGCCGG - Intronic
1064322043 10:14314473-14314495 AAAAATAAGGGGAAGTGTTCTGG + Intronic
1064360618 10:14661076-14661098 AAGGTGAAGGGGAAGTAGGCAGG - Intronic
1064709901 10:18112326-18112348 TAGCGGAAGGGAAAGTGGGCAGG - Intergenic
1065064693 10:21949391-21949413 AAGAAGAAGGGGGTGGGGGGAGG - Intronic
1065145228 10:22761910-22761932 ATGAAGAGGGGGAGGTGGGCAGG + Intergenic
1065170469 10:23022460-23022482 AAGAAGAAGGTGAACTGGCTGGG + Intronic
1065800951 10:29351841-29351863 AAGAAGAAGGTCAAGTGTGGTGG - Intergenic
1066675154 10:37880013-37880035 AAAAAGAAGGTAAAGTGGCCGGG - Intergenic
1067531547 10:47077837-47077859 AAGAAGAATGCGAATTTGGCGGG + Intergenic
1067541936 10:47161122-47161144 AAGAAGAAGAGGAGGGGGCCGGG - Intergenic
1069230960 10:66007854-66007876 AGGAAGGAGGGGAAGTAGGAAGG - Intronic
1070025231 10:72625942-72625964 AAGGCGAAGGGGAAGGGGGTTGG - Intronic
1070037182 10:72737814-72737836 CAGAAAAAGGGGAAATAGGCTGG - Intronic
1070360171 10:75680664-75680686 ACGAGGAAGGGGAAGTAGGTAGG + Intronic
1070541679 10:77419890-77419912 AAGAAGAAAGTGAAGAGGTCAGG + Intronic
1070696468 10:78567503-78567525 AAGGAGAAAGGGAAGTGGAGGGG + Intergenic
1070833682 10:79435292-79435314 AAGAGGAAGGGGAAGTTTGGTGG + Intronic
1071021471 10:81061952-81061974 AAGAAGAACTGGTAGTGGGATGG - Intergenic
1071275760 10:84053563-84053585 AGGAAGAAGGGGCAGCAGGCTGG + Intergenic
1071290082 10:84182225-84182247 AAGGAGGAGGTGAAGAGGGCTGG + Intronic
1071519026 10:86317573-86317595 AGGAAGAAGAAGAGGTGGGCAGG + Intronic
1072112512 10:92336640-92336662 AAGAAGAAGAGGAAGGGGCATGG + Intronic
1072180821 10:92978111-92978133 AAGAAAAAAGAAAAGTGGGCTGG + Intronic
1072317075 10:94213532-94213554 AAGCAGAAGAGGAAGAGGTCTGG - Intronic
1072494277 10:95940142-95940164 AAGAAGAAAGAGAAGAGGGGAGG + Intergenic
1072511259 10:96128358-96128380 AAAAAAAAGTGGAAGTGGGGTGG - Intergenic
1072784701 10:98271779-98271801 ATGAAGTTGGGGAAGTGGGGAGG + Intergenic
1072841355 10:98777750-98777772 AAGAAGAAGGACAAGGAGGCAGG - Intronic
1073186763 10:101619669-101619691 AAAAAGAAGAGGAAGGGGGAAGG + Intronic
1073265517 10:102226135-102226157 AAAAGGCTGGGGAAGTGGGCGGG + Intergenic
1073453736 10:103624191-103624213 GGGAAGAAGGGGATGTGGGGAGG + Intronic
1073592120 10:104767605-104767627 AAGGAAAAGGGGAAGGGGGAAGG - Intronic
1074139515 10:110659734-110659756 AAGAAGAAGAGGAAGAGGAAAGG - Intronic
1074139526 10:110659794-110659816 AAGAGGAAGGGGAAGGGGAACGG - Intronic
1074376340 10:112943893-112943915 AAGGAGAATGGGAAGTGGTGGGG + Intergenic
1074429020 10:113377299-113377321 AATAAGATGGGGTAGTGGTCTGG + Intergenic
1074487393 10:113899107-113899129 AAGAGGAAGGGGCAGCGGGTTGG - Intronic
1074491238 10:113941532-113941554 AAGAAGCAGGAGAAATGGGCTGG - Intergenic
1074495394 10:113975820-113975842 AGGAAGTAGGGGAAGGGGGAAGG + Intergenic
1074685861 10:115961987-115962009 AAGGAGAGGGGCAAGGGGGCAGG - Intergenic
1074704083 10:116116009-116116031 GTGAAGAAGAGGAGGTGGGCGGG - Intronic
1074890848 10:117735562-117735584 AAGTACAAGGGGAAGTGGTCAGG - Intergenic
1074924447 10:118053184-118053206 GAGAAGAAGGGGAAGGGGAAGGG - Intergenic
1075051490 10:119185626-119185648 AAGGTGAAGGGGAAGATGGCAGG + Intergenic
1075339198 10:121632108-121632130 AAGAAGAAGGCCAGGTGGGATGG + Intergenic
1075344913 10:121674874-121674896 AAGAAGAACGGGAAGGAGACTGG - Intergenic
1075456250 10:122586878-122586900 AAGAAGATGGGGAGGTGGCCTGG + Intronic
1076318879 10:129564217-129564239 AAGAGGAGGGGGAAGGGGGAAGG - Intronic
1076331462 10:129673348-129673370 AGGAAGATGGGGAGGTGGGCAGG - Intronic
1077705425 11:4480707-4480729 AAGATGAAGGGGAAGCAAGCAGG - Intergenic
1078259175 11:9688545-9688567 ATAAGGAAGGTGAAGTGGGCTGG + Intronic
1078631230 11:13006577-13006599 GAGAAGCTGGAGAAGTGGGCTGG + Intergenic
1079571791 11:21952547-21952569 AAGAAGAAGGAAGAGTGGGAAGG + Intergenic
1079718650 11:23782989-23783011 AAGGTGAAGGGGAAGCTGGCAGG + Intergenic
1079923411 11:26460411-26460433 AAGAAGAAAGGGGGGGGGGCGGG + Intronic
1080007956 11:27429504-27429526 AACAGGAAGGGGAGGTGGGGAGG + Intronic
1080055563 11:27902904-27902926 TAGAAGAAGGGGAGGTGGCAAGG + Intergenic
1080142972 11:28944501-28944523 AATAAAAAGGGGACATGGGCTGG + Intergenic
1080384367 11:31802534-31802556 AAGGAGAGGGGAAAGTGGGAAGG + Intronic
1080397454 11:31903082-31903104 AACCAGCAGGGGAAGAGGGCAGG + Intronic
1080521449 11:33071016-33071038 AAGAAGAAGGGTGATAGGGCTGG + Intronic
1081155472 11:39684415-39684437 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
1081226593 11:40531282-40531304 ATGAAGGAGGTGAAATGGGCAGG - Intronic
1081237598 11:40664246-40664268 AAGAAAAAGAGAATGTGGGCTGG + Intronic
1081443855 11:43110390-43110412 AAGAAAAAGAAAAAGTGGGCAGG + Intergenic
1081558716 11:44192214-44192236 AAGAAGAAGCAGGAGAGGGCTGG - Intronic
1081878541 11:46428175-46428197 AAGAAGAAGGGGAATGGGGAGGG + Intronic
1081885987 11:46496813-46496835 AAAAAAAAAGGGAAGGGGGCTGG + Intronic
1081969580 11:47188316-47188338 AAAGAGAAGGGGATGTGGACTGG + Intergenic
1082013884 11:47469898-47469920 GAGAAGAAGGGGATGTGGGAAGG + Intronic
1082037189 11:47654476-47654498 AAGAACAAAGGAAAGAGGGCGGG + Intergenic
1082196797 11:49316251-49316273 AAGGAGAAGGGGAAGGGGTAAGG + Intergenic
1082672225 11:56047629-56047651 AAGAAGAAAGAGAGGGGGGCAGG - Intergenic
1083068660 11:59952630-59952652 CAGAAGAGGGGGAAGTTGGGAGG + Intergenic
1083351895 11:62035572-62035594 AAGAAGGAGGGAAAGAGGGAGGG - Intergenic
1083367205 11:62148546-62148568 AAGAAGAAGGTGAGGGGAGCTGG + Exonic
1083406525 11:62461129-62461151 AAAAAAAAGGGGAATTTGGCCGG - Intronic
1083479377 11:62933882-62933904 AAGGAGAGGAGGAAGAGGGCTGG - Intergenic
1083975438 11:66115776-66115798 AAAAAGAAGGGGAGGAGGGAAGG - Intronic
1084148060 11:67275471-67275493 AGGAAGAAGGGGAAGGGGGTGGG - Intronic
1084379341 11:68801110-68801132 AAAAAAAAGGGGGAGGGGGCAGG + Intronic
1084953577 11:72679736-72679758 ATGAAGAGGGGGAAGTAGTCCGG - Intergenic
1085502648 11:77037953-77037975 AAGAAGAAGAGGAGGGGGGAAGG + Intronic
1085745146 11:79108853-79108875 AAGCAGACAGGGAACTGGGCAGG - Intronic
1086079574 11:82889397-82889419 AAGAAGAAGGAGAAGGAGGAGGG + Intronic
1086318955 11:85624861-85624883 AAGAAGAAAGGGAAGGAGGGAGG + Intronic
1086609023 11:88731206-88731228 ATGAAGCTGGAGAAGTGGGCAGG - Intronic
1086659027 11:89391934-89391956 AAGGAGAAGGGGAAGGGGAAGGG - Intronic
1086872227 11:92052095-92052117 ACGAAGAAGAGGAAGTGGAGAGG + Intergenic
1087087041 11:94230459-94230481 AGGAGGAAAGGGAAATGGGCTGG - Intergenic
1087249695 11:95883721-95883743 AAGCAGAATGGAAAATGGGCTGG - Intronic
1087487170 11:98770779-98770801 AAGAGGGAGGGGAAGGGGGAGGG + Intergenic
1087707092 11:101505716-101505738 GATAAGAAGGGAAAGTGAGCCGG + Intronic
1087752289 11:102020095-102020117 AAGAAGAAGAAGAAGAGGCCAGG + Intergenic
1088087764 11:106002088-106002110 AATGAGAAGGTGAAATGGGCCGG + Intronic
1088339318 11:108745103-108745125 AAGAGGAAGGGGAAGGGGAGGGG - Intronic
1088758870 11:112910534-112910556 AAGGTAAAGGGGAAGTGGGAGGG - Intergenic
1088818228 11:113435636-113435658 AGGAGGAAGGGAAAGTGGGGGGG - Intronic
1089028605 11:115298376-115298398 AAGAAGAAAGGGAAGGAGGCAGG + Intronic
1089179215 11:116569418-116569440 AGGAAGATGGGCAATTGGGCAGG + Intergenic
1089196263 11:116695605-116695627 AGGGAGGAGGGGAAGAGGGCAGG - Intergenic
1089225991 11:116922489-116922511 AAAAAGAAGGGGGAAGGGGCGGG + Intronic
1089321587 11:117630180-117630202 AAGAAGAAGGGGCACTGGAATGG - Intronic
1089407081 11:118206694-118206716 CAGAAGCAGGGGAAGTCGGGAGG - Intronic
1089625038 11:119745812-119745834 AGGATGAAGGGGAGGTGGGCAGG + Intergenic
1089652307 11:119922268-119922290 TAGTAGAAGGGAAAGTGGACAGG - Intergenic
1089665357 11:120014476-120014498 AAGAGGCAGGGGAGGTAGGCGGG - Intergenic
1089715216 11:120352928-120352950 AAGAAGAAGGGGAATGGGCTGGG - Intronic
1089726544 11:120485588-120485610 AAGAAGAGGAGGAAGTGAGACGG + Exonic
1089784969 11:120901247-120901269 GAGGAGAAGGCGAGGTGGGCTGG - Intronic
1090148904 11:124360210-124360232 AGAAAGAAGGGGAAGAGGGAGGG + Intergenic
1090728026 11:129545024-129545046 AAGAACAAGGGGGAGATGGCAGG + Intergenic
1090744218 11:129693709-129693731 AAGAGGAAGGGGAAGGGGAAGGG + Intergenic
1090960309 11:131550549-131550571 AAGGCGAAGGGGAAGAAGGCAGG - Intronic
1091144500 11:133265822-133265844 AAACAGAAGGGGAAATGTGCCGG + Intronic
1091656524 12:2350565-2350587 AAACAGAAGAGGAAGTGTGCTGG + Intronic
1091694521 12:2618756-2618778 AGAAGGAAGGGGAAGTGGGATGG + Intronic
1091718196 12:2794747-2794769 CAGGAGAAGGGGGAGGGGGCAGG + Intergenic
1091852393 12:3710496-3710518 AAGAAAGATGGGAAGTTGGCCGG + Intronic
1091915720 12:4271013-4271035 AATCGGAAGGGGAAGTGGACAGG + Intergenic
1091974405 12:4812960-4812982 AAACAAAAGGGGAGGTGGGCAGG - Exonic
1092246905 12:6868757-6868779 AAGAAGAAGAGGGTGAGGGCTGG + Intronic
1092334292 12:7614991-7615013 AAGGAGAAGGGGAAGGGGAAGGG + Intergenic
1092739841 12:11616859-11616881 AAGGTGAAGGGGAAGCAGGCAGG + Intergenic
1092751679 12:11725048-11725070 AAGCTGATGGGGAAGTGGGCAGG - Intronic
1092764713 12:11842100-11842122 AAGAAGAAGGAGATGTAGGCTGG + Intronic
1092788569 12:12051939-12051961 AAGAAGAAGTGGAATTGAGTTGG + Intronic
1092861847 12:12725334-12725356 AAGAAGGAGGGGGTGGGGGCGGG - Intergenic
1093052499 12:14519322-14519344 TATAAGAAGAGGAAGTGAGCCGG + Intronic
1093394968 12:18669962-18669984 TATAAGAAGAGGAAGAGGGCCGG - Intergenic
1093459228 12:19393277-19393299 AAGGGGAAGGGGAAGGGGGAAGG + Intergenic
1093501848 12:19822445-19822467 AAAATGAAGAGGAAGAGGGCTGG - Intergenic
1093561987 12:20552565-20552587 AAGTGGAAGCGGAAGTCGGCAGG + Intronic
1093591526 12:20907467-20907489 AAGAGGAAGGGGAAGGGGAAGGG - Intronic
1094155819 12:27335808-27335830 AAGGAGAAGGGGAGGAGGGGAGG + Intronic
1094197853 12:27767834-27767856 AAGAAGAGGGAGTAGTGGGAAGG + Intronic
1094202014 12:27804347-27804369 AAGAAGAAGAGGAAATAGGGTGG - Intergenic
1094203577 12:27817377-27817399 AAGAAGAAGGAGGGGAGGGCAGG - Intergenic
1094747229 12:33358865-33358887 AAGAGAAAGAGGAAGTGAGCTGG - Intergenic
1094772749 12:33684479-33684501 AGGGAGAAGGGGAAGGGGGAGGG - Intergenic
1095337594 12:41047576-41047598 GACAAGAAGGGGAAATGGGTGGG - Intronic
1095801541 12:46274191-46274213 ATTAAGAAGTAGAAGTGGGCCGG + Intergenic
1095954809 12:47799874-47799896 CTGGAGAAGGGGAAGTGGGTGGG + Intronic
1096001048 12:48130956-48130978 AAGGAGAAGGGGAAGTTGGTGGG - Intronic
1096218825 12:49814610-49814632 AAGAAGAGGTGGAAGAGGGGTGG - Intronic
1096528419 12:52228133-52228155 AAGAAGAAGGAGGAGGGGGAGGG - Intergenic
1096543073 12:52319141-52319163 AAGAAGAAGTGAGTGTGGGCAGG - Exonic
1096584529 12:52611190-52611212 AAGAAGCAGGTGAAGGGGACTGG - Exonic
1096691421 12:53324465-53324487 CCTGAGAAGGGGAAGTGGGCAGG + Intronic
1096813386 12:54185888-54185910 AAGAAGAAAGGGAAGAGAGAAGG + Intronic
1096816740 12:54206434-54206456 AAGAAGCAGAGGAGGTGGGGAGG + Intergenic
1096862511 12:54539996-54540018 GAGGAGAAGGGGGACTGGGCTGG + Intronic
1096875237 12:54624881-54624903 AAGGAGAAGGGGAAGAGGAAGGG - Intergenic
1096881768 12:54678835-54678857 GAGAAGTAGGGGAAATGGGTAGG + Intergenic
1097644520 12:62220809-62220831 AAGAAAGAAGGGAAGGGGGCCGG + Intronic
1097655426 12:62355969-62355991 AAGAAAAAGGGGGTGGGGGCAGG - Intronic
1097865569 12:64556820-64556842 AAAAAAAAGGGGTAGGGGGCAGG - Intergenic
1097923651 12:65104718-65104740 AAGAAGAAGAGGTGGTGGGGTGG - Intronic
1097941175 12:65307465-65307487 GGGAAGCAGGGGAAGTGGTCAGG + Intronic
1097987434 12:65798758-65798780 AAGAAGGAGAGAAAGGGGGCAGG + Intergenic
1098416452 12:70240622-70240644 GGGAAGATGGAGAAGTGGGCAGG + Intergenic
1098495882 12:71135285-71135307 AAGAAGAAGGAGGAGGGGGAGGG + Intronic
1098701310 12:73631187-73631209 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1098873618 12:75844042-75844064 AAGATGAAGGGAAAGTGAGGGGG + Intergenic
1099146773 12:79056228-79056250 AAGAGGAAGGGAAAGTGTGAGGG + Intronic
1099540961 12:83907221-83907243 AAGAAGGGTGGGAAGTGGGAGGG + Intergenic
1099764101 12:86960548-86960570 AAGGAGAGGGAGAAGTGGGAAGG - Intergenic
1100046654 12:90390181-90390203 ACTGAGAAGGGCAAGTGGGCAGG + Intergenic
1100273601 12:93049547-93049569 AAGAAGAAAGGGAAGGAGGGAGG - Intergenic
1100405318 12:94267834-94267856 AAAAAGAAGGGGAGGAGGGAAGG - Intronic
1100409177 12:94297568-94297590 AAAAAGAAGAGGAACTGGGTAGG - Intronic
1100700240 12:97139656-97139678 AAGATGAAGGGGAAGAAAGCAGG - Intergenic
1100779407 12:98008033-98008055 AAGAGGAAGGGGAAGGGGAAGGG + Intergenic
1100811138 12:98339500-98339522 AAGAAGAGGTGGAGGTGTGCAGG - Intergenic
1101746714 12:107547204-107547226 GAGAAGAAGGAGAAGGGGGAGGG + Intronic
1101746718 12:107547210-107547232 AAGGAGAAGGGGGAGGGGGAGGG + Intronic
1101861882 12:108489146-108489168 AAGGAGAAGGGAAAGAGGGAAGG + Intergenic
1102029665 12:109732670-109732692 CAGAAGGAGGGGAGGTGGGTGGG + Intronic
1102045245 12:109825774-109825796 CAGAGGAGGGGGAAGAGGGCAGG + Intronic
1102159575 12:110757571-110757593 CAGAAAAATGGGAAGGGGGCTGG - Intergenic
1102166744 12:110812994-110813016 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
1102167957 12:110821025-110821047 AAGAAGAAGGTGGAGGGGGAGGG - Intergenic
1102223095 12:111208034-111208056 AAGGAGAAGGGGAAGTGGGAGGG + Intronic
1102226873 12:111235013-111235035 CAGAAAGAGAGGAAGTGGGCTGG - Intronic
1102404091 12:112657778-112657800 ATGAAATAGGGGAAGTGGGTAGG + Intronic
1102536757 12:113587685-113587707 AAGGAGTGGGGGAAGTGGGAAGG - Intergenic
1102542652 12:113633762-113633784 AAGGAGAAGGGATATTGGGCAGG + Intergenic
1102777677 12:115534823-115534845 AAGAAAAAGGAGGAGTAGGCAGG + Intergenic
1102790687 12:115642743-115642765 AAGAGGAAAGAGAAGTGTGCAGG - Intergenic
1102808084 12:115799659-115799681 AAGAAGAAGGGGGGGTTGGGGGG + Intergenic
1103013362 12:117475106-117475128 AAGAAGGAGAGGATGGGGGCCGG - Intronic
1103244781 12:119447308-119447330 CAGTACAAGGGGAAGTGGGAGGG - Intronic
1103371572 12:120423323-120423345 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
1103568000 12:121826761-121826783 AAGAATATGAGGAAGTGGGATGG + Intronic
1103587390 12:121966252-121966274 AAGAAGAAGGGGAGGGGGAGGGG - Intronic
1103719060 12:122963856-122963878 AAGGGCAAGGGGAAGTGGGTAGG + Intronic
1103782405 12:123407725-123407747 TTGAAGAAGGGAAAGTGGGGCGG - Exonic
1103940725 12:124499916-124499938 ACAGAGAAGGGGAAATGGGCAGG + Intronic
1104623745 12:130337419-130337441 AAGCAGAAGAGGAACAGGGCGGG + Intergenic
1104768539 12:131345965-131345987 GAGAAGAAGGGCAAGGTGGCAGG + Intergenic
1104948742 12:132429275-132429297 GTGAAAATGGGGAAGTGGGCGGG - Intergenic
1105217691 13:18298755-18298777 TTGAAGAAGGGAAAGTGGGGCGG - Intergenic
1105537976 13:21287623-21287645 AAGAAGAAGAGGTAATGGGCCGG - Intergenic
1105611806 13:21975395-21975417 AAAAAGAAAGGGAAGCGGGGAGG - Intergenic
1105977212 13:25482582-25482604 AAGAAGAAGGTGATGTGGTTTGG + Intronic
1106021542 13:25920459-25920481 AGGCAGAGGAGGAAGTGGGCAGG - Intronic
1106154642 13:27142797-27142819 AAAAAGAAGTGGAAGAGGCCAGG + Intronic
1106176073 13:27333033-27333055 AAGAAGAAGAAGAAGAAGGCTGG + Intergenic
1106771511 13:32965278-32965300 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
1107184594 13:37504162-37504184 AAGAAGAAAGGCCAGTGGGCTGG - Intergenic
1107379941 13:39845813-39845835 AAGAAGAAGGGGAGAGGGCCAGG - Intergenic
1107417656 13:40216432-40216454 AAGATGAATGGCAAGGGGGCTGG - Intergenic
1107435127 13:40375119-40375141 AAGAAGAGGGGAAATCGGGCTGG - Intergenic
1107459436 13:40587278-40587300 AAAAAAAAGTGGGAGTGGGCAGG + Intronic
1107678009 13:42816935-42816957 AGGAAGAAGGAACAGTGGGCAGG + Intergenic
1107795451 13:44046897-44046919 AAGGAGAAGGGGAAGGGGAAAGG - Intergenic
1107795460 13:44046921-44046943 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
1108411194 13:50148901-50148923 AAGAAGAAAGGAAGGTGGGAAGG - Intronic
1109053676 13:57518107-57518129 AAAAAGGAAGGAAAGTGGGCTGG + Intergenic
1109507775 13:63329121-63329143 AAGCAGAAGGGTAAGTGTCCTGG - Intergenic
1109642584 13:65209770-65209792 AAGGCAAAGGGGAAGTAGGCTGG + Intergenic
1110703691 13:78579872-78579894 AAGCAGAAAAGGAAGTGGGGAGG + Intergenic
1110810457 13:79806700-79806722 AAGAGAATGGGGGAGTGGGCCGG - Intergenic
1111353787 13:87070306-87070328 AAGGGGAAGGGGAAGTGGAAGGG - Intergenic
1111926950 13:94473758-94473780 GAAAAGAATGGGAAGTGGGGGGG + Intronic
1113027045 13:105952408-105952430 AAGAGGAAGTGGAAGTGAGTGGG - Intergenic
1113262570 13:108581588-108581610 ACAAAGTAGGGGAAGTGGACAGG + Intergenic
1113375180 13:109758883-109758905 AAGAGGAAGGGGAAGAGGAAGGG + Intronic
1113647861 13:112011640-112011662 AAAAAGAAGGAGAAGAGGCCGGG - Intergenic
1113680671 13:112242151-112242173 AAGAGGAAGGGAAAGAGGGAAGG + Intergenic
1114201235 14:20522612-20522634 GAGGAGAAGGGGAAGTGGAAGGG + Intergenic
1114224585 14:20725956-20725978 AAGAGGAAGGGGAAGGGGAAGGG + Intergenic
1114276865 14:21154610-21154632 AGGAAGAAAGGGAGGTGGGGAGG + Intergenic
1114294167 14:21314454-21314476 AAAAAGAACTGGAAGTGGCCTGG + Intronic
1114320656 14:21544583-21544605 AAAAAGAAGAGGAACAGGGCGGG + Intergenic
1114525392 14:23364777-23364799 AAGGAGAATGGGGAGGGGGCGGG + Intronic
1114666046 14:24377752-24377774 AGGAAGGAGGGAAAGGGGGCAGG - Exonic
1115298874 14:31861565-31861587 AAGAAGGAGGAGAAGAGGGCAGG - Intergenic
1115529359 14:34312796-34312818 AAGGAGAAGGGGAAGGGGAAGGG - Intronic
1117383892 14:55192264-55192286 AAAAAAAAGGGGAGGGGGGCTGG - Intergenic
1117772722 14:59151091-59151113 ACAAGGATGGGGAAGTGGGCAGG + Intergenic
1118171909 14:63396084-63396106 GAGGAGAAGGGGGAGGGGGCAGG + Intronic
1118303168 14:64633207-64633229 TATAAAAAGGGGAAGTCGGCCGG - Intergenic
1118304946 14:64647994-64648016 AAGCAGAAGAGGAGGTAGGCCGG + Intergenic
1118411123 14:65479541-65479563 AAGAAGAAAGGGAAGGAGGGAGG - Intronic
1118620427 14:67609785-67609807 GAGAAGAAGGGGAAGGGGGTGGG + Intergenic
1118768434 14:68925682-68925704 GACAAGAAGGGCAAGTGGTCAGG + Intronic
1119067395 14:71542615-71542637 AAGAAGAAGGGGAGGAGGAGGGG - Intronic
1119192331 14:72691430-72691452 TACAAGAAGAGGAAATGGGCTGG + Intronic
1119714007 14:76845350-76845372 AAGAAGAAGGGGAAGGGAAGGGG + Intronic
1120050779 14:79862966-79862988 AAGAGGAAGGGGAGGTGGGCTGG + Intronic
1120191657 14:81445534-81445556 AAGAAGAAAGTGATCTGGGCTGG + Intergenic
1120255019 14:82107459-82107481 AAGAGAGAGGGGAAGGGGGCTGG + Intergenic
1120281453 14:82443663-82443685 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
1120371082 14:83636822-83636844 AAGGAGAAGGTGATGTGTGCAGG - Intergenic
1120510783 14:85411789-85411811 AAGAAGAAGGAAATGTTGGCAGG + Intergenic
1120525368 14:85570879-85570901 AAAAATAAGGGGAATTTGGCCGG - Intronic
1120718213 14:87863024-87863046 AAGAAGGAGGGGAACAGGGAAGG + Intronic
1121219017 14:92271931-92271953 AGGAAGAATGGGAAATGGGACGG - Intergenic
1121535496 14:94687800-94687822 AAAAAGAGGGGGAAGGTGGCAGG - Intergenic
1121577518 14:95000458-95000480 AAGGCGAAGGGGAAGCAGGCAGG + Intergenic
1122204627 14:100142420-100142442 GAGGAAAAGGGGGAGTGGGCAGG + Intronic
1122419355 14:101565290-101565312 AAGATGAAGGGGAAGCAGGGAGG - Intergenic
1122448125 14:101782860-101782882 AAGAGGGAGGGGAAGGGGGGAGG - Intronic
1122640096 14:103154788-103154810 AAGGGGAAGGGGAAGGTGGCAGG + Intergenic
1122647930 14:103207379-103207401 AGGAGGAAGGGGAAGGGGCCTGG - Intergenic
1122813814 14:104302388-104302410 AGGAAGAAAGGGATGTGGGGAGG - Intergenic
1202841430 14_GL000009v2_random:124825-124847 AGGAAAATGGCGAAGTGGGCGGG + Intergenic
1202910818 14_GL000194v1_random:115056-115078 AGGAAAATGGCGAAGTGGGCGGG + Intergenic
1124196427 15:27634652-27634674 AAGAAAAAGAGGAAGAGGACAGG - Intergenic
1124529780 15:30495548-30495570 AAGAGGAAGGTGAATTGGTCGGG + Intergenic
1124716153 15:32064249-32064271 AAGAAGAAGGGGAAGGGAAAGGG - Intronic
1124768879 15:32512140-32512162 AAGAGGAAGGTGAATTGGTCGGG - Intergenic
1125016641 15:34944391-34944413 AAAAAGAATGGGAAGTGGTCTGG + Exonic
1125263641 15:37854743-37854765 AAGGCAAAGGGGGAGTGGGCAGG - Intergenic
1125428670 15:39575183-39575205 CAGAAGAAGAGAATGTGGGCTGG - Intergenic
1125532724 15:40424108-40424130 AAGAAGGAAGGCAAGTTGGCAGG - Intronic
1125937085 15:43646692-43646714 AAGAAAAAGAGGAAGTGGGTAGG - Intronic
1125949937 15:43743792-43743814 AAGAAAAAGAGGAAGTGGGTAGG - Intergenic
1126386303 15:48096908-48096930 ATGAAGAAGGGGAAGAGAGGAGG - Intergenic
1126592960 15:50357958-50357980 AATAAGAAGGTGAAGTGCACTGG + Intergenic
1126851125 15:52797933-52797955 AATAAAAACGGGAAGGGGGCAGG + Intergenic
1126852167 15:52804144-52804166 AAGAAGTAGGGGCGGTAGGCCGG - Intergenic
1127446393 15:59067355-59067377 AGGAAGAAGGGGAAGGGGAAGGG - Intronic
1127719159 15:61682968-61682990 AAGAGGAAGGAGGAGTGGGCAGG + Intergenic
1127856917 15:62960841-62960863 AAGAGGGAGGGGAAGAGGGAGGG + Intergenic
1127918186 15:63472485-63472507 TAGAAGGTGGGGAAGTGGGCTGG + Intergenic
1127973018 15:63977101-63977123 AAAGAGAAGGGGAAGGGGGAAGG + Intronic
1128139808 15:65291236-65291258 AAGAAGAAGAGAAAATAGGCTGG - Intronic
1128891045 15:71332025-71332047 AAGAAGAAGGGGCAGTTGTAGGG + Intronic
1128903484 15:71446977-71446999 AAGAAGTCAGGGGAGTGGGCCGG + Intronic
1128975180 15:72147062-72147084 AAGAGGCAGGGAAAGTGGGAAGG - Intergenic
1129138182 15:73573016-73573038 AAGGTGAAGGGGAAGCAGGCAGG - Intronic
1129173274 15:73821058-73821080 AAGAGGAAGAGGAAGTGGGGAGG + Intergenic
1129230410 15:74194084-74194106 CTCGAGAAGGGGAAGTGGGCAGG - Intronic
1129767879 15:78181787-78181809 AACAAGAAGGGAAACTAGGCCGG - Intronic
1130009919 15:80143113-80143135 AAAAAGAAGGGAAAATGGCCAGG - Intergenic
1130668145 15:85886956-85886978 CAGTAGAAAGGGAAGTGGGTTGG + Intergenic
1131111009 15:89765560-89765582 AAGAGGAAGGGGAAGAGGAAAGG + Intronic
1131120723 15:89822037-89822059 AAGAAAAGGTGGAAGTGGGAGGG + Intergenic
1131199730 15:90386848-90386870 AAGAATAAACGGAAGAGGGCCGG + Intergenic
1131284832 15:91048179-91048201 AAGAAGGAGGGGGAGGGGGAGGG - Intergenic
1131379825 15:91954584-91954606 AAGAGGAAGTGGAAGTTGGTGGG + Intronic
1131379831 15:91954608-91954630 AAGAGGAAGTGGAAGTTGGCGGG + Intronic
1131465888 15:92654812-92654834 AAGAAGAAGAAAAAGTAGGCGGG + Intronic
1131836748 15:96398586-96398608 AAGAAGAATGGAAAGAGGGCAGG - Intergenic
1132707990 16:1254736-1254758 CAGAAGCAGAGGAGGTGGGCTGG + Intergenic
1132950616 16:2560345-2560367 GGGAGAAAGGGGAAGTGGGCCGG - Intronic
1132963733 16:2639825-2639847 GGGAGAAAGGGGAAGTGGGCCGG + Intergenic
1133172781 16:3992242-3992264 CAGGAGAAGGGAAGGTGGGCAGG - Exonic
1133696131 16:8264571-8264593 AAGAAGAAGTGGGAGTGGAGTGG + Intergenic
1133725162 16:8530600-8530622 AGGAAGAAGGGAAGGTGGGATGG + Intergenic
1133816313 16:9200010-9200032 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
1133928957 16:10216653-10216675 TAGAAGAAGGGGAAGGGGGAGGG + Intergenic
1133937009 16:10277624-10277646 AAGAAGAGGGGGAAGTAGGAGGG - Intergenic
1134065334 16:11224746-11224768 AAGGAGCAGGGGAAGGAGGCGGG - Intergenic
1134287181 16:12872035-12872057 AAGAAGAAGGAGGAGGGGGGAGG - Intergenic
1134352619 16:13451929-13451951 AAGGAGAAGGGGAAGGGAGAAGG + Intergenic
1134866337 16:17610695-17610717 AAGAAGAAAGGGAAGGAGGGAGG - Intergenic
1135470052 16:22722085-22722107 AAAAAGAAGGAAAAGTGGACTGG + Intergenic
1135505037 16:23029020-23029042 GAGAAGAAGGAGACCTGGGCAGG - Intergenic
1135506301 16:23039775-23039797 AAGTAGAAGGGGCAGGTGGCAGG + Intergenic
1135621431 16:23959275-23959297 AAGAAAAATGGAAAGTGGTCAGG - Intronic
1135646735 16:24169471-24169493 AAGAAGAAGGGGGACAGGGTAGG - Intronic
1135667936 16:24351583-24351605 AAGAGGAAGGGGAAGGGGAAGGG + Intronic
1135738269 16:24951090-24951112 AAAAAGACGAGGAGGTGGGCTGG + Intronic
1135801520 16:25501323-25501345 AAAAAAAAGGGGCAGTGGGGGGG + Intergenic
1135963429 16:27016463-27016485 AAGAAGAAGGGGAAGGGGAAGGG - Intergenic
1135976020 16:27109439-27109461 AGGAAGGAGGGGAAGTTGGAGGG + Intergenic
1136092300 16:27929225-27929247 CAGAAGAAGGGAGAATGGGCTGG - Intronic
1136099017 16:27979612-27979634 AGGAAGAAAGGGAGATGGGCAGG + Intronic
1136121486 16:28138594-28138616 AAGGAGAATGGGTATTGGGCAGG - Intronic
1136993274 16:35170190-35170212 AAGAAGGAGGAGTAGTCGGCGGG - Intergenic
1137557141 16:49477641-49477663 AAGAAGAAGGAGAAGAAGGAGGG + Intergenic
1137637008 16:49995714-49995736 AAGAAGAAGGCAAACTGGTCTGG + Intergenic
1137665793 16:50248222-50248244 AGGAAGAGGGAGAGGTGGGCGGG - Intronic
1138091940 16:54181987-54182009 AAGAAGAAGAAGAAGTTGGAGGG - Intergenic
1138378107 16:56580935-56580957 AAGAAGAAAGGAAAGAGGGAAGG - Intergenic
1138440275 16:57030128-57030150 AAGAGGAGGGGAAAGTGGGATGG + Intronic
1138517179 16:57542620-57542642 AGGAAGAAGGGGAAGTCGGGAGG - Intronic
1138579411 16:57930558-57930580 AAGGAGGAGGGGAAGGGGGAGGG + Intronic
1138991624 16:62397206-62397228 AAGAAGAAAGGAAAGAAGGCAGG + Intergenic
1139007743 16:62594033-62594055 AAGAAGAAAGGGAAGAGGCCGGG + Intergenic
1139060940 16:63250684-63250706 AAGAAGAAGGGGAAGGCGGAGGG + Intergenic
1139066777 16:63325404-63325426 GAGGAGGAGGGGAAGTTGGCAGG + Intergenic
1139210078 16:65068208-65068230 AAGAGGAAGGGAAAGAGGGAAGG + Intronic
1139354227 16:66357761-66357783 AGGAAGGAGGGGAAGTGGAAAGG + Intergenic
1139542150 16:67626141-67626163 AAGAATCAGGAGAAATGGGCTGG + Intronic
1139636942 16:68263865-68263887 CAGAGGGAGGGGAAGGGGGCAGG + Intergenic
1139640050 16:68285065-68285087 AAAAAGAAGCAGAAGTGGGAGGG - Intronic
1139851590 16:69953828-69953850 AAAAAGAAGAGGGAGGGGGCGGG + Intronic
1139880567 16:70176735-70176757 AAAAAGAAGAGGGAGGGGGCGGG + Intronic
1139895976 16:70288403-70288425 ATCAAGAAGGGGAAGGCGGCCGG - Intronic
1139956929 16:70697612-70697634 ATGATGATGGGGGAGTGGGCAGG + Intronic
1140112546 16:72016312-72016334 AAGAGGAAGAGGAAGGGGACTGG + Intronic
1140371942 16:74418782-74418804 AAAAAGAAGAGGGAGGGGGCGGG - Intronic
1140516947 16:75550133-75550155 GAGAAGAAGGGGAAGCGGGTGGG + Intronic
1140655147 16:77132382-77132404 AAGAGGAAGGGGAAGGGGATGGG - Intergenic
1140903576 16:79392121-79392143 AAGAAGAGAGGGAACTGGGGAGG + Intergenic
1140980112 16:80100419-80100441 GAGAGGAAGGGGAAGTGGGAGGG + Intergenic
1141173221 16:81704189-81704211 AGGAAGGAGGGGGAGGGGGCAGG - Intronic
1141179708 16:81744152-81744174 AAAAAAAAAGGGAAGTTGGCTGG - Intronic
1141248307 16:82331555-82331577 ATGAAGAAGAGGAAGTGGGTTGG + Intergenic
1141310873 16:82912155-82912177 AAGAGGGAGGAGGAGTGGGCTGG - Intronic
1141463122 16:84190033-84190055 AAGAAGCAGGTGTGGTGGGCTGG - Intergenic
1141521605 16:84583830-84583852 AAGGAGAAGTGGAGGTGGGAAGG - Intronic
1141589047 16:85055600-85055622 ACCAAGAAGGGGAAGTGGTGAGG - Intronic
1141589953 16:85061807-85061829 AAGCAGTGGGGGAAGTGGGGCGG + Intronic
1142016465 16:87750821-87750843 AAGAACAACTGGAAGTGGGTGGG - Intronic
1142467064 17:142074-142096 GATAAGAAAGAGAAGTGGGCAGG + Intergenic
1142470552 17:161128-161150 AAGAAGAGGGAGGAGAGGGCAGG - Intronic
1142505028 17:357831-357853 AAGAGCTAGGGGAACTGGGCAGG - Intronic
1142781625 17:2185750-2185772 GAGAAGACGGGGACGAGGGCAGG + Intronic
1142816488 17:2430102-2430124 AAAAAAAGTGGGAAGTGGGCAGG - Intronic
1143381378 17:6498370-6498392 AGGAAGAGGGGAAAGTGGTCGGG + Intronic
1143386784 17:6535621-6535643 AAGAAAAAAAGGAAGTGGCCGGG + Intronic
1143514953 17:7414887-7414909 AAGGAGAGGGGGGAGTTGGCAGG - Intronic
1143570213 17:7753417-7753439 ATGACCAAGGGGGAGTGGGCTGG + Intronic
1143663874 17:8345091-8345113 AAGAAGAGGGAGAAGTGCCCAGG - Intronic
1143686770 17:8523653-8523675 AGGGAGAAGTGGAAGTGGGGAGG + Intronic
1143871312 17:9959018-9959040 CAGGAGAAGGGGAGGTGGGAGGG + Intronic
1144080933 17:11763172-11763194 AAGAAGAAGTGGGAGGGGGAGGG + Intronic
1144346555 17:14354785-14354807 GAGAGGAAGCAGAAGTGGGCAGG - Intergenic
1144354242 17:14428886-14428908 AACAAGAAGAGGAAGTGAGGGGG - Intergenic
1144712266 17:17409616-17409638 AGGAAGAAGGAGGAGTTGGCCGG - Intergenic
1144764961 17:17727574-17727596 AAGAGGAAGGGGAACTGTGGTGG - Intronic
1144780785 17:17807429-17807451 AACAAGAATTGGAAGGGGGCAGG - Intronic
1144899527 17:18571477-18571499 TATAAGAAGGGGAACTGGGTTGG + Intergenic
1145240319 17:21237126-21237148 TTGAAGAAGGAGATGTGGGCTGG - Intergenic
1145988574 17:29064199-29064221 AAGAGAATGGGGAAGTGGGCAGG + Intergenic
1145994310 17:29096752-29096774 AAGAAGCAGAGGAGGTGGGTGGG - Exonic
1146435990 17:32848323-32848345 AAGAATTAGGGGAAAGGGGCAGG + Intronic
1146571097 17:33954055-33954077 AAGAAGAAATGGATGTTGGCAGG - Intronic
1146637565 17:34517726-34517748 AAGCAGAGGAGTAAGTGGGCAGG - Intergenic
1146801500 17:35827408-35827430 AAGAAGAAGGGGCATGGGCCAGG + Intronic
1146804656 17:35855627-35855649 GAGAAGAGGAAGAAGTGGGCAGG + Intronic
1146804757 17:35856261-35856283 AAGGAGTAGGGGAAGTGGAAGGG + Intronic
1147327453 17:39676304-39676326 AAGGAGAAGAGGAAGGCGGCAGG + Intronic
1147358915 17:39919059-39919081 AAGAAGAAGGGGTTCTGGCCGGG - Intronic
1147602301 17:41754187-41754209 AAGGAAGAGGGGAGGTGGGCAGG + Intergenic
1147740170 17:42666805-42666827 AAGGAGAAGGAGTAGTGGGGAGG - Exonic
1147976894 17:44253048-44253070 AAGGGGAAGGGGAAGGGGCCGGG + Intronic
1148060784 17:44834900-44834922 AAGAAGTAAGGCCAGTGGGCTGG + Intergenic
1148335057 17:46835505-46835527 AAGAATAAGGGAGACTGGGCTGG - Intronic
1148489226 17:48012530-48012552 GAGCTGAAGGGGTAGTGGGCCGG - Intergenic
1148787441 17:50152209-50152231 AGGATGGAGGGGAAGAGGGCGGG - Intergenic
1148912875 17:50952508-50952530 AGGAAGAAAAGCAAGTGGGCTGG + Intergenic
1149195158 17:54110759-54110781 AAGGAGAAGGGGAAGAGGAAGGG + Intergenic
1149209519 17:54287649-54287671 AAGAAGAAAGGCAAGGGTGCAGG + Intergenic
1149213301 17:54327898-54327920 AAGAAGAAAGGCAAGGGTGCAGG - Intergenic
1149303983 17:55331143-55331165 AACAGGAAGCAGAAGTGGGCAGG - Intergenic
1149652101 17:58281885-58281907 AAGAAGAAAGGGGAGTGAGGAGG - Intergenic
1149891260 17:60392146-60392168 AGGAGGCAGGGGAAGGGGGCGGG - Intronic
1150037251 17:61816780-61816802 AGCAAAATGGGGAAGTGGGCGGG + Intronic
1150286011 17:63954554-63954576 AAGAAGAAGAGGAAGTGACTAGG - Intronic
1150384963 17:64751443-64751465 AAAAGGAAGTGGATGTGGGCAGG - Intergenic
1150453283 17:65287278-65287300 GAGAAGGAGGGGCAGAGGGCAGG + Intergenic
1150479415 17:65497814-65497836 GAGAGGAAGGGGATTTGGGCTGG + Intergenic
1150513024 17:65776229-65776251 AAAAAAAAGGGGATGGGGGCGGG - Intronic
1150576240 17:66433403-66433425 GAGCAGAAGAGGAAGTGGGAGGG - Intronic
1150609788 17:66724708-66724730 AAGCAGAAGAGTAAGTGTGCTGG - Intronic
1150739915 17:67771108-67771130 TTGAAGATGGTGAAGTGGGCTGG - Intergenic
1150979419 17:70124968-70124990 AAAAAGAAAGGAAAGTTGGCTGG + Intronic
1150983701 17:70171256-70171278 AGGAGGAGGGGGAAGTGGGGAGG - Intronic
1151216006 17:72576671-72576693 AAGGAGAAGGGGGAGTGGCGAGG + Intergenic
1151371946 17:73653224-73653246 AGGAAGAGGGGGAGGTGGGGTGG - Intergenic
1151430497 17:74059325-74059347 ATAAAGAAAGGGAAGGGGGCTGG + Intergenic
1151632813 17:75322495-75322517 AGGAAGAAGGTGAGGAGGGCTGG + Intronic
1152107231 17:78337756-78337778 AAGGAGAAGGGGAAGGTGACTGG - Intergenic
1152232796 17:79123058-79123080 AAGACGAGGGGGGTGTGGGCTGG + Intronic
1152350893 17:79783704-79783726 AAGATAAAGGAGAAGTTGGCTGG - Intronic
1152358281 17:79817055-79817077 AAGAAGAAGAGGAGGTGGATGGG - Intergenic
1152488123 17:80608999-80609021 AAGAAGAAGTCAGAGTGGGCAGG + Intronic
1152494945 17:80664471-80664493 GAGGAGAAGGAGAAGGGGGCAGG - Intronic
1152609221 17:81307449-81307471 AAGGGGAAGGGGAAGGGGGAGGG - Intergenic
1152609255 17:81307532-81307554 AAGGGGAAGGGGAAGGGGGACGG - Intergenic
1152609258 17:81307538-81307560 AAGAGGAAGGGGAAGGGGAAGGG - Intergenic
1153141532 18:1977969-1977991 AAGAGGAAGAGGAAGTGGAGGGG - Intergenic
1153218829 18:2845239-2845261 ATGAAGAAGAGGAAGAGGGGGGG - Intergenic
1153520912 18:5953174-5953196 CAGGAGAAGGGGAAGGGAGCTGG + Intergenic
1154126607 18:11697773-11697795 AAGAAGAAGAGGCAGTTGGAGGG + Intronic
1154197536 18:12277431-12277453 ATGAAGTGGGGGCAGTGGGCAGG + Intronic
1155197708 18:23490381-23490403 AGGAAGAAGGGGAAGAGTGAAGG - Intergenic
1155377555 18:25176968-25176990 AGGCAGAAGGAGAAGGGGGCTGG - Intronic
1155937242 18:31766590-31766612 AAGAAAAAGTGAAAGTAGGCCGG - Intergenic
1156276501 18:35588527-35588549 AAGAAGAGGAGAAAGAGGGCAGG - Intronic
1156387423 18:36618735-36618757 AAGAGGAAGGGGAGGTGGCAGGG - Intronic
1156508801 18:37617494-37617516 AACAAAAAGGGGAAGAGGGAAGG + Intergenic
1156721743 18:40078639-40078661 AAGAAGAAAGGAAAGAAGGCCGG + Intergenic
1156920270 18:42513887-42513909 TAGAGGAAGGGGAATTGAGCAGG - Intergenic
1157237605 18:45979188-45979210 AAGAAGAAGGAGAAGGGAGAGGG - Intergenic
1157270284 18:46269806-46269828 AAGAAGCAGAGAAAATGGGCAGG - Intergenic
1157335802 18:46736658-46736680 AGGAAGAATGGGGAGTTGGCAGG + Intronic
1158129015 18:54132316-54132338 AAGGTGAAGGGGGAGTAGGCAGG - Intergenic
1158672873 18:59492527-59492549 AAGGAGAAGGGGAAGGAGGGAGG - Intronic
1158860782 18:61590186-61590208 ATGAAGAAGGGGAGGGAGGCAGG - Intergenic
1159960865 18:74555042-74555064 GAGAACAAGGGGAACTAGGCTGG - Intronic
1159977877 18:74738441-74738463 AAAAAAAAGGAGAAGTTGGCCGG + Intronic
1160251850 18:77210150-77210172 AAGGATAAGGGGTAGGGGGCAGG - Intergenic
1160473038 18:79156248-79156270 AAGAGGAAAGAGAAATGGGCTGG - Intronic
1160821846 19:1062603-1062625 CAGAAGAGGAGCAAGTGGGCAGG - Intronic
1160975967 19:1792613-1792635 AAGAAAGCGGGGAAGAGGGCTGG + Intronic
1161306435 19:3571800-3571822 TTGAGGAAGAGGAAGTGGGCCGG + Intronic
1161557815 19:4954467-4954489 AAGTGGAAGCGGAAGTCGGCAGG + Exonic
1161586614 19:5109184-5109206 AAGAGGAAGGGGGAAAGGGCAGG - Intronic
1161662302 19:5554350-5554372 ATGAAGACGGGGAAGAGGTCTGG - Intergenic
1161914944 19:7221410-7221432 AAGAAGAAGAAGAAGAAGGCTGG + Intronic
1161957598 19:7505277-7505299 AAGAATAAGGTAAAGTGGGCTGG - Intronic
1162450817 19:10753410-10753432 AAGGGGAAAGGGAAGTGGGGGGG - Intronic
1162475261 19:10895889-10895911 AGGAAGCAGGGGAAGAGGGGAGG + Intronic
1162524511 19:11199599-11199621 AGGAGGAAGAGGATGTGGGCTGG - Intronic
1162535498 19:11261351-11261373 AAGAAGACAGGGAAGGGGGATGG - Intronic
1162846057 19:13393555-13393577 AAGAAGAAGGGGGGGAGGGAGGG - Intronic
1162914153 19:13865401-13865423 AAGAAGAGGGGGAAATGCGGCGG + Intronic
1162950036 19:14065839-14065861 AAGAAGAAGAAGAAGAAGGCTGG + Intergenic
1162969285 19:14170413-14170435 AAGAAGCAGGGTGAGTGGGCTGG + Intronic
1163172134 19:15539191-15539213 AAGGAGAAAGGGAAGTGCACGGG - Intronic
1163235663 19:16029099-16029121 AAGAAGAAGGGGAAGGGGAAGGG + Intergenic
1163478037 19:17538452-17538474 ATGAAGAAGGGGAATAGGTCAGG + Intronic
1163630652 19:18416615-18416637 AAGAAGAGGGGGATGATGGCAGG - Intergenic
1163673340 19:18642222-18642244 AAGAGGAAGGAGACGTGGGCAGG - Intronic
1163686650 19:18715654-18715676 GAGAAGCAGGGGAAGAGGGGAGG - Intronic
1163693647 19:18751225-18751247 AAGAAAATGGGGAAATGGGCTGG + Intronic
1163771257 19:19192583-19192605 AAGAAGTAGGGGAAGTACGCGGG - Exonic
1163958999 19:20669595-20669617 AAGATGAAGGGAAACTGGGAGGG + Intronic
1164441136 19:28281788-28281810 AGGAAGAAGGGAAAGAGGGTTGG - Intergenic
1164581719 19:29439028-29439050 AAGGAGAAGGGGAAGGAGGGAGG + Intergenic
1165197735 19:34118123-34118145 AAGAAGAAGGGGGAGGGGGAGGG + Intergenic
1165361105 19:35337582-35337604 AAGAAGTAGAGGAAGTGGGAGGG + Intronic
1165488127 19:36107713-36107735 AATAAGAAAGGCAAGTGGGCTGG + Intergenic
1165682442 19:37789471-37789493 AAGAAGAAGAAGAAGATGGCCGG + Intronic
1165895712 19:39139696-39139718 AAGGAGATTGGGGAGTGGGCAGG - Intronic
1165961784 19:39540773-39540795 AAGAAGAAGAGGAAGGGTTCTGG - Intergenic
1166008621 19:39925123-39925145 AAGAAGAAGAAGAAGAGGGAAGG + Intronic
1166231572 19:41427995-41428017 GAGAAGACGGGCAAGTGGGAAGG + Intronic
1166383098 19:42365310-42365332 AAGGAGATGGGGGAGTGGCCAGG + Intronic
1166552064 19:43672400-43672422 AAGAAGTAGGGCAGATGGGCAGG + Intergenic
1166623998 19:44333631-44333653 AAGAGGAAGAGAAAGAGGGCAGG - Intronic
1166674944 19:44734651-44734673 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
1167126423 19:47552316-47552338 CAGCAGAAGGGAAACTGGGCTGG + Intronic
1167435243 19:49475156-49475178 AAGAGGAGGGGGAGGTGGACAGG + Intronic
1167607888 19:50491269-50491291 AAGAAGACGGGGACGCGGGAGGG + Intergenic
1167679214 19:50909222-50909244 CAGAGGTAGGGGGAGTGGGCAGG - Intronic
1167702104 19:51054950-51054972 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
1167758901 19:51431028-51431050 AAGGTGAAGGGGAAGCAGGCAGG - Intergenic
1167786633 19:51643212-51643234 AAGTAGAAGGGGTATGGGGCAGG + Exonic
1168054207 19:53852568-53852590 AAGAAGAAGAAGAAGAAGGCTGG - Intergenic
1168063186 19:53905653-53905675 GAGATGAAGGGGAAGAGGGAGGG - Intronic
1168105570 19:54163954-54163976 AAGAAGAAGAAGAAGAGGCCGGG - Intronic
1168249675 19:55134676-55134698 AAGGAGAAAGGAAAGTGGGGAGG + Intronic
1168249712 19:55134775-55134797 AAGAAGAAGGGGAGGGAGGGAGG + Intronic
1168630259 19:57950626-57950648 AAGAAGCATGGGAAGGAGGCCGG - Intergenic
1168721759 19:58558329-58558351 AAGAAGGAGGAGGAGTCGGCGGG - Exonic
925072690 2:983592-983614 CAGGAGAAGGGCAGGTGGGCTGG - Intronic
925709914 2:6728842-6728864 AAGGTGAAGGGGAAGCAGGCAGG + Intergenic
925887998 2:8410194-8410216 AGGGAGAAGGGGGTGTGGGCTGG + Intergenic
925948934 2:8893101-8893123 AGGAGGCAGGGGAGGTGGGCAGG + Intronic
926010036 2:9400256-9400278 AGGAAGGAGAGGAAGAGGGCAGG - Intronic
926228488 2:10985135-10985157 AAGAAAAAGTGGGAGTGGGCAGG - Intergenic
926725054 2:15991206-15991228 AAGAAGAAGAAGAAGGTGGCCGG - Intergenic
927137603 2:20108336-20108358 AAGAAGAAAAAGAAGAGGGCCGG + Intergenic
927138449 2:20114047-20114069 GAGAAGAAGAGTGAGTGGGCTGG + Intergenic
927151512 2:20198930-20198952 AAGATGAAGGTGCAGAGGGCTGG - Intergenic
927287480 2:21371607-21371629 AAGGAGAAGGGGAAGGGGAAGGG + Intergenic
927429169 2:23012347-23012369 AAAAAGAAGGGGACTTGGACAGG + Intergenic
927478550 2:23432811-23432833 AAGAAGAAGTTGAAGTTGGCTGG + Intronic
927681005 2:25138969-25138991 AAGAAGATTGGGAAGAGGTCGGG + Intronic
927789464 2:25999138-25999160 AAGAAGAAAGGAAAGAGGGAAGG - Intergenic
927861863 2:26565082-26565104 AAGAAGAAGGGGTAGGGGAAGGG - Intronic
927866174 2:26589147-26589169 AAGGAGAAGGGGAAGGGGAAGGG - Intronic
927866188 2:26589195-26589217 AAGAAGAAGAGGAAGGGGAAGGG - Intronic
928268252 2:29831004-29831026 AAGAAGAAGGGGAAGAGGAAGGG + Intronic
928268302 2:29831171-29831193 AAGAGGAAGGGGAAGGGGAAGGG + Intronic
928449603 2:31366766-31366788 AGGAAGAGGGAGATGTGGGCTGG - Intronic
928471374 2:31580209-31580231 AGGAAGAAAGGGAAGCGGGGCGG + Intronic
928694557 2:33836214-33836236 CAGGAGTAGGGGAAGAGGGCAGG + Intergenic
928948790 2:36795697-36795719 AACAAGAAGGCAGAGTGGGCTGG - Intronic
929271866 2:39981471-39981493 GAGAAGAAGGGGTAGGAGGCTGG + Intergenic
929502949 2:42505712-42505734 AAGAGCAAGGGCAAGTGGGTGGG + Intronic
929694450 2:44102230-44102252 AATAAGAAGTACAAGTGGGCTGG + Intergenic
929769841 2:44882669-44882691 AGGAAGATGAGGAAGGGGGCAGG - Intergenic
929932509 2:46269805-46269827 GAGTAGAGGGGGAAATGGGCTGG - Intergenic
930140914 2:47950587-47950609 AAGAAGAAGGGGAAGGGGAAGGG + Intergenic
930270557 2:49251535-49251557 AAGAGGAAGGGGAAGGGGAAAGG - Intergenic
930772462 2:55141657-55141679 GAGAGGAAGGGGAGGTGAGCAGG - Intergenic
930798537 2:55419361-55419383 AGGAGGAAGGGAAAGGGGGCTGG + Exonic
931947337 2:67324797-67324819 AAGAAGAAAAGGAAGGGGGAAGG + Intergenic
932191373 2:69743572-69743594 AAGTAGGAGAGGAAGTGGACAGG + Intronic
932335879 2:70931151-70931173 ATGAGGAAAGGGAACTGGGCAGG - Intronic
932337876 2:70941351-70941373 CAGAAAGAGGGGCAGTGGGCTGG - Exonic
932405811 2:71512058-71512080 AAGAAGAGGGTGCAGTGGGTGGG + Intronic
932504903 2:72219280-72219302 AGGAGGAGGGGGAAGAGGGCAGG + Intronic
932617818 2:73246642-73246664 AAGAGAGAGGGGAAGTAGGCAGG - Intronic
932746776 2:74340478-74340500 AAGATGGAGGAGAAATGGGCAGG + Intronic
932750855 2:74370829-74370851 AGGAAGAAGTGGAGGTGGGAGGG + Intronic
932772383 2:74507778-74507800 AGGGAGAAAGGGACGTGGGCGGG - Exonic
933030846 2:77326818-77326840 CAGAGGAAGGGAAAGTAGGCTGG - Intronic
933193706 2:79365649-79365671 AAAAAAAAAGGGAAGTGGGGGGG + Intronic
933230287 2:79799203-79799225 AAGAAGAGGGGGAATGAGGCTGG - Intronic
933387907 2:81634652-81634674 AAGGAGAAGGAAAAGTGGGAAGG + Intergenic
933619348 2:84519587-84519609 AAGAAGAAGGGGAAGGGAAAGGG - Intronic
933661725 2:84933056-84933078 AAGAAGAAGAAGTAGGGGGCAGG + Intergenic
933938485 2:87226078-87226100 GAAGAGAAGGGGAAGGGGGCTGG - Intergenic
934296617 2:91747896-91747918 TTGAAGAAGGGAAAGTGGGGCGG + Intergenic
935427388 2:102934295-102934317 AAGAAGAAGGGGAAATGGCATGG + Intergenic
936268630 2:111031235-111031257 AGGAAGGAGGGAACGTGGGCTGG + Intronic
936276812 2:111106101-111106123 AAAGAGAAGAGGAAGTGGGCTGG - Intronic
936521085 2:113212555-113212577 GAGGAGGAGGGGAAGTGGGGGGG + Intergenic
936832835 2:116669860-116669882 AAGGAGAAGGAGAAGAGGGAAGG - Intergenic
937025011 2:118690559-118690581 AAGAAGGAGGGAAAGAGGGAGGG + Intergenic
937085453 2:119168909-119168931 AAGAAGAAGAGGAAGAGGAAGGG + Intergenic
937130902 2:119512328-119512350 AAGGAGAAGGGGAAGGGGAAGGG - Intronic
937192086 2:120112070-120112092 AAGAAGACTGGGCAGGGGGCGGG - Intronic
937249554 2:120514987-120515009 AAGAAGAGGGGGAATGGGGGAGG - Intergenic
937354813 2:121191635-121191657 AAGGAGAAGTGGCAGTGGGTGGG + Intergenic
937486099 2:122316341-122316363 AAGAGGCAGGGGATGTGGGTGGG + Intergenic
937495203 2:122411866-122411888 AAGCAGAAGGAGAAGTGGGTGGG - Intergenic
937688513 2:124725440-124725462 AAGAGGAAGGGGAAGGGGAAGGG - Intronic
937720189 2:125085989-125086011 AAGAAGAAGGAAATGTGGGAAGG + Intergenic
938024494 2:127934600-127934622 TAGAAGAGGTGAAAGTGGGCTGG - Intergenic
938043410 2:128095377-128095399 AAGGAGAAGGGGAAGGGGAAGGG - Intronic
938487140 2:131723200-131723222 GAGGAGATGGGGAAGTGGACGGG + Intronic
938645759 2:133328467-133328489 AGGCAGAAGGAGAAGTAGGCTGG + Intronic
938671976 2:133595415-133595437 GAGAAGAAGAGGAGGTGGGGAGG - Intergenic
939669737 2:144995454-144995476 AAGAATAAGGGGAAAAGGCCGGG - Intergenic
939986460 2:148833994-148834016 AAGAAAGAGGGGAAGGGGGAAGG - Intergenic
939990295 2:148872028-148872050 AAGAAAAAGGAGAACAGGGCCGG - Intergenic
940134460 2:150420792-150420814 CAGAAGAATGGGCAGTGGGTAGG + Intergenic
940287976 2:152051062-152051084 TAGAAAAAGTGGATGTGGGCTGG - Intronic
940315115 2:152320246-152320268 AAGGAGAAGGAAAAGTGGGAAGG - Intergenic
940775034 2:157876135-157876157 AGGAGGAAGGGGAGGAGGGCGGG + Intergenic
940786984 2:157991939-157991961 AAGAAGAAGGGGGTATGGCCTGG + Intronic
940979407 2:159984790-159984812 AATAAGAAGGGTAAGAGGACTGG - Intronic
941038226 2:160590594-160590616 GAGGAGAAGGGGAAGGGGGAGGG - Intergenic
941234027 2:162946635-162946657 AAGGAGAAGGGGAAGGGGAAGGG + Intergenic
941573765 2:167204110-167204132 AAGAACCAGGCGAAGTGTGCTGG - Intronic
941959437 2:171239227-171239249 AGGAAGGAAGGCAAGTGGGCAGG - Intergenic
942183338 2:173401720-173401742 AAGAAGAAGGGAAAGAAGGAAGG - Intergenic
942207728 2:173638192-173638214 AAGAAGAAGGAGGAGGAGGCAGG + Intergenic
942260564 2:174157345-174157367 AAGATGAAGGGGAACAGGGAAGG + Intronic
942552805 2:177137362-177137384 CAGAAGATGGGGAAAGGGGCTGG - Intergenic
942996460 2:182266849-182266871 AAGAAAAAATGGAAGTGGCCTGG + Intronic
943921535 2:193713263-193713285 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
943921538 2:193713269-193713291 AAGAAGAAGGAGAAGGGGAAGGG - Intergenic
944100378 2:196019943-196019965 AAGAAGAAGGGGGAGGAGGAGGG - Intronic
944320293 2:198332547-198332569 CATAAGAAGGGGAGGTGGGATGG + Intronic
944450011 2:199833284-199833306 AAGCAAGATGGGAAGTGGGCAGG - Intronic
944550690 2:200842007-200842029 AAGAATTAGGTGCAGTGGGCCGG + Intergenic
945080565 2:206084480-206084502 AGGAGGGAGAGGAAGTGGGCAGG - Intronic
945155166 2:206830432-206830454 AAGAAGAAGAAGAAGGGGGGAGG + Intergenic
945898800 2:215514988-215515010 AAGAAGAAGAGGAAGAGGAAGGG + Intergenic
945898802 2:215515000-215515022 AAGAGGAAGGGGAAGAGAGAAGG + Intergenic
946100205 2:217314119-217314141 CAGAACAAGAGGAAGGGGGCTGG - Intronic
946169713 2:217887602-217887624 AAGAACTAGGGGATGTTGGCTGG - Intronic
946306159 2:218858218-218858240 CTAAAGAAGGGGAAGGGGGCAGG - Intergenic
946313578 2:218896059-218896081 AGGAAATAGGGGAAATGGGCTGG + Intronic
946452103 2:219789090-219789112 AAGAAGAAGAGAGAGTGGGGAGG - Intergenic
947343626 2:229166979-229167001 AAGGGGAAGGGGAAGTGGAAGGG + Intronic
947375317 2:229489544-229489566 AAGAGGAAGGGGAGGAGGGGAGG + Intronic
947578370 2:231294608-231294630 CAGGAGAAGGGGAGCTGGGCAGG + Intronic
947627718 2:231631014-231631036 AAGAAGAAGCAAAAGTTGGCCGG + Intergenic
947916425 2:233834943-233834965 AAGCAGAAAGGTGAGTGGGCAGG + Intronic
948078683 2:235187832-235187854 AAGAGGAAGAGGAAGAGGGGAGG - Intergenic
948151013 2:235744668-235744690 GAGAAGAAGGGGAGGAGAGCAGG - Intronic
948229219 2:236337364-236337386 GAGAAGAAGGTGGTGTGGGCTGG - Intronic
948319593 2:237058714-237058736 TAGAAGATGGGGAAGTGAGTGGG + Intergenic
948344339 2:237282679-237282701 AAGGAGAAGGGGAAGGGGGAGGG + Intergenic
948396716 2:237650134-237650156 AACAAGAAGGGCAAGTGGGGAGG + Intronic
948558561 2:238835251-238835273 AAGGGGAAGGGGAAGTGGAAGGG - Intergenic
948558565 2:238835263-238835285 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
948558591 2:238835344-238835366 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
948948288 2:241232980-241233002 AGGAAGAAGGGGAAGGGGAAGGG + Intronic
949027217 2:241771909-241771931 AAGCAGAAGGGCAAGTGGTTGGG + Intergenic
949037632 2:241824519-241824541 AAGAAGAAGAAGAAGTAGTCAGG - Intergenic
1168750247 20:276971-276993 CAGAGGATGGGGAAGAGGGCGGG + Intronic
1168811714 20:709115-709137 ACAAAGAATGGGAAGTGGGAGGG - Intergenic
1168817030 20:745008-745030 AAGAATAAGGGAAGGTAGGCTGG + Intergenic
1169001922 20:2174169-2174191 TAGAGGAAGGGGAAGCAGGCAGG + Intronic
1169026985 20:2379938-2379960 GTGAGGAAGGGGAAGTGGGAGGG - Intergenic
1169178644 20:3542606-3542628 AAGGAAAAGGGGAAGGGGGAAGG - Intronic
1169468060 20:5858931-5858953 AAGAAGAAAAGGAGGAGGGCAGG - Intronic
1169559802 20:6787582-6787604 AAACAGAAAGGGAACTGGGCCGG - Intergenic
1169655252 20:7915383-7915405 AAGGAGAAGGGGAAGAGGAAGGG + Intronic
1169874196 20:10278904-10278926 AGGAAGCCGGGGAAGTGGGTGGG + Intronic
1169971148 20:11270756-11270778 AATGACAAGGGGATGTGGGCGGG + Intergenic
1170191505 20:13649402-13649424 AAGAAGAAAGGAAAGTGGAGAGG + Intergenic
1170316669 20:15049298-15049320 AAGAAGAAAGAGAAGAGGGAGGG + Intronic
1170369436 20:15632766-15632788 AAGGAGAACGGAAAGTAGGCAGG - Intronic
1170532640 20:17309853-17309875 AAGAAGAAGGGGAAGGGGAAGGG + Intronic
1170532651 20:17309904-17309926 AAGAAGAAAGGGAAGGGGAAGGG + Intronic
1170579241 20:17685250-17685272 AAGGAGAAGGGGAAGGGGAAGGG + Intergenic
1170952205 20:20947238-20947260 AAAAAGAATGGGCCGTGGGCTGG + Intergenic
1171964004 20:31515693-31515715 AAGCAGAAGGTGAAATGTGCTGG - Intronic
1172038694 20:32028779-32028801 AGGAAGAAGGAGAAGGGGGGTGG + Intronic
1172228935 20:33323965-33323987 TAGAAGAAGGGGAAAGGGGCGGG + Intergenic
1172619042 20:36307443-36307465 AGGAAGAAGGGGAGAAGGGCCGG - Intronic
1172700569 20:36851412-36851434 ATGAAGATGGAGAAGTGGACGGG - Intronic
1172811151 20:37649335-37649357 AAGAATAGATGGAAGTGGGCTGG - Intergenic
1173053016 20:39583661-39583683 AAGAAGAAAGGGAAGAGGAAAGG + Intergenic
1173224869 20:41156548-41156570 AAGAAGATGGGGCAGTGAGAAGG - Intronic
1173307971 20:41869678-41869700 AGGAAGAAGAGAAAGAGGGCAGG - Intergenic
1173678250 20:44856974-44856996 AAGAAGAAGGGGAGGGGGAGGGG + Intergenic
1174091439 20:48051827-48051849 AAGGAGAATGGGATGTGGACAGG + Intergenic
1174247687 20:49194130-49194152 TAGAAGAAAGGAAACTGGGCTGG + Intergenic
1174287526 20:49483465-49483487 GAGAAGGAGGAGAAGGGGGCGGG - Intergenic
1174295977 20:49545473-49545495 AAGGAAAAAGGGATGTGGGCTGG + Intronic
1174581720 20:51576940-51576962 CAGAAGAAGGGGAAGGGGTGGGG - Intergenic
1174593869 20:51668071-51668093 AAGAAGGAAGGGAGGTGGGGGGG + Intronic
1174671617 20:52313357-52313379 AACAAGAAGCCGATGTGGGCTGG - Intergenic
1174812611 20:53660076-53660098 AAGAACAAGGGGGGGTGGGGAGG + Intergenic
1175367973 20:58468308-58468330 TACAAAAATGGGAAGTGGGCTGG + Intronic
1175380760 20:58561448-58561470 GAGAAGTAGGGGGAGAGGGCAGG + Intergenic
1175685916 20:61028934-61028956 GAGAAGGAGGGAAAGTGGGAAGG - Intergenic
1175689110 20:61052952-61052974 CAGAGGAAGGGGAATTGGCCCGG + Intergenic
1175738527 20:61404246-61404268 AACAAGCAGAGGAAGGGGGCGGG - Intronic
1175756401 20:61533136-61533158 GAGAAGAAGGGGACTTGGGTTGG + Intronic
1175786079 20:61712516-61712538 AAGAAGAGGAGGAGCTGGGCAGG - Intronic
1176214416 20:63941502-63941524 AAGAGGAAGCAGAAGTGGGCCGG + Intronic
1176286553 21:5021990-5022012 AGGAGGGAGGGAAAGTGGGCGGG - Intergenic
1176630170 21:9129753-9129775 AGGAAAATGGCGAAGTGGGCGGG + Intergenic
1176720418 21:10388133-10388155 AGGAAGAAGGGGAAGGGGAAGGG + Intergenic
1177114863 21:17073343-17073365 AAGAAGAAGGGGAAGGAGAAGGG + Intergenic
1177114869 21:17073355-17073377 AAGGAGAAGGGGAAGGGGAAGGG + Intergenic
1177299257 21:19219574-19219596 AAGCAGAAGGGGAAGGGAGAAGG + Intergenic
1177914486 21:27071815-27071837 AAGAAAAAGAGGAAGTGAGTGGG - Intergenic
1178143464 21:29710880-29710902 AAGAAGAAAGGGAAGGAGGGTGG - Intronic
1178326038 21:31646268-31646290 TGGAAGAAAGGGAAGAGGGCTGG + Intergenic
1178534783 21:33402966-33402988 AAAAAAAAGGGGAGGGGGGCGGG + Exonic
1178630303 21:34253665-34253687 AAGAAGAATGGGGAGTAGTCAGG + Intergenic
1178643201 21:34363308-34363330 AAGAAGAAGACGATGTGGGAAGG - Intergenic
1178799491 21:35779164-35779186 GAGGAGAAGGGGAAGCGGGAGGG + Intronic
1179870628 21:44241485-44241507 AGGAGGGAGGGAAAGTGGGCGGG + Intergenic
1180109536 21:45641745-45641767 AACCAGAAGGGAAGGTGGGCCGG - Intergenic
1180960731 22:19761174-19761196 AAGAAGAACGCGAAGGTGGCCGG + Exonic
1181959853 22:26615351-26615373 AAGAAGAAAAGGAAGTGGGCTGG - Intronic
1182072705 22:27474991-27475013 AAGAGGAGGGGGGAGAGGGCTGG - Intergenic
1182085239 22:27556716-27556738 AAGCAGGACTGGAAGTGGGCTGG + Intergenic
1182367969 22:29791381-29791403 AAGAAGAAGAAGAAGAAGGCTGG + Intronic
1182369722 22:29802232-29802254 AAGGGGAAGGCTAAGTGGGCCGG + Intronic
1182408347 22:30158566-30158588 AAGGAGAAGGGGAAGGGGAAGGG - Intronic
1182544202 22:31064166-31064188 AGGAAGAAGCAGAACTGGGCAGG + Intronic
1182581586 22:31315841-31315863 AAAAGGAAAGGGAAGTGGGGAGG + Intergenic
1182688772 22:32141436-32141458 GAGTAGCAGGGGAAGTGGGGAGG - Intergenic
1182863832 22:33584818-33584840 ATGAAAAAGAGAAAGTGGGCTGG + Intronic
1182873982 22:33674238-33674260 GGGAAGAATGGGAAGTTGGCTGG - Intronic
1183020754 22:35024111-35024133 TGGAAGAAGGCAAAGTGGGCGGG + Intergenic
1183068150 22:35377912-35377934 AAAAAGAAGGGGAAGTCAGGAGG + Intergenic
1183253066 22:36743986-36744008 AAGAGGAAGGGGAAGGGGTTTGG - Intergenic
1183257335 22:36770968-36770990 AAGAAAAAGGAGAAGCAGGCGGG - Intronic
1183419734 22:37704453-37704475 GAGAAGGAGGGGAAGGGGGAGGG + Intronic
1184149228 22:42628845-42628867 ATGGAGAAGGGGAAGGTGGCTGG + Intronic
1184212475 22:43044034-43044056 GAGGAGAAGGGGCAGTGGTCAGG - Intronic
1184770519 22:46594335-46594357 AAGGACAGGTGGAAGTGGGCGGG + Intronic
1185236765 22:49718376-49718398 GAGAAGAAAGGGAAGTGGAGGGG - Intergenic
1185305495 22:50113124-50113146 TAGAAGAAGGGGAAGTAAGTGGG + Intronic
1185396172 22:50590664-50590686 AAGAGGAAGAGGAAGAGGGAGGG - Intronic
950284230 3:11732279-11732301 AAGAAGAAAGGGAGGAAGGCAGG - Intergenic
951516731 3:23567878-23567900 AAGGAGAGGGGGAAGTTGGCAGG + Intronic
951651900 3:24959786-24959808 AAGAACAAGGGGAATGAGGCAGG + Intergenic
951825026 3:26859303-26859325 AAGAAGAAGGTGAAGAGAGGAGG - Intergenic
951856308 3:27200926-27200948 AAACAGAAGGGGAAGTGGGAGGG + Intronic
952221539 3:31328426-31328448 CAGGAGAAAGGGAAGGGGGCAGG + Intergenic
952341477 3:32451184-32451206 GGGAAGAAGTGGATGTGGGCTGG + Intronic
952412856 3:33064935-33064957 TAGAAGAAGGAGAATGGGGCAGG + Intronic
952428849 3:33202502-33202524 ACTAAGAAGGTGAAGTGGGCTGG + Intronic
952890039 3:38033755-38033777 AAGAGAACGGGGAAGTGGGGCGG + Intergenic
953340988 3:42134159-42134181 AAGAGGAAGGGGAAGGGGAAGGG - Intronic
953435079 3:42871602-42871624 TAGAAGGAGGAGAAATGGGCTGG - Intronic
953449660 3:42995728-42995750 GAGAAGAAGGGGAGGGGAGCAGG - Intronic
953664754 3:44917742-44917764 AAGAAGGAGGGGAAATGGCAAGG + Intronic
953669580 3:44951459-44951481 AAATAGAAAAGGAAGTGGGCAGG - Intronic
954000112 3:47549913-47549935 AGGAAGAGGGGGAGGTGGGAGGG - Intergenic
954638050 3:52082180-52082202 AGGAAGAGGGGGGAGTGGGGAGG + Intronic
954654184 3:52183958-52183980 CACAAGAAGGGGAAGAGGGAGGG + Intergenic
954899991 3:54010630-54010652 AAGAATAAGTGGAGGTGGCCAGG - Intergenic
955033537 3:55243819-55243841 AAGGAGGAGTGGAAATGGGCTGG - Intergenic
955079655 3:55647023-55647045 AAGAAGCAGGTGAACTGGGCAGG - Intronic
955314644 3:57926320-57926342 AGGAGGAAGGGGAAGAAGGCTGG - Intronic
955834432 3:63039157-63039179 TAGAAGAAGGGGGAGAGGACAGG - Intergenic
956225250 3:66950265-66950287 AGGAAGAAGTGGCATTGGGCTGG + Intergenic
956488390 3:69745451-69745473 CAGAGGAAGGGGAACTGGGGAGG + Intronic
957239420 3:77639124-77639146 AAGAACTAGGGGAAAGGGGCCGG - Intronic
957955931 3:87187010-87187032 ATGAAGCTGGGGAAGTAGGCAGG + Intergenic
958095039 3:88933702-88933724 AGGCAGAAGGGGAAGAGGGAAGG - Intergenic
959118445 3:102205804-102205826 AAGAGGAAGGAGGAGTGGGAAGG - Intronic
959155908 3:102665752-102665774 AAGAGGAAGGGGAAGAGGAGAGG - Intergenic
959240909 3:103792500-103792522 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
959397721 3:105862318-105862340 AAGGAAAAGAGGAAGTGTGCGGG - Intronic
959749809 3:109820072-109820094 AAGAAGAAGGGGGAATGGAAAGG + Intergenic
960084707 3:113578168-113578190 AAGTAGAAGGGGAATAGGCCGGG + Intronic
960141531 3:114155919-114155941 AGGCGGAAGGGGAAGTGGGAGGG - Intronic
960568286 3:119158090-119158112 AAGAATCAGGGGAAGTAGCCTGG - Intronic
960611116 3:119555596-119555618 AGCAAGAAGGGGCAGTGAGCTGG - Intronic
961167178 3:124771450-124771472 AATAAGAAGGAATAGTGGGCTGG + Intronic
961714199 3:128847575-128847597 GGGAGGAAGGGGAAGGGGGCAGG + Intergenic
961879406 3:130050281-130050303 AAGAAGAAGGAGAAGAAGGAAGG + Intergenic
962055821 3:131870624-131870646 AAGAAGGAGGGGAAGAGGAGGGG - Intronic
962254507 3:133861113-133861135 CTGCAGAAGGGGAAGGGGGCTGG + Intronic
962297185 3:134201336-134201358 AATATGAAGGGGAAGGGAGCTGG - Intronic
962635760 3:137329995-137330017 AAGAAAATGGGGAATTGGGAAGG + Intergenic
962746740 3:138402389-138402411 AGGGAGAAGGGCAGGTGGGCAGG + Exonic
962823676 3:139079098-139079120 AGGAAGAAGAGGATGTGGGGAGG - Intronic
963466777 3:145691966-145691988 ATGAAGAAAGGGAAGAGGACTGG - Intergenic
963831228 3:150011801-150011823 AAGAAGAAGAAGAAGAAGGCCGG + Intronic
963938873 3:151081445-151081467 AAAAGGCAGGGGAAGTGGGAGGG - Intergenic
963958020 3:151276825-151276847 AAGACACAGGGGAAGTGGGCCGG - Intronic
964158549 3:153617309-153617331 AAGGAGAAGAGGAAGGAGGCAGG - Intergenic
964376342 3:156052159-156052181 AAGAAAAAGGGGGAGGGGGAGGG - Intronic
964458204 3:156892153-156892175 AAGAAGAAAGGCAGGTGGGTAGG + Intronic
964833299 3:160910172-160910194 AAGGGGAAGGGGAAGGGGACAGG - Intronic
964934155 3:162060644-162060666 AAGGTGAAGGGGAAGCAGGCAGG + Intergenic
965044361 3:163556344-163556366 AAGAAGAAGAGAAAGTTGGAGGG + Intergenic
965076004 3:163977303-163977325 TAAAAGAAGGAGAAGGGGGCTGG - Intergenic
965083880 3:164069444-164069466 GAGAAGGAGGGAAAGAGGGCAGG + Intergenic
965355452 3:167667382-167667404 AAGAAGGAGGGGAAGAAGGAAGG + Intergenic
965529515 3:169757199-169757221 TAGAAGATGGTGAACTGGGCTGG + Intergenic
966146137 3:176814039-176814061 TAGAAGAAGGGAAGGTGGGCTGG - Intergenic
966207663 3:177421473-177421495 AGGAAGAAGAGGAATGGGGCAGG + Intergenic
966685271 3:182686609-182686631 AATAAAAGGGGGAAATGGGCTGG + Intergenic
966705276 3:182906790-182906812 AAGAAGAAGAAGAAGAAGGCCGG + Intronic
966827770 3:183979353-183979375 AAAAAAAAGGGGCAGTGGGGAGG + Intronic
966830858 3:184007314-184007336 AAAAATAAGCAGAAGTGGGCCGG - Intronic
966854129 3:184182630-184182652 CAGAACAAGGAGAAGTGGTCAGG - Intronic
967071715 3:185968229-185968251 AACAAGAAGGGCAAGTGAGCAGG - Intergenic
967983370 3:195078522-195078544 AGGAAGAGGGGGAGGTAGGCTGG - Intronic
968135629 3:196217639-196217661 AAGGAGAAGGGGAAGGGGAAGGG + Intronic
968150299 3:196332474-196332496 AAGAGGAAGGGGAAGGGGAAGGG + Intronic
968152764 3:196351694-196351716 AAGAAGAAAGAGAAGTGTGAAGG + Exonic
968336501 3:197918029-197918051 AAGAAGGAGGAGAAATGGGCTGG - Intronic
968448287 4:663427-663449 AAGCCGAAGGGGAAGCGGCCCGG + Intronic
968630616 4:1649120-1649142 AAGAGGAAGGGGAAGGGGAAGGG + Intronic
968890816 4:3367535-3367557 ACGAAGCAGGGGCAATGGGCTGG + Intronic
969077214 4:4589678-4589700 AAGAAGAAGAGGAAGAGGCTGGG - Intergenic
969091635 4:4698290-4698312 AAAGAGCTGGGGAAGTGGGCAGG + Intergenic
969198201 4:5579851-5579873 AAGAAGAAGAGGAAGATGCCAGG + Intronic
969334968 4:6502453-6502475 AGGAAGAAGGGAAGGAGGGCAGG - Intronic
969397674 4:6933272-6933294 AAGGGGAAGGGGAAGGGGGAGGG - Intronic
970379682 4:15494257-15494279 AAGAGCAAGGGGCACTGGGCAGG + Intronic
970645298 4:18113832-18113854 AAGAAGAAGGGGAAGGGGAAGGG + Intergenic
970664832 4:18324765-18324787 ATAAAGAAGAGGAATTGGGCAGG - Intergenic
970796939 4:19924115-19924137 ATCAAAAAGGGGAAATGGGCTGG + Intergenic
970867220 4:20772928-20772950 AATAAGAAAGGGAAAGGGGCCGG - Intronic
971105215 4:23517342-23517364 AAGGAGAAGGAGGAGTGGGAAGG - Intergenic
971305120 4:25473301-25473323 AAGGAGAAGGGGAAGGGGAAGGG + Intergenic
971305123 4:25473307-25473329 AAGGGGAAGGGGAAGGGGACGGG + Intergenic
971305153 4:25473376-25473398 AAGAAGAAGGGGAAGGGGAAGGG + Intergenic
971399334 4:26261509-26261531 AAGAAGAGAGGGAAGTGGTCAGG + Intronic
972082531 4:35171657-35171679 AAGCAGAAGGGCAAGGGAGCCGG - Intergenic
972158582 4:36196299-36196321 AAGGAGGAGGGGAAGAGGGAGGG + Intronic
972388622 4:38591773-38591795 AAGAAGCAGAGGTTGTGGGCGGG - Intergenic
972422838 4:38905792-38905814 CTGATGAAGGGGAAGTGGGTGGG - Exonic
972637783 4:40899603-40899625 ATGAAGAAGGGCAAGTGGCTGGG + Intronic
972945516 4:44249782-44249804 AAAGAGGAGGGGAAGGGGGCAGG - Intronic
973303592 4:48617663-48617685 AACAAGGAGGGGAAGAGGACAGG + Intronic
973399504 4:49626650-49626672 AGGAAAATGGCGAAGTGGGCCGG + Intergenic
973752132 4:54031914-54031936 AAGAATTAGAGCAAGTGGGCTGG - Intronic
974162622 4:58159316-58159338 AAGAAGAATTAGAGGTGGGCTGG - Intergenic
974214953 4:58832991-58833013 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
974374543 4:61059605-61059627 TAGAAGAAGGCGAGGTGGCCAGG - Intergenic
974693715 4:65337364-65337386 AAGAGGAAGGGGAAGGGAGGAGG - Intronic
974986309 4:69030369-69030391 AAGAAAGATGGGAAGTGGGTGGG + Intronic
974991678 4:69099277-69099299 AAGAAGCAGGTAAAGTGGTCAGG + Intronic
975276488 4:72507234-72507256 AAGAGGAAGGGAAGCTGGGCAGG - Intronic
975360210 4:73460925-73460947 AAGGAGGAGGGGAAGGGGGAGGG - Intergenic
975362362 4:73485704-73485726 AAGGAGAAGGGGAAGGGGAAGGG + Intronic
975442024 4:74421791-74421813 AAGAGGAAGGGGAAGAGGAGGGG + Intergenic
975502306 4:75100345-75100367 GAGGAGAGGGGGAAGTGGGGAGG - Intergenic
976096419 4:81513081-81513103 AAGAGGAAGGGAAAGGGGGAGGG - Intronic
976267185 4:83195446-83195468 AAGAGCAAGGAGAAGAGGGCGGG - Intergenic
976280477 4:83322051-83322073 AAGAGGAGGAGGCAGTGGGCAGG - Intronic
977595001 4:98868923-98868945 AAGAAGAAGAAGAAGTTGGGTGG + Intergenic
977749662 4:100594101-100594123 AGGAAGAAGTGGAAGTGGCAGGG + Intronic
978268533 4:106858872-106858894 AAGAAGAAGGGGAAGGGGAAGGG + Intergenic
978272689 4:106909562-106909584 AAGAACATGGGGAAGTGGTTGGG + Intergenic
978529778 4:109702101-109702123 AGGAAGAAGAGGAAGGGAGCAGG + Intronic
978816088 4:112907471-112907493 AAGAAGAGGGATAAGTGGGTGGG - Intronic
978842637 4:113232818-113232840 CATAAGAAGTGGGAGTGGGCAGG + Intronic
979367020 4:119837429-119837451 AAGGAGAAGGGGATGGGGGAGGG + Intergenic
979546833 4:121950043-121950065 AGGGAGACGGGGAAGTGAGCTGG + Intronic
979853542 4:125603389-125603411 AAGGAGAAAGGGAAGAAGGCAGG + Intergenic
980137518 4:128873029-128873051 AAGAAGAAGGTCAAGTGGACTGG - Exonic
980340139 4:131533628-131533650 AGGCAGAAATGGAAGTGGGCAGG + Intergenic
980363312 4:131765274-131765296 AAGAAGAGTGAGAAGTGGGGAGG + Intergenic
980901269 4:138907611-138907633 AGGCAGAAAGGGAAGTAGGCAGG + Intergenic
980947869 4:139340784-139340806 AAAAAGAAGGGGAAGGGGAGGGG - Intronic
980976424 4:139615109-139615131 AAGAAGAAAGGAAAGCGGCCGGG + Intergenic
981138796 4:141242886-141242908 AAGAATAAAGAGAAGTTGGCTGG - Intergenic
981430235 4:144648759-144648781 GAGGAGAAGGGGAAGGGGGATGG + Intronic
981756520 4:148146077-148146099 AAGAAGAAGGGGAAGTGGGCTGG + Intronic
982338698 4:154270512-154270534 AAGAAGAAGGTGGAGATGGCAGG + Intronic
982358600 4:154494536-154494558 AAAGTGAAGGGGAAGTAGGCAGG + Intergenic
982364366 4:154559179-154559201 AAGAAGAAGGGGAAGGGGAAGGG - Intergenic
982444103 4:155470213-155470235 AAGAAGAGGTGGACATGGGCGGG - Intergenic
982486968 4:155977727-155977749 AAGAAGCTCGGGAAGTGGGGTGG + Intergenic
982973039 4:162015278-162015300 AAGAAAAAAGGGAAGTGTGACGG + Intronic
983029811 4:162785595-162785617 AAGAAGAAGAAGAAGTAGTCAGG + Intergenic
983272216 4:165575715-165575737 CAGAAGAAGGGGAAGTGACTGGG + Intergenic
983509041 4:168587912-168587934 AAGCAGGAGGGGAAGTGGACAGG + Intronic
983640810 4:169942496-169942518 AAGAAGAACGTGAGGTAGGCCGG - Intergenic
984070309 4:175103264-175103286 AAGGAGAAGGGGAAGGGGAAGGG + Intergenic
984632567 4:182076187-182076209 AAGAAGAAGGAGAAAGAGGCTGG - Intergenic
984725159 4:183013444-183013466 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
984725162 4:183013450-183013472 AAGAAGAAGGAGAAGGGGAAGGG - Intergenic
984828531 4:183950408-183950430 CAGAAGAAGGGGACCTGGCCTGG + Intronic
984834179 4:184003889-184003911 AAGAAGAAAGGAAAGAAGGCAGG - Intronic
984911437 4:184676929-184676951 AGGGAGAAGGGGAAGGGGGAAGG - Intronic
985020190 4:185680750-185680772 AAGAAGAAGGTGTACTGGGCGGG + Intronic
985140986 4:186840552-186840574 GAGAAGGAGGGGAAGGGGGGAGG - Intergenic
985160326 4:187037522-187037544 AAGAAGAAGAAGAAGTGAGTAGG + Intergenic
985202095 4:187494374-187494396 AAGGCGAAGGGGAAGCAGGCAGG - Intergenic
985313815 4:188632558-188632580 AAGAAGAAGGGGAGGGTGGCCGG + Intergenic
985336189 4:188897626-188897648 AACAAGGAGGGGTACTGGGCAGG + Intergenic
985652302 5:1112618-1112640 AAGAAGGAGGGGTAGGGGGCTGG - Intergenic
985869920 5:2546049-2546071 AAGTTGAAGGGGAAGCAGGCAGG + Intergenic
985988927 5:3539154-3539176 AAGGACAAGGGGAAGAAGGCTGG - Intergenic
985992806 5:3577352-3577374 AAGGTGAAGGGGAAGCAGGCAGG - Intergenic
986024042 5:3833320-3833342 AAGGTGAAGGGGAAGCAGGCTGG - Intergenic
986671329 5:10145592-10145614 CAGAAGATGGGGAAGAGGGGAGG + Intergenic
986946672 5:13029309-13029331 AAGAAGAAGGGGAAGGGGAAGGG + Intergenic
986946684 5:13029342-13029364 AAGAAGAAGGGGAAGGGGAAGGG + Intergenic
987109531 5:14672363-14672385 ATGAAGAAGGGGTACTGGGAGGG - Intronic
987132093 5:14870011-14870033 AGAAAGAAGGGAAGGTGGGCGGG + Intronic
987206802 5:15635677-15635699 ATGAAGATGGAGAAGTAGGCAGG + Intronic
987447264 5:18035106-18035128 AAAATGAAGGGGAAGCCGGCAGG - Intergenic
987811419 5:22840960-22840982 AAGAACAAGGGGAAGGATGCAGG + Intronic
987896106 5:23949406-23949428 AAGAAGGAGGAGGAGTGGGAGGG - Intergenic
987942226 5:24554092-24554114 AGAGAGAAGGGGAGGTGGGCGGG + Intronic
988708934 5:33754300-33754322 AAGATGTAAGAGAAGTGGGCAGG - Intronic
988802103 5:34705941-34705963 AAGAAAAACAGAAAGTGGGCTGG - Intronic
988857499 5:35243197-35243219 AAAAAGAAGGCAAAGTAGGCTGG + Intergenic
989088393 5:37700936-37700958 AAGAAGAAAGGGAAGGGGAAGGG - Intronic
989707030 5:44346543-44346565 AGAAAGAAGGCCAAGTGGGCTGG - Intronic
990425401 5:55683030-55683052 AAGAAGAGAGGGAAGGAGGCAGG + Intronic
991027060 5:62041169-62041191 AAGAAGAAGGGGAAGAAGTAGGG + Intergenic
991293045 5:65051172-65051194 AAGAAGAAAGGGATTTGGGCTGG + Intergenic
991481960 5:67090380-67090402 GGGGAGAAGGGGAAGTGGGGAGG - Intronic
991921094 5:71657720-71657742 AAGAATAAGGAGATGTGGTCAGG - Exonic
992030220 5:72713648-72713670 ATGAAGAGGGGAAAGTGGGTAGG - Intergenic
992447951 5:76850730-76850752 AAGAAGAGAGGGAAGAGGGATGG + Intronic
992705462 5:79386999-79387021 AGGAAGAGGGGGAAGGGGGAGGG - Intronic
992768384 5:80024291-80024313 AACAAGAAGGGGTAGTGTCCTGG - Intronic
992933046 5:81670782-81670804 AAGAAGAAGGTAAAGTGGATGGG - Intronic
993263599 5:85693702-85693724 AAGGTGAAGGGGAAGCAGGCAGG + Intergenic
993901150 5:93584922-93584944 AAGGGGAAGGGGAAGGGGGGAGG - Exonic
995133853 5:108659569-108659591 AGGAAGAATGGGAAGAGGGAGGG + Intergenic
995156532 5:108920891-108920913 AATAATGAGGGGAAGTAGGCAGG - Intronic
995419914 5:111952720-111952742 AAGAAGAGGGGGAAGTTGGTTGG + Intronic
995532872 5:113108357-113108379 AAAAAGAAAGGAAAGTGGCCAGG + Intronic
995756677 5:115512705-115512727 ACGTAGAAGGCAAAGTGGGCGGG + Intergenic
997105955 5:131019602-131019624 AGGAGGAAGGGGCAGTGGGCAGG + Intergenic
997288245 5:132699856-132699878 AAGAAGAAGAGGGAGCGGGCCGG - Intronic
997444072 5:133928608-133928630 AAAAAAAAGGGGGAGGGGGCGGG + Intergenic
997465699 5:134086695-134086717 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
997496434 5:134330882-134330904 ACCAAGAGGTGGAAGTGGGCTGG - Intronic
997511911 5:134459982-134460004 AAAAAAAACGGGAAGGGGGCTGG + Intergenic
997654866 5:135547228-135547250 AAGAAAAAGGGGTAGTCTGCGGG - Intergenic
997678760 5:135734530-135734552 ATTAAGAAGGGGAAGGGGCCGGG + Intergenic
997708853 5:135986124-135986146 GAGAAGAAAGGGAAGAGGGAAGG - Intergenic
997923563 5:138006191-138006213 AAAAAGAAGAGGAAATAGGCCGG - Intronic
998079161 5:139260404-139260426 AAGAAGCAAGAGAAGTGGGTGGG - Intronic
998174775 5:139895003-139895025 AAGAAGAAGGGGAAGGGAGGAGG + Intronic
998258163 5:140606079-140606101 AAGAAGGGGGGGAAGGGGGAGGG - Intergenic
998372466 5:141670633-141670655 AAGGGGAAGGGGAAGTAGTCAGG + Intronic
998569495 5:143244631-143244653 ATGAAGCTGGGGAAATGGGCTGG - Intergenic
999114035 5:149146076-149146098 AAGAAGACATAGAAGTGGGCTGG - Intronic
999145719 5:149391953-149391975 GAGAAGCTGGGGAAGAGGGCAGG - Intronic
999214000 5:149916335-149916357 AGGGAGATGGGGAAGTGGTCAGG + Intronic
1000097956 5:157987502-157987524 AAGGAGAAGAGGAACTGGACAGG - Intergenic
1000182054 5:158821099-158821121 ATGTAGATAGGGAAGTGGGCTGG - Intronic
1000220283 5:159208683-159208705 AAGACGAAGGGAAAGAGGGAGGG + Intronic
1000443785 5:161295155-161295177 AAGAGGAAAGGGAAGAGGGTAGG + Intronic
1000917074 5:167095384-167095406 ATAAAGAAGGGGGATTGGGCTGG + Intergenic
1000931363 5:167255528-167255550 AACAAGAAGGAAAAGAGGGCAGG - Intergenic
1000944049 5:167398746-167398768 AGGAATAAGGGAAAGGGGGCTGG - Intronic
1001075998 5:168628597-168628619 CAGAAGAAATGCAAGTGGGCTGG + Intergenic
1001195460 5:169669500-169669522 AAGAATGAGGGAAAGTGGGAGGG - Intronic
1001270773 5:170309923-170309945 CAAAAGAAGGGGCAGTGGGTAGG + Intergenic
1001290529 5:170455296-170455318 AAGAAGAAGGGGAAGGGGAAGGG - Intronic
1002484851 5:179527958-179527980 AAAAAGAAAGGGTGGTGGGCTGG - Intergenic
1002636919 5:180613116-180613138 AACAGGAAGGGGAGGTGGGTGGG + Intronic
1003044494 6:2720864-2720886 AAGAATAAGAGAATGTGGGCTGG + Intronic
1003509929 6:6771287-6771309 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509940 6:6771330-6771352 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509951 6:6771373-6771395 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003683747 6:8280886-8280908 AAGGACAAGGGAAAGTGGGTGGG - Intergenic
1003714057 6:8626395-8626417 AAGAAGTAGGGGAAATGAGGGGG - Intergenic
1003762758 6:9198895-9198917 AAGAAGAGGGTGGACTGGGCTGG - Intergenic
1003839757 6:10107815-10107837 AAGCAGAAAGGCAAGTGAGCAGG + Intronic
1004000623 6:11593812-11593834 ATTAAGAAGGAGAAATGGGCCGG - Intergenic
1004066676 6:12252904-12252926 AAGAAGAAGAGGAAGAGGAGAGG + Intergenic
1004343937 6:14831115-14831137 AACAAGAAGAGGATGTGTGCAGG + Intergenic
1004462712 6:15853422-15853444 AAGCAGAAGGGGAAGGGGAAAGG - Intergenic
1005152528 6:22768644-22768666 AAGAAGGAAGGAAATTGGGCTGG - Intergenic
1005437961 6:25835617-25835639 AAGGAGGTTGGGAAGTGGGCAGG + Intronic
1005464119 6:26095191-26095213 ATGAAGAAAGTGAAGTAGGCCGG + Exonic
1005478785 6:26234851-26234873 AAGAAAAAGGCGAAGAAGGCAGG - Exonic
1005567768 6:27113851-27113873 AAGATGAGTGGGCAGTGGGCTGG + Intergenic
1005667076 6:28068480-28068502 AAGTACAATGGGAAGTGAGCAGG + Intergenic
1005838014 6:29722682-29722704 GAGAAGAAGAGGAGGGGGGCGGG + Intergenic
1005979187 6:30823371-30823393 AAGAAGAAGAAGAAATGGGCTGG - Intergenic
1006002202 6:30973989-30974011 AAGAAGAAGAAGAAGAGGCCGGG + Intergenic
1006252698 6:32802534-32802556 ATGAAGAAGTGGAAATGGGAGGG - Intergenic
1006562976 6:34929777-34929799 AAGGAAAAGGGGAAGGGGGAGGG - Intronic
1006567722 6:34974112-34974134 AAGAGGAAGGGGAAGGGGAAGGG - Intronic
1006567766 6:34974211-34974233 AAGGAGAAGGGGAAGGGGAAGGG - Intronic
1006652441 6:35562820-35562842 AAGGAGAAAGGGAAGGGGGTGGG + Intergenic
1006697703 6:35945450-35945472 AAGAAGAATGGCAAGAGGCCAGG - Intronic
1006934066 6:37705357-37705379 AAGGAGAAGGGGAGGAGGGGCGG + Intergenic
1006985174 6:38171200-38171222 AAAAAGAAGGTGAAGTTGACTGG + Exonic
1007193143 6:40037028-40037050 AAGAACGAGTGGATGTGGGCAGG + Intergenic
1007246449 6:40466647-40466669 ATGAAGAAGTGGAAGTGGATTGG - Intronic
1007397471 6:41585943-41585965 AAGAAGAAGGGGAAGAAGCTGGG - Intronic
1007410688 6:41659531-41659553 AACAAAAAGGGCAGGTGGGCTGG + Intergenic
1007498703 6:42279464-42279486 AAGATAGAGGGGAAGTGGGCTGG + Intronic
1007706859 6:43796376-43796398 AAGGAGAAAGGGGAGTGGCCTGG - Intergenic
1007708731 6:43807447-43807469 AAGCAGAGGGGGACATGGGCTGG - Intergenic
1007874415 6:45079460-45079482 AAGAAGAAGGGGAAAGGAGGAGG + Intronic
1007939445 6:45765440-45765462 AAGAGGAAGGGGAAGGGGAAGGG - Intergenic
1007967564 6:46016106-46016128 AAGAGGAAGGGGAAAGGGGAAGG + Intronic
1007967574 6:46016131-46016153 AAGAGGAAGGGGAAAGGGGAAGG + Intronic
1007967584 6:46016156-46016178 AAGAGGAAGGGGAAAGGGGAAGG + Intronic
1007967594 6:46016181-46016203 AAGAGGAAGGGGAAAGGGGAAGG + Intronic
1007967604 6:46016206-46016228 AAGAGGAAGGGGAAAGGGGAAGG + Intronic
1008016433 6:46525636-46525658 GAGAAGAAGGGGGAGGGGGGAGG + Intergenic
1008111245 6:47497356-47497378 AAGGAGAAGGGGAAGGGGAAGGG - Intronic
1008126242 6:47672671-47672693 AAGATGGAGGGGAGGTGGGTGGG - Intronic
1008228434 6:48952580-48952602 AAAAAGAAGAGGAAGATGGCAGG + Intergenic
1008860059 6:56138393-56138415 ATGAGGAAGGGGAAGAGGACAGG + Intronic
1009606157 6:65870297-65870319 AAGCAGAAGGGAAAATGGGACGG + Intergenic
1009993171 6:70868923-70868945 AATAAGGAGGGGTGGTGGGCAGG - Intronic
1010091890 6:71992525-71992547 AAGAAGAAGAGGAGGAGGGGAGG - Intronic
1010581702 6:77607045-77607067 AAGACCAAGGGGAAATGGGCAGG - Intergenic
1012463535 6:99491235-99491257 AAGAAAAGGGGGAAGAGGCCAGG + Intronic
1012494375 6:99818510-99818532 AAGAAGAAGGGGGAGGGGGAGGG - Intergenic
1012494379 6:99818516-99818538 AAGAAGAAGAAGAAGGGGGAGGG - Intergenic
1012596003 6:101041050-101041072 AAAAAGAAGGAGAAGAAGGCAGG - Intergenic
1012603326 6:101126165-101126187 AAGAAGGAAGGGAACTGGGATGG - Intergenic
1013068980 6:106711182-106711204 AAGAAGAAGGGGCAGGGGAAGGG - Intergenic
1013236410 6:108200759-108200781 AAGAAGCAGGGGAAATTAGCCGG - Intergenic
1013252742 6:108350436-108350458 AAGAAAGAGGTGAAGTGAGCAGG - Intronic
1013459977 6:110365496-110365518 AGGAAGAAGGGGGAGAGGGAAGG - Intergenic
1013735438 6:113221907-113221929 AAGAGGTGGGGGAAGTGGGTGGG + Intergenic
1014684380 6:124477738-124477760 AAGGAAAAGGGGAAGGGGGAAGG - Intronic
1015102376 6:129496460-129496482 CAAAAGAAGGGGAAATAGGCCGG - Intronic
1015111454 6:129596449-129596471 CAGAACAAGGGGAATTGGGAAGG - Intronic
1015362335 6:132354681-132354703 AAGAGGAAGTGGTGGTGGGCGGG + Intronic
1015486819 6:133781002-133781024 AAGAAGAAAGGGAAGTGGGTAGG + Intergenic
1015890106 6:137962154-137962176 AAGAAGGAGAGGCAGTGGCCTGG - Intergenic
1015997885 6:139013621-139013643 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
1016291082 6:142528830-142528852 AGGAAGAAGGGGAGGTGCCCTGG + Intergenic
1016772805 6:147870784-147870806 AAGAAAAAAGGGAAGAGGGAAGG + Intergenic
1016801476 6:148173513-148173535 AAGAAGAAGGGGAAGAAGGGGGG + Intergenic
1016877870 6:148881607-148881629 AAGAAAAGGTGGAAGTGGGCTGG - Intronic
1017221386 6:151969659-151969681 AAGAAGACAGGTAAGTGGGAGGG - Intronic
1017339565 6:153305195-153305217 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
1017398114 6:154027701-154027723 AAGAAAAAGGAAAAGTGGGAAGG - Intronic
1017523895 6:155226161-155226183 ATGAAGAATGGGATGGGGGCAGG - Intronic
1017634764 6:156432726-156432748 AGGAAGAAAGGGAAGGGTGCAGG + Intergenic
1017884540 6:158588168-158588190 TAGGAGAATGGGAGGTGGGCGGG + Intronic
1017927749 6:158924769-158924791 AAGAGGGAGGGGAAGTGAGAAGG + Intergenic
1018238693 6:161751883-161751905 AAGGAGAAGGGGCAGTGAACTGG + Intronic
1018403742 6:163454610-163454632 AAGAAGAAATGGAGGTAGGCAGG - Intronic
1018798844 6:167207468-167207490 AAGAGGAAGGGGAAGGGGAAGGG + Intergenic
1018852499 6:167651063-167651085 AGGAAGAAGTGGAGGTGGGAGGG + Intergenic
1019535356 7:1526402-1526424 AAGGAGAAGGAGAAGAGGGGAGG + Intergenic
1019551733 7:1606665-1606687 AAGAAGAGGGGGAAGGGGAGGGG - Intergenic
1019919986 7:4157343-4157365 AAGAAGGAAGGAAAGTGGGAAGG + Intronic
1020088718 7:5325226-5325248 AAGAAGAAAGGGAAAGAGGCTGG - Exonic
1020256119 7:6503923-6503945 AAGAAAAAAGGAAAGGGGGCGGG + Intronic
1020376528 7:7493658-7493680 AAGAAAAAGGGGAAATGGGAAGG - Intronic
1020534147 7:9372999-9373021 CAGAAACAGGGGAAGTGGGAGGG - Intergenic
1021289380 7:18823989-18824011 AAGAAGAAGGAGAAGGGGAATGG + Intronic
1021330923 7:19338698-19338720 ATTAAAAAGAGGAAGTGGGCTGG - Intergenic
1021380467 7:19959797-19959819 AAGGTGAAGGGGAAGCAGGCAGG - Intergenic
1021467437 7:20960865-20960887 AAGCAGAGAGGGAAGTGGGGAGG - Intergenic
1021555964 7:21918316-21918338 TAGAAGAAGGGGAGTTGGGTCGG - Intronic
1021751887 7:23809089-23809111 AAGAAGAAGGTGAAGTAGCTAGG - Intronic
1022001850 7:26233494-26233516 AAGAAGAAGAAGAAGAAGGCTGG + Intergenic
1022157007 7:27670860-27670882 AAGATGAATTGGAAGTGGGTTGG - Intergenic
1022274426 7:28841823-28841845 AAGGAGAAGGGGAAGGGGAAGGG + Intergenic
1022357055 7:29625792-29625814 AAGGAGAAGGGGAAGGGGAAGGG + Intergenic
1022500153 7:30877654-30877676 AAGAAGAAGAAGAAGAGGGAAGG - Intronic
1022585558 7:31605325-31605347 AAGAAGCAGGGGAATTGTGGAGG - Intronic
1022629067 7:32068404-32068426 AAGAAGAAGAAGAAGTGGTAAGG + Intronic
1022973236 7:35536039-35536061 AGGGAGAAGGGGAAGGGAGCCGG + Intergenic
1023116566 7:36868642-36868664 CAGAATAAGGAGAAGCGGGCAGG - Intronic
1023132589 7:37017581-37017603 ATGAAGAAGTTGAAGTGGGGAGG - Intronic
1023226563 7:37975807-37975829 TAAAAGAAGGGCAAGTGGCCAGG + Intronic
1023379103 7:39588213-39588235 TAGAAGAAGGAAAAATGGGCCGG + Intronic
1023528922 7:41133573-41133595 CAGAAGAAGGGGGTGGGGGCGGG + Intergenic
1023623846 7:42097348-42097370 AAGATGGAGGGGCAGGGGGCGGG + Intronic
1023640776 7:42254742-42254764 AAGTGGAAGAGGCAGTGGGCAGG - Intergenic
1023640791 7:42254985-42255007 AAGTGGAAGGGGCAGTGGGCAGG - Intergenic
1023730229 7:43184849-43184871 AAGGTGAAGGGGAAGCAGGCAGG + Intronic
1023854645 7:44175222-44175244 AAGAAGAAGGGGAAGCAGTTAGG - Intronic
1024048642 7:45602190-45602212 GAGAGGAAGGGGATATGGGCTGG + Intronic
1024195699 7:47056842-47056864 AAGAAGAAGGCAAACTGGTCTGG - Intergenic
1024577089 7:50773399-50773421 AAGGGGAAGGGGAAGGGGACGGG + Intronic
1024582060 7:50808488-50808510 TCGAAGAAGGGGGATTGGGCTGG + Intergenic
1025117196 7:56268439-56268461 AGGAAGGAGGGGAGGTGGGAAGG - Intergenic
1026154548 7:67815735-67815757 AAAAAGAAGAGGAAGGGGGCTGG + Intergenic
1026241727 7:68581429-68581451 AAGGAGAAGGGGAAGGGGAAGGG + Intergenic
1026345810 7:69473271-69473293 GAGAAGAAGTCGAAGTGTGCAGG - Intergenic
1026828137 7:73596560-73596582 AAGAAGAAGGGGACTGGGTCTGG - Intronic
1026868677 7:73837838-73837860 AAAAAAAAGGGGGGGTGGGCAGG - Intronic
1026979314 7:74517360-74517382 AAGAAGAAGAGGAAGTGGAGAGG - Intronic
1027111489 7:75443120-75443142 AAGTAGAAATGGAAGTGGGGGGG - Intronic
1027283720 7:76627653-76627675 AAGTAGAAATGGAAGTGGGGGGG - Intergenic
1027343908 7:77237990-77238012 AAGAAGGAGGGGAAGTGATTGGG - Intronic
1027416921 7:77983519-77983541 AAAAAGAAGGGAAAGAGGGAGGG - Intergenic
1027518487 7:79172109-79172131 AAGAAGGAAGGGAAGAGGGCAGG + Intronic
1027533533 7:79366386-79366408 AAGACAAAGGGAAAGAGGGCAGG + Intronic
1027543654 7:79499941-79499963 AAAAAGAAAGGGAAGGGAGCTGG - Intergenic
1027841673 7:83320224-83320246 AAGGAGAAGGAGCAGTGGCCTGG + Intergenic
1027882216 7:83855132-83855154 AAGAAGAAGGAGAAAGAGGCAGG + Intergenic
1027902619 7:84136915-84136937 AAGAAGAAGGGGAGGAAGGAAGG + Intronic
1028192965 7:87873908-87873930 AAGAAGAAGTGAATGGGGGCAGG - Intronic
1028451799 7:90993514-90993536 AAGAAGAAGGGGAAGGAAGGAGG + Intronic
1028456487 7:91043650-91043672 ATGACGAAGGGGAAGGAGGCAGG - Intronic
1029167287 7:98601313-98601335 AAAAAGCAGTGGAAGTGGACTGG + Intergenic
1029488278 7:100856495-100856517 AAGAAGAAGGGGCAGGGCGCCGG - Intronic
1029554002 7:101255060-101255082 AAGAAGAAGGAGAAGCTGGCTGG + Intergenic
1029974793 7:104822842-104822864 AAAAAAAGGGGGCAGTGGGCTGG + Intronic
1030069409 7:105685977-105685999 AAGAAGGAGAGGAAGTGGCATGG + Intronic
1030248651 7:107415020-107415042 TAAAAGAAGGGACAGTGGGCCGG - Intronic
1030951510 7:115795941-115795963 AAGAGGAAGCGGGGGTGGGCCGG - Intergenic
1031595108 7:123640723-123640745 GAGGAGAAGGGGAAGGGGGAAGG + Intergenic
1031865992 7:127039630-127039652 AAGGAGAAGGGGAAGGGGAAGGG + Intronic
1031993023 7:128210159-128210181 GAGAAGGAGGGGAGGTGGGAGGG + Intergenic
1032131814 7:129235403-129235425 AAGAAGAATGAGAAGGAGGCTGG - Intronic
1032543340 7:132722471-132722493 AATAAGAAAAGGAAGTGTGCCGG + Intronic
1032654014 7:133907853-133907875 AAGAAGGAGGGGAAGGAGGGAGG + Intronic
1033804324 7:144937416-144937438 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
1033921953 7:146404734-146404756 AAGAAGCATGGCAAGTGGGCTGG - Intronic
1034083557 7:148302700-148302722 ATGGGGAAGGGGAAGTAGGCAGG - Intronic
1034944920 7:155255652-155255674 AAGAAGAAGGGGAAAGGGGAAGG + Intergenic
1035043988 7:155952232-155952254 GAGAAGCAGAGGAGGTGGGCAGG - Intergenic
1035109712 7:156470959-156470981 AAGGTGAAGGGGAAGCAGGCGGG - Intergenic
1035249170 7:157585734-157585756 AAGAGGAAGAGGAAGAGGGGAGG + Intronic
1035724337 8:1815198-1815220 CAGAAGAAGGGAAAGTGGAGGGG - Intergenic
1035905035 8:3500120-3500142 AAGATGAACGTGAAGTGCGCAGG - Intronic
1036446850 8:8829082-8829104 AAGGAGCTGGGAAAGTGGGCAGG - Intronic
1036718041 8:11144894-11144916 AAGGAGAAGGGGAAGGGGAAGGG + Intronic
1037052561 8:14394443-14394465 TAGAAGGTAGGGAAGTGGGCTGG - Intronic
1037497048 8:19450217-19450239 AAGAGGGAGGGGGAGGGGGCAGG + Intronic
1037660535 8:20922552-20922574 AAGAAGGAGGGGAGGTCGGCAGG - Intergenic
1037809037 8:22075310-22075332 AAGAAGAAGAAGAAGGGGGAGGG - Intronic
1038042640 8:23737997-23738019 AAGAAGAAGGGGAAGGGGAAGGG - Intergenic
1038070657 8:24008998-24009020 AAGAAGCAGGGGAAATGAGCAGG - Intergenic
1038286655 8:26211469-26211491 AAGAAGGAAGGGAACTGGGCCGG - Intergenic
1038471576 8:27827830-27827852 CATAAGAAGGGGAAGTGGCAGGG - Intronic
1038812702 8:30866366-30866388 AAGAGGAAGGGGAAGGGGAAGGG + Intronic
1039400332 8:37263654-37263676 AAGGAAAAGGGGAAGCAGGCAGG + Intergenic
1039503509 8:38034788-38034810 GGGAAGAAGGGGATGTAGGCTGG + Intronic
1039762176 8:40589866-40589888 AAGGGGAAGGGGAAGAGGACGGG - Intronic
1040288552 8:46112692-46112714 GACAAGAGGGGGGAGTGGGCGGG - Intergenic
1040796957 8:51297753-51297775 AAGAGGAAAGGCAAGGGGGCAGG - Intergenic
1041154395 8:54970132-54970154 AAGATGAAGGTGAAATTGGCAGG - Intergenic
1041225173 8:55690409-55690431 AAGAAGGAAGGGATGTGGGTTGG + Intergenic
1041267607 8:56080332-56080354 AAGAAGAAGGAGGAGGGGGAGGG + Intergenic
1041321243 8:56615138-56615160 AAGAGGAAGGGGAAGGAGGGAGG - Intergenic
1041628192 8:60055087-60055109 AAGAAGGAAGGAAAGTGGGAGGG + Intergenic
1041861420 8:62517615-62517637 AAGAAGAATGGGATGTGGGAGGG + Intronic
1042082947 8:65075923-65075945 AAGATGAAGGGGAAGAAAGCAGG + Intergenic
1042130429 8:65582486-65582508 AAGAAGGAGGAGAAGGGGGAGGG + Intergenic
1042190282 8:66178831-66178853 AGGAGGAAGGGGAAGTGGGAAGG + Intergenic
1042363898 8:67914542-67914564 AAAAAGAAGGGGAGGAAGGCTGG - Intergenic
1042614487 8:70633401-70633423 AAGCAAAAGGGGAAGTTGGTTGG - Intronic
1042663964 8:71185963-71185985 AAGAGGAAGGGAAAGAGGGAGGG - Intergenic
1042730904 8:71933936-71933958 AAGAAGAAGGGGAAGGGATGAGG - Intronic
1042827489 8:72993444-72993466 GAGAGGTAGGGGAAGTTGGCTGG + Intergenic
1042888920 8:73585585-73585607 AAGAGTAAGGGGAAGAGGTCAGG + Intronic
1042945303 8:74148093-74148115 AGGAAGATGGGCAAGTGGGGAGG - Intergenic
1043358192 8:79438768-79438790 CAGAAGAAGGAGAACTGGTCTGG + Intergenic
1043548771 8:81344852-81344874 AAGAGGAAAGGGAAGAGGGGAGG - Intergenic
1043590185 8:81822379-81822401 ACAGAGAAGGGGAGGTGGGCAGG + Intronic
1043811271 8:84744128-84744150 AAAAATAAGAGGAAATGGGCAGG + Intronic
1043938288 8:86167979-86168001 AAGGGGAAGGGGAAGGGGGAGGG + Intergenic
1044931020 8:97251702-97251724 AGGGAGTTGGGGAAGTGGGCAGG + Intergenic
1045246076 8:100442641-100442663 AGGAAGAAGGGTATGAGGGCAGG + Intergenic
1045322519 8:101092557-101092579 AAGGAGGATGGGAAGGGGGCAGG - Intergenic
1045326589 8:101121949-101121971 AATAAGAAGGAGAAATGAGCTGG - Intergenic
1045745313 8:105412204-105412226 AAAATGAAGGGGAAGGGGTCAGG - Intronic
1045985629 8:108246660-108246682 AAGAAGTAGAGGAAGTGGATGGG - Intronic
1046015600 8:108601126-108601148 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1046020744 8:108661784-108661806 AAGAAGAATGGGAATTAGCCAGG + Intronic
1046091530 8:109508487-109508509 AAGAAGGAGGGGAAGAGGGATGG + Intronic
1046373007 8:113336011-113336033 AAGGAGAAGGGAAAGAGAGCAGG - Intronic
1046592217 8:116220464-116220486 AAGAAGAAGGGAAAGAGGGAAGG - Intergenic
1046662259 8:116961007-116961029 AAGAAGGAAGGGAGGTGGGGAGG + Intronic
1046728318 8:117698154-117698176 AAGAGGAAGGGGAAGTTTACTGG + Intergenic
1046778334 8:118188014-118188036 AAGGAGAAGGGTAAATGGGTTGG + Intergenic
1047392031 8:124459987-124460009 AAGAGAAAGGGGAATTGGGATGG - Intronic
1047523724 8:125615286-125615308 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
1047574049 8:126133456-126133478 AAGTAGATGGGTAAGTGGGTGGG - Intergenic
1047692747 8:127373009-127373031 TTGAAGAAGAGAAAGTGGGCTGG + Intergenic
1048437407 8:134431422-134431444 CAGAAGACATGGAAGTGGGCAGG + Intergenic
1048588910 8:135802923-135802945 AAGAGGAAGGGGAAGGGGAAGGG - Intergenic
1048792325 8:138115236-138115258 AAGATGAAGAGGAAGTAGGAGGG + Intergenic
1048983386 8:139715368-139715390 CAGTAGAAGGGGAAGTGAGCAGG + Intergenic
1049198895 8:141330311-141330333 GAGAAGAAGAGGAAGAGGGAAGG - Intergenic
1049799985 8:144513228-144513250 AGGAAGAGGTGGCAGTGGGCAGG + Exonic
1049852533 8:144840742-144840764 GAGAAGCAGGGGAGGTGGCCAGG + Intronic
1050358547 9:4805390-4805412 AAGAAGAAGGAGAAGGGGAAGGG + Intronic
1050358550 9:4805396-4805418 AAGGAGAAGGGGAAGGGGAAGGG + Intronic
1050445890 9:5722182-5722204 AAGAAGAAGATGAAATGGGCTGG - Intronic
1050481082 9:6087331-6087353 AAGAAGAAGGGGAAATCTGTGGG + Intergenic
1050523235 9:6523518-6523540 AAGAAGAAAAGGAAGTCTGCAGG - Intergenic
1050561009 9:6834536-6834558 ACGATGAAGGGGAAGACGGCCGG - Intronic
1050569987 9:6927812-6927834 GAGAAGAATGGGAAGTGGGAAGG - Intronic
1050602040 9:7262596-7262618 CAGAAAAAAGGGAAGTAGGCAGG + Intergenic
1050685693 9:8166430-8166452 AAAAAGAAGTGGAAGTGGGAGGG + Intergenic
1050753636 9:8972494-8972516 AAGAAGAAAGGGAAGAGGAGAGG + Intronic
1050942181 9:11473235-11473257 AAGATGAAGGAGAAGTGGAGAGG + Intergenic
1051109483 9:13619577-13619599 AGGAAGAAGGGGAAGGGGCATGG - Intergenic
1051173591 9:14343319-14343341 AAGAGGAGGTGGAAATGGGCTGG + Intronic
1051184434 9:14443439-14443461 AAGAAGAAGGGCAGGTGGGTGGG - Intergenic
1051185113 9:14452336-14452358 AAGAAGGAGGGAAAGTAGGAAGG + Intergenic
1051187901 9:14479974-14479996 AGGAAGAAGGAGAAGGAGGCAGG + Intergenic
1051386741 9:16517502-16517524 AGAAAGAAGGGGCAGTGGGAGGG + Intronic
1051388932 9:16542388-16542410 AAGAAGATGGGGGAGGGGACAGG + Intronic
1051423120 9:16908524-16908546 AAAAAGAAGGGCAAGAGGGAGGG + Intergenic
1051534540 9:18142135-18142157 AAAAAGAAGGGGAAGAGGTCAGG - Intergenic
1051546737 9:18283932-18283954 AAGAAGAAGAAGAAGAAGGCTGG + Intergenic
1051662121 9:19435416-19435438 AGGAAAAAGAGGAAGGGGGCAGG + Intronic
1051782135 9:20700967-20700989 AAGAAGAATCAGAAGTGGGAAGG - Intronic
1051886572 9:21899396-21899418 AAGGAGAAGGGGAAGGGGAAGGG + Intronic
1052037443 9:23698743-23698765 AAGAAGAAGGGGGAGTGGGGCGG + Intronic
1052207504 9:25860844-25860866 AAGCAGAAGGGAAAGCAGGCAGG - Intergenic
1052900338 9:33788296-33788318 AAGAAGAGGGGGTCGTTGGCTGG - Intronic
1052976789 9:34417051-34417073 AAGGAGAAGGGGAAGGGGAAAGG - Intronic
1052976791 9:34417057-34417079 AAGAAGAAGGAGAAGGGGAAGGG - Intronic
1053072459 9:35109326-35109348 AACAAGAAGGGGAAGGGGAAGGG + Exonic
1053144865 9:35705506-35705528 AGGAACAAGGGGCAGGGGGCAGG + Intronic
1053157075 9:35788962-35788984 AAGACAAAAGGGAAGTGGGAAGG - Intergenic
1053324245 9:37128353-37128375 AAGCAGAAGTGGGAGAGGGCGGG + Intronic
1053453742 9:38214719-38214741 AAGGAGAAGGGGAAAGGGGTTGG + Intergenic
1053516303 9:38733572-38733594 AAGATGAAAGGGCGGTGGGCAGG + Intergenic
1053618614 9:39794258-39794280 AGGAAGACGAGGAAGTGGGAGGG - Intergenic
1054265541 9:62913171-62913193 AGGAAGACGAGGAAGTGGGAGGG + Intergenic
1054746827 9:68862495-68862517 AAGAAAAGCTGGAAGTGGGCCGG + Intronic
1054909231 9:70438703-70438725 AGCAAGCAGGGGAAATGGGCGGG + Intergenic
1054979735 9:71191414-71191436 AGGAAGAAATGGAAGTGAGCTGG - Intronic
1055706337 9:79008908-79008930 AAGAAGAAAGGAAAGAAGGCAGG + Intergenic
1055822078 9:80277919-80277941 AAGAAAAAGGGTAAGAGGGAAGG - Intergenic
1056501435 9:87213767-87213789 AGGGAGAAAGGGAAGTGAGCTGG - Intergenic
1056672543 9:88642815-88642837 AAGGAGAAGGGGAAGAGGAAGGG - Intergenic
1056779094 9:89535924-89535946 AAGAGGAAGGGGGAGAGGGTGGG + Intergenic
1057037204 9:91820028-91820050 AAGAAGAAGGGGCAGTAAGAAGG + Intronic
1057230470 9:93318653-93318675 GAGAAGGGAGGGAAGTGGGCAGG - Intronic
1057624430 9:96665068-96665090 CAAAAGCAGGGAAAGTGGGCGGG - Intergenic
1058115297 9:101078177-101078199 AAGAAGAAGAGGAGGGGGGGAGG + Intronic
1058328512 9:103728184-103728206 AGGAAGAGTGGGAAGGGGGCAGG - Intergenic
1058965165 9:110030712-110030734 AATAAAAAGGGCAAGGGGGCAGG - Intronic
1059284202 9:113158872-113158894 CATAAGAAGGGGATGTGGGGTGG + Intronic
1059771938 9:117434851-117434873 AAGTGGAAGGGGAAGTGAGGAGG + Intergenic
1059777377 9:117489054-117489076 CAGAAGAAGAGGAACTGGGCTGG - Intergenic
1059808067 9:117826240-117826262 CAGAAGAAGGGGAAGTAGTGGGG + Intergenic
1060013365 9:120064437-120064459 AAGGAGAAGGGGAAGTGAGCAGG - Intergenic
1060619271 9:125048561-125048583 AAGAAGAAGAAGAAAAGGGCAGG + Intronic
1061183053 9:129036465-129036487 TAGGAGGAGGGGAAGAGGGCGGG + Intergenic
1061286473 9:129626245-129626267 AAGAAGATGGGGAAGAGGAAGGG - Exonic
1061347268 9:130036747-130036769 AAGAAAAAGGAGCAGTAGGCCGG + Intronic
1061383282 9:130272534-130272556 AAGAAGAAGAAGAAGAGGCCAGG - Intergenic
1061979031 9:134089314-134089336 AAGAAGAAGGGAAAGATGGCTGG + Intergenic
1062123625 9:134847875-134847897 GAGAGGAAGGGGAAGTGGGAGGG + Intergenic
1062532228 9:137007018-137007040 AAGGCTAAGGGGAAGGGGGCCGG + Intergenic
1203753005 Un_GL000218v1:97438-97460 AGGAAAATGGCGAAGTGGGCGGG + Intergenic
1185510425 X:660049-660071 AAGAAGAAGAAGAAGAAGGCTGG - Intergenic
1185540489 X:899393-899415 AAGGGGAAGGGGAAGTGGAAGGG - Intergenic
1185704825 X:2258977-2258999 AAAAATAGGGGGAAGTGGCCGGG + Intronic
1186047099 X:5548526-5548548 AAGAAGAAGAGGAGGAGGGGAGG - Intergenic
1186189401 X:7054119-7054141 AATAAGAAGGTGACGTAGGCTGG + Intronic
1186219314 X:7332628-7332650 AAGTAAGAGAGGAAGTGGGCAGG - Intronic
1186771084 X:12818816-12818838 AACAGGAAGAGAAAGTGGGCAGG - Intronic
1186908748 X:14139049-14139071 AAGGAGAAGGGGGAGAAGGCAGG + Intergenic
1187128873 X:16481677-16481699 GAGAGGGAGGGGAAGTGGGAAGG - Intergenic
1187228711 X:17399744-17399766 AATAAGATGGGGAAGATGGCTGG + Intronic
1188529970 X:31129064-31129086 AAGACAAAAGGGAAGTGTGCTGG + Intronic
1189110544 X:38285930-38285952 AAGAGGAAGGGGAAGTGGAAGGG - Exonic
1189512975 X:41682255-41682277 AAAAAGAAGGTGAAGGGGTCAGG + Intronic
1189650840 X:43187938-43187960 AAGAAGAAGTAGAAGGGGGCAGG + Intergenic
1189684401 X:43548820-43548842 AAGGAGAAGGGGAAGGGGAAGGG + Intergenic
1189805108 X:44727709-44727731 AAGAAGAAGAAGAAGAAGGCCGG + Intergenic
1189914487 X:45843346-45843368 AAGAACATGGGGCAGTGGGAGGG + Intergenic
1190067802 X:47254089-47254111 AAGAAGACTGGGAAGCGGCCGGG - Intergenic
1190549996 X:51570276-51570298 AAGAAAAAGGGGAAGGGGCCAGG - Intergenic
1190561953 X:51694986-51695008 AAGGAGAAGGGGAAGGGGAAGGG + Intergenic
1190748139 X:53338816-53338838 AAGAGGAAAGGGAAGTGGGAGGG - Intergenic
1190798815 X:53770024-53770046 AAGAGGAAAGGGAAGTGGGAGGG - Intergenic
1190814831 X:53920703-53920725 AAGAGGAAGAGGAAGAGGACAGG + Intergenic
1190935823 X:54998376-54998398 AGAAAGAAGGGAAAGTAGGCAGG - Intronic
1190962071 X:55262066-55262088 AAGAATAATGGGAAGTGGAATGG + Intronic
1191197258 X:57737470-57737492 AAGAAGGAGGAGAAGAGAGCAGG + Intergenic
1191851121 X:65587221-65587243 AAGGGGAAGGGAAAGGGGGCGGG + Intergenic
1191856807 X:65633971-65633993 GTGAAGAAGGGGATGTGGTCTGG - Intronic
1191865089 X:65697505-65697527 AAGAGGAAGGGGCAGTGAGGAGG - Intronic
1192448953 X:71230885-71230907 AAGGAGAAGGGGAAGGGGAAGGG + Intergenic
1192448964 X:71230910-71230932 AGGAAGAGGGGGAAGGGGGAAGG + Intergenic
1192726216 X:73755620-73755642 CAGAAGAAGGGAGAGTGGGAGGG - Intergenic
1193169767 X:78322012-78322034 AAGCAGAAGAGGAAGTGGGGAGG + Intronic
1193463135 X:81813655-81813677 AAGGTGAAGGGGAAGCAGGCAGG - Intergenic
1193876531 X:86868934-86868956 AGGAAGAGTGGGCAGTGGGCAGG - Intergenic
1194965233 X:100280770-100280792 AAGAATAGTGGGAAGTGGGTGGG - Intergenic
1195054433 X:101129524-101129546 AAGAAGAAGAAGAATTGGCCTGG - Intronic
1195329463 X:103785553-103785575 AAGAAGAAGGGGAAACAGTCAGG - Intronic
1195364276 X:104112419-104112441 AGCAAGAAGGGGGAGCGGGCCGG - Intronic
1195370099 X:104165388-104165410 AGGAAGAAGAGAAAGAGGGCAGG - Intergenic
1195769026 X:108329055-108329077 AAGAAGAGTGGGAAGGGGGCTGG + Intronic
1195802642 X:108731206-108731228 GAGAAAAAGGGGATGTGGGGGGG + Intronic
1196500677 X:116377721-116377743 AAGAAATAGGGCAAGTGGGTGGG - Intergenic
1196727057 X:118905257-118905279 AAGAAGAAGGGGAAGGGGAAGGG - Intergenic
1196810513 X:119625487-119625509 AGCAGGAAGGGGAAGTGGGAAGG + Intronic
1197712417 X:129681050-129681072 AAGTAGAAGGGTCAGTGGGCTGG - Intergenic
1197721866 X:129750716-129750738 ACCAAGAAGGGTAAGGGGGCAGG + Intronic
1197764273 X:130049747-130049769 AAGAACATGGGGAAATGGCCAGG - Intronic
1198187463 X:134267248-134267270 AAGGACAAGGGGAAGTGGCAGGG + Intergenic
1198963825 X:142207645-142207667 AAGGGGTTGGGGAAGTGGGCAGG - Intergenic
1198963843 X:142207710-142207732 AAGGAGGCAGGGAAGTGGGCAGG - Intergenic
1199038812 X:143085757-143085779 AAGAAGAAAGGGAAGAAGGAAGG + Intergenic
1200137651 X:153882847-153882869 AAGAACACGGGGACCTGGGCTGG + Intronic
1200415573 Y:2906590-2906612 AAGAAGAAGGAGGAGAGGGGAGG - Intronic
1200808478 Y:7457813-7457835 AATAGGAGGAGGAAGTGGGCTGG + Intergenic
1200934335 Y:8725026-8725048 AAGAAGAAGGTAAATTGTGCTGG + Intergenic
1201166647 Y:11215008-11215030 AGGAAAATGGCGAAGTGGGCGGG + Intergenic
1201458929 Y:14201326-14201348 ATAAGGAAGGGGAAGTGGGGAGG + Intergenic
1201588892 Y:15591859-15591881 AAGTAAGAGGGGAAGTGGGCAGG - Intergenic
1202038367 Y:20658239-20658261 AAAATGAAGGTGAAGTGGGCCGG + Intergenic