ID: 981756655

View in Genome Browser
Species Human (GRCh38)
Location 4:148147202-148147224
Sequence ATGGAGGAAAGGTGGGAAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 835
Summary {0: 1, 1: 0, 2: 4, 3: 79, 4: 751}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981756655_981756662 14 Left 981756655 4:148147202-148147224 CCTATTTCCCACCTTTCCTCCAT 0: 1
1: 0
2: 4
3: 79
4: 751
Right 981756662 4:148147239-148147261 ATACCGAAGAATAAGATCTTTGG 0: 1
1: 0
2: 0
3: 6
4: 114
981756655_981756663 15 Left 981756655 4:148147202-148147224 CCTATTTCCCACCTTTCCTCCAT 0: 1
1: 0
2: 4
3: 79
4: 751
Right 981756663 4:148147240-148147262 TACCGAAGAATAAGATCTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981756655 Original CRISPR ATGGAGGAAAGGTGGGAAAT AGG (reversed) Intronic
900069869 1:762669-762691 AAGGAGGGAAGGAGGGAAAAAGG + Intergenic
902107447 1:14049649-14049671 AGGGAGAAAAGGAGGGAAAAGGG - Intergenic
902692005 1:18115775-18115797 AGGGAGGAAAGGAAGGAAAAAGG + Intronic
902793908 1:18787926-18787948 AAGGAGGGAAGGAGGGAAAAAGG + Intergenic
903355234 1:22742336-22742358 ATGGAGGAAAGTTGGTAGAAAGG + Intronic
903677638 1:25074447-25074469 AAGGAGGAAAGGAGGGAAGGAGG + Intergenic
903976432 1:27153425-27153447 ATGAAGGAAAGGTGGGAATATGG + Intronic
904155554 1:28479934-28479956 GTAGAGGAAAGGTGGCACATGGG + Intronic
905509312 1:38505977-38505999 GTGGTGGGAAGATGGGAAATTGG + Intergenic
905530052 1:38670867-38670889 ATAGAGGAAGGGTGGGGAAATGG - Intergenic
905963645 1:42068672-42068694 ATCAAGGAAAGGAGGAAAATGGG + Intergenic
906348693 1:45038471-45038493 AGGAAAGGAAGGTGGGAAATGGG + Intronic
906770728 1:48479795-48479817 AGGGGGGAAAGGTGGGGAAAAGG + Intergenic
906789968 1:48650497-48650519 AAGGAGGCAAGGAGGGAGATAGG - Intronic
906800800 1:48735383-48735405 ATGGAGGGAGGGTGGGAGAGAGG + Intronic
906843562 1:49165684-49165706 ATGGAGGAAAGGAGGGAGGATGG + Intronic
907069881 1:51524780-51524802 AGAGAGGAAAGGAAGGAAATAGG - Intergenic
907076630 1:51584907-51584929 ATGGGGAAAAGGTGGGCATTTGG + Intronic
907517206 1:55000330-55000352 AGGGAGAAAAGGAGGGAAATAGG + Intronic
908066027 1:60405449-60405471 AGGGTGGGAAGGTGGGAAGTGGG + Intergenic
908119963 1:60976769-60976791 AAGAAGGAAAGGGAGGAAATAGG - Intronic
908181086 1:61606674-61606696 ATGGAAGAAAGGAGGGGAACTGG + Intergenic
908313290 1:62907225-62907247 ATGGAGTAAAGGTTGGAATTTGG - Intergenic
908793394 1:67805243-67805265 ATGAAGGAAATGTGATAAATAGG - Intronic
908843426 1:68300787-68300809 ATGGAGGAAAGAAGGGAAGGAGG - Intergenic
908921752 1:69202771-69202793 AGGGAGGAAAGGAGGGAAGGAGG + Intergenic
909055625 1:70817284-70817306 AGGGAGGGAGGGAGGGAAATGGG + Intergenic
909294978 1:73936094-73936116 ATAAAGGAAAGGTGAGTAATAGG + Intergenic
909373044 1:74909112-74909134 GTGGGGTAAAGGTGGGAGATAGG - Intergenic
909655441 1:78026707-78026729 ATGGAGGAAAGGTGGGAATGGGG - Intronic
909655535 1:78027865-78027887 ATGGAGGAGAGGTGGGAATGGGG - Intronic
909764425 1:79337805-79337827 AGGAAGAAAAGGTGGGAAAGGGG - Intergenic
909843667 1:80362518-80362540 ATGGGGGGAAGGTGGGAAGAGGG - Intergenic
909892310 1:81022854-81022876 ATGAAGGAAAGGAGGCAATTTGG - Intergenic
910613745 1:89173901-89173923 ATGGAGGATGGGTGGGAATGTGG - Intronic
910820056 1:91336390-91336412 ATGGAGGTAAGGAGGGAAAGGGG - Intronic
910955509 1:92699320-92699342 ATTTAGGAAAGATTGGAAATGGG - Intronic
911210914 1:95137243-95137265 TTGGAGTCAATGTGGGAAATAGG + Intronic
911978247 1:104531150-104531172 ATGGAAGAATTGTGGGACATAGG - Intergenic
912246858 1:107968675-107968697 GTGAAGGCAAGTTGGGAAATAGG + Intergenic
912865975 1:113256689-113256711 ATGGAAGAAATATGGGAAAAAGG - Intergenic
912972147 1:114293672-114293694 CTGGAGGAAGGCTGGGAAACTGG - Intergenic
913707542 1:121441835-121441857 ATGGAGGAAGGGATGGAAAAGGG - Intergenic
914343752 1:146781059-146781081 ATGAAGGGAAGGAGAGAAATGGG - Intergenic
914681670 1:149943392-149943414 GTGGAGGGGAAGTGGGAAATTGG - Exonic
914689071 1:150009970-150009992 ATGGAGGAAAGGCGAGAAAAAGG - Intronic
915013589 1:152712785-152712807 ATGGAGGTAAGGAGGGAGACAGG + Intergenic
915328690 1:155094858-155094880 AAGGCGGAGAGGTGGGGAATGGG - Intergenic
915482491 1:156196449-156196471 ATGGAGACAAGGTGGGAAATCGG + Intronic
915739773 1:158110013-158110035 GTGGAGGGAAGGAGAGAAATTGG - Intergenic
915938291 1:160101608-160101630 ATGGAGGGCAGGTGGGAAGCTGG - Intergenic
916064027 1:161121583-161121605 ATGGAGGAAAGGCGGCAGAGAGG + Exonic
916177825 1:162057288-162057310 ATGGAGAATATGTGGGGAATGGG + Intergenic
916208702 1:162340659-162340681 AGGGAGGATAGGAAGGAAATGGG + Intronic
916391816 1:164339613-164339635 TTGGAGTAAATGAGGGAAATAGG - Intergenic
917149891 1:171932043-171932065 ATGGAGGGAGGGTGGGGGATGGG - Intronic
917782306 1:178411394-178411416 TGGGAGGAAGGGTGGGAGATGGG + Intronic
918103215 1:181394604-181394626 ATGGGGGAAAAGGGGAAAATAGG + Intergenic
918317030 1:183331022-183331044 AGGAAGGAAGGGTGGGAAAAAGG - Intronic
918802011 1:188984800-188984822 AGGGAGGAAGGGTGGGAGAGAGG - Intergenic
919221134 1:194629914-194629936 AAGGAGGGAAGGAGGGAAAGAGG + Intergenic
919293364 1:195662582-195662604 AAGGAGGTAAGGTGATAAATTGG - Intergenic
919415678 1:197306007-197306029 ATGGATGATAGGTGGGGAAAAGG + Intronic
919847710 1:201651918-201651940 AGGGAGGAAAGGAGGGGAGTTGG + Intronic
920566809 1:206980631-206980653 AAGGAGGAAAGTTGGGAAAAGGG + Intergenic
920608632 1:207415075-207415097 AGGAAGGAAATGGGGGAAATTGG + Intergenic
921247124 1:213256287-213256309 ATCCAGGAAAGATGGAAAATGGG + Intronic
921831966 1:219737564-219737586 ATGGAGTAAAGCTGGGAGAGGGG - Intronic
922265552 1:223980657-223980679 AAGGAGGGAAGGAGGGAAAAAGG + Intergenic
922286137 1:224172440-224172462 AAGGAAGAAAGGTGGGAAGGAGG + Intergenic
922790569 1:228308713-228308735 ATGGATGACAGGTGGGTAAATGG - Intronic
923268464 1:232334557-232334579 ACTGAGGAAAGGTAGGAAAAGGG - Intergenic
923523308 1:234752803-234752825 ATGGAGGGGAGGTGGGAAGTAGG + Intergenic
923850826 1:237792523-237792545 ATGGAGGAAGGATGGGACAGAGG + Intronic
923970830 1:239201491-239201513 ATGAAGGAAATCTTGGAAATGGG + Intergenic
924044218 1:240011299-240011321 ATGGAGGAAAGTTGGGACAAGGG - Intergenic
924202608 1:241675194-241675216 AGGGAGGAAGGGAGGGAAGTTGG - Intronic
924328677 1:242921185-242921207 ATGGAGGGGAGGAGGGAGATGGG + Intergenic
924347412 1:243085656-243085678 AAGGAGGGAAGGAGGGAAAAAGG + Intergenic
1062922863 10:1293084-1293106 AGGGAGGAAAGGAGGGAAGGGGG + Intronic
1063193326 10:3718064-3718086 AGGGAGGGAAGGAGGGAAGTGGG + Intergenic
1063338820 10:5243892-5243914 AGGGAGGAAAGGTGGGAGGAGGG + Intergenic
1063549580 10:7017672-7017694 ATGGAGCAAGGATGGGAACTGGG - Intergenic
1063827028 10:9909448-9909470 ATGTAGCAAAGATGGGAAAAGGG + Intergenic
1064016070 10:11773272-11773294 ATGGAGGACTGGTGGGAAGGTGG - Intergenic
1064063358 10:12158800-12158822 CTGGAGGCAGGGTGGGAGATAGG - Intronic
1064188596 10:13185660-13185682 ATGAAGGAAAGGATGGAAAATGG + Intronic
1065016002 10:21463400-21463422 ATGGGGGACAGGTGAAAAATGGG + Intergenic
1065198162 10:23286635-23286657 AGGGAGGAAAGGAGGGAGAAAGG + Intronic
1065450159 10:25848421-25848443 AGGGAGGAAGGGAGGGAAAAGGG + Intergenic
1066279274 10:33899247-33899269 AGGGATGAAAGGTTGGAGATGGG - Intergenic
1066282777 10:33933878-33933900 ATGGAGGAAAGGGTGGGAATGGG + Intergenic
1066290884 10:34013465-34013487 AAGGAGGAAAGGAGGGAGAGAGG - Intergenic
1066695292 10:38071950-38071972 ATGGAGGAAGGATGGCAAAGAGG - Intergenic
1067037665 10:42932105-42932127 CTGGAGGAAAGGTGGTCATTGGG + Intergenic
1067166135 10:43867962-43867984 ATAGAGGGAAGGTGGCAAACAGG - Intergenic
1067720305 10:48723126-48723148 AGGGTGGAAAGGAGGGAAAAGGG - Intronic
1069078456 10:64063352-64063374 ATGCAGGAAAGCTGGGAGGTGGG - Intergenic
1069347837 10:67490581-67490603 GTGGAGGGATGGTGGGAGATGGG + Intronic
1069536224 10:69255371-69255393 ATGGAGGGAAGGAGGGAGACTGG + Intronic
1069771495 10:70903400-70903422 ATGGAGCAGAGCTGGGAACTGGG - Intergenic
1070403384 10:76073489-76073511 ATCCAGGAACGGTGGGAAAATGG - Intronic
1070597904 10:77845589-77845611 ATGGAGGGAAGGAGGGAAGAAGG + Intronic
1070653422 10:78254320-78254342 ATGGAGGAAAGCCATGAAATAGG - Intergenic
1071042485 10:81330316-81330338 ATGGAGGAAAAGAGGGAGAAGGG + Intergenic
1071444829 10:85736016-85736038 AGGGAGGGAAGGAGGGAAGTAGG + Intronic
1071827088 10:89336127-89336149 AGGGAGGAAAGAAGGAAAATAGG + Intronic
1071827108 10:89336188-89336210 AGGGAGGAAAGAAGGAAAATAGG + Intronic
1072195874 10:93116827-93116849 ATGGAGGGAACCTGAGAAATCGG + Intergenic
1072210091 10:93238591-93238613 AGGGAGGAAAGAGGGGAAATAGG - Intergenic
1072754740 10:98011787-98011809 AGGGAGGAAGGGAGGGAGATGGG + Intronic
1072809117 10:98446022-98446044 AAGAAGGGAAGCTGGGAAATAGG - Intronic
1073463413 10:103679533-103679555 ATGGAGGAAGGGTGGGGGAGAGG + Intronic
1073812149 10:107163877-107163899 ATGGAGAATTGGGGGGAAATAGG - Intronic
1074886633 10:117699205-117699227 ATGGAGGAAAGGTGGGCAGAGGG + Intergenic
1074963126 10:118465611-118465633 AAGGAGGAAAGGAGGGAAGGAGG + Intergenic
1075167853 10:120085335-120085357 GTGGAGGGGAGGAGGGAAATGGG + Intergenic
1075283037 10:121157584-121157606 ATGGAGGAAGGGTGGAAAGAGGG + Intergenic
1075411910 10:122234324-122234346 GTGGAGTGAAGGTTGGAAATTGG + Intronic
1075872336 10:125779888-125779910 GTGGGGGAAAGGTGGGACCTGGG + Intergenic
1076141275 10:128080331-128080353 AGGGAGGACAGGTGCGAAGTGGG - Intronic
1076282020 10:129254541-129254563 ATCTATGAAAGGTGGGAAAATGG - Intergenic
1076348523 10:129797558-129797580 GAGGAGGAAAGGTGGGAATGAGG - Intergenic
1077325263 11:1961025-1961047 TTGCAGGAAAGGTGGGAGGTGGG - Intronic
1077539953 11:3141868-3141890 ATGGAGAGAAAGTGGGAAAATGG - Intronic
1077597784 11:3548902-3548924 GTGGAGGAAAGGTAGGGGATAGG + Intergenic
1077765135 11:5150660-5150682 AAGGAAGAGAGGTGGGGAATGGG - Intergenic
1078201447 11:9187621-9187643 ATGGGGGAAAAGTAGGAAAAAGG + Intronic
1078852633 11:15178492-15178514 TTGGAGGAAAGGAGAGAAAGAGG + Intronic
1079152921 11:17917412-17917434 AGGGGGGAAGGGTGGGAAGTGGG + Intronic
1079300018 11:19269616-19269638 AAGGAGGAAAAGTGAGGAATTGG - Intergenic
1079419027 11:20268845-20268867 ATGAAGGAAAGGGGGAAAAAGGG + Intergenic
1079497730 11:21064652-21064674 ATGGAGGAAGGATGGGAAAGTGG + Intronic
1079520686 11:21322880-21322902 ATGGAGGCAAAGCAGGAAATTGG - Intronic
1079645597 11:22860702-22860724 GGGTAGAAAAGGTGGGAAATTGG - Intergenic
1080212821 11:29806715-29806737 AATGAGGAAAGGTGGGAAAGAGG + Intergenic
1080558195 11:33436809-33436831 ATGGAGGAAGGGCAGGAAAGGGG + Intergenic
1080685080 11:34508733-34508755 GTGGAGGCGAGGAGGGAAATTGG - Intronic
1081145566 11:39559216-39559238 CTGGGGTAGAGGTGGGAAATAGG - Intergenic
1081686600 11:45047436-45047458 ACTGGGCAAAGGTGGGAAATGGG - Intergenic
1082071922 11:47946248-47946270 AAGGAGGAAAAGTGGGAAAGGGG + Intergenic
1082650839 11:55790678-55790700 ATGGTGGAAATGTGGGAAATGGG - Intergenic
1082707849 11:56515003-56515025 AGGAAGGAGAGGTGAGAAATAGG - Intergenic
1082735264 11:56847953-56847975 ACAGAGGACAGGTGGAAAATAGG + Intergenic
1082761878 11:57135375-57135397 AGGCAGGAAAGGAGGGAAAGAGG + Intergenic
1082763653 11:57149464-57149486 AAAGAGGAAGGGTGGGAAACCGG + Intergenic
1083909738 11:65699323-65699345 ATGGAGGAGAGGAGGCAAAGGGG + Intergenic
1084134429 11:67165620-67165642 ATGTAGCAAAGCTGGAAAATAGG + Intronic
1084157626 11:67323001-67323023 AGGGAGGAGAGGAGGGAAAGAGG - Intronic
1084253872 11:67924810-67924832 GTGGAGGAAAGGTAGGGGATAGG + Intergenic
1084340743 11:68498359-68498381 ATAGAAGAGAAGTGGGAAATGGG - Intronic
1084772644 11:71353836-71353858 ATGGAGGGAGGGAGGGAAAGAGG + Intergenic
1084928693 11:72535978-72536000 AGGGAGGAATGTTGGGAAAAAGG + Intergenic
1085024812 11:73230244-73230266 ATGGAGGAACGGTGGGGAGGAGG - Intronic
1085150685 11:74250837-74250859 ATTGAGGTGAGGTTGGAAATGGG + Intronic
1085993525 11:81881593-81881615 TTGGAAGAATGGTGGGAAACAGG - Intergenic
1086266944 11:85011316-85011338 ATGGAGAAAATGAGGAAAATGGG - Intronic
1086537437 11:87865115-87865137 ATGGAGGAAATGGGGGAAAAGGG + Intergenic
1086638257 11:89118368-89118390 CTGGAGAAGATGTGGGAAATAGG + Intergenic
1086659512 11:89397361-89397383 AAGGAGGAAAGGTCTAAAATTGG + Intronic
1086957831 11:92952090-92952112 ACAGAGGAAAAGTTGGAAATGGG - Intergenic
1086960090 11:92972543-92972565 GTGGAGGCAAGGTGGGAGGTAGG + Intronic
1087350651 11:97027676-97027698 ATGCAGGAAAGGAGAGAAGTAGG - Intergenic
1087382637 11:97426218-97426240 ATGGAGGGAAGTTGCCAAATTGG + Intergenic
1087481799 11:98710910-98710932 ACAGAGGAAAGGTGAGAAATAGG - Intergenic
1087922444 11:103882147-103882169 ATGGAGCAAAGGTGGAGAAATGG - Intergenic
1088079398 11:105892445-105892467 GTGGAGGATAGGTAAGAAATAGG - Intronic
1088183896 11:107142396-107142418 AAGGAGGAAAAGAGGGAAAGGGG - Intergenic
1089029380 11:115308759-115308781 AGGGAGGGAAGGAGGGAAAGAGG - Intronic
1089219431 11:116858521-116858543 TGGGAGGGAAGGTGGGGAATTGG + Intronic
1089221115 11:116872766-116872788 ATGGATTAAAGGAGGGAAAAGGG + Intronic
1089460957 11:118653224-118653246 AAGGAGGAAATGTCAGAAATGGG + Intronic
1089489778 11:118875250-118875272 AAGGAGGAAAGGAGGGAAGGAGG + Intergenic
1089492143 11:118890491-118890513 TTGGAGGAAGGGTGGAAATTAGG + Intronic
1090461929 11:126898916-126898938 TTGGAGGACAGTTGGGAAAGGGG - Intronic
1090890061 11:130915669-130915691 ATGGAGGACAGGTGGCCAACGGG + Exonic
1090948235 11:131450188-131450210 AAGGAGGGAAGGTGGGACCTGGG - Intronic
1091021229 11:132101971-132101993 CTGTAGGAATGGTGGGAAATGGG - Intronic
1202808244 11_KI270721v1_random:16204-16226 TTGCAGGAAAGGTGGGAGGTGGG - Intergenic
1091507105 12:1082840-1082862 TTTGAGGGAATGTGGGAAATGGG - Intronic
1091856703 12:3746391-3746413 GTGGAGGAAGGGTGGGGAAGAGG - Intronic
1092423942 12:8358199-8358221 GTGGAGGAAAGGTAGGGGATAGG + Intergenic
1093362208 12:18243711-18243733 ATGGAGGAATTATAGGAAATGGG - Intronic
1093632584 12:21427130-21427152 ATAGAGAAAAGGTGGCAAATTGG + Intergenic
1093984327 12:25512350-25512372 AGGGAGCAAAGGAGGGGAATAGG + Intronic
1094715322 12:33008198-33008220 AAGGAGGAAGGGAGGGAAAGAGG - Intergenic
1095238793 12:39832541-39832563 AAGCAGGAAAAGTGGGAAGTTGG - Intronic
1095401532 12:41819771-41819793 ATTGAGGAAAGGTGGGATAGAGG + Intergenic
1096262112 12:50099462-50099484 GTGGAGGGAAGGAAGGAAATTGG - Exonic
1096524793 12:52204030-52204052 ATGGAGGAGAGCTGGGCAAGGGG + Intergenic
1096869483 12:54584320-54584342 TCTGAGGGAAGGTGGGAAATGGG + Exonic
1096943188 12:55372461-55372483 AAGGAGGAAAGGAGGGAAGGAGG + Intergenic
1098258828 12:68646672-68646694 GTGGAGGAAGGGTGGAGAATTGG + Intronic
1099068798 12:78018968-78018990 ATGGGGGATATGTGAGAAATTGG + Intronic
1100691809 12:97046409-97046431 ATGGTGGAATGGTGGGAGATGGG - Intergenic
1101222147 12:102652734-102652756 GTTGAGGAGAGGTGGGAGATTGG + Intergenic
1101825520 12:108217424-108217446 ATGCAGGAAATGAGGGAAGTGGG + Intronic
1102097234 12:110250383-110250405 AGAGAGGGAAGGTGGGAGATTGG - Intergenic
1102598063 12:114007949-114007971 AAGGAGGAAATGTGTGAAAATGG - Intergenic
1102669189 12:114602588-114602610 AAGGAGGAAAGGAGGGAGAAAGG + Intergenic
1102697324 12:114809978-114810000 TTGGACGAGAGGTGAGAAATGGG + Intergenic
1102715268 12:114965660-114965682 ATGGAGGAATGGGTGGAAAATGG - Intergenic
1102717425 12:114986386-114986408 AGGGAGGAAAGGAGGGAAAAAGG - Intergenic
1103164321 12:118757157-118757179 AGGGAGGAAAGGCAGGAAAGAGG + Intergenic
1104386495 12:128355679-128355701 GTGGAGGAAAGGAGGGAATAAGG - Intronic
1104541927 12:129673763-129673785 AAGGAGCAAAGGTTGGAAATTGG - Intronic
1104668841 12:130666944-130666966 AGGGAGGAAAGGAGGGAGAGAGG + Intronic
1105272971 13:18894959-18894981 ATAGAGGACAGGTGGCCAATGGG + Intergenic
1105694406 13:22873584-22873606 ATGGAGGGAGGGAGGGAAAGAGG - Intergenic
1105860701 13:24409463-24409485 GAGGAGGAAGGGTGGGAGATAGG + Intergenic
1106153348 13:27127595-27127617 ATGGAGGGTAGGTGGGAGAATGG - Intronic
1106264057 13:28093904-28093926 AAGGAGGAAGGGTGGGAAGGAGG + Intronic
1106299412 13:28450522-28450544 AGGGAGGAAAGGAGGGAGAGAGG + Intronic
1106312670 13:28567536-28567558 ATGGAGGAAAGATGGTAGGTGGG + Intergenic
1107007510 13:35630936-35630958 AGGGGGGAATGGTGGGAAGTGGG - Intronic
1107107437 13:36660281-36660303 ATGAAGGAAAGAGGAGAAATGGG + Intergenic
1107222540 13:38002397-38002419 ATGAAGGAAAGGTGGTTAAAGGG - Intergenic
1107549028 13:41457932-41457954 GTGGAGGGAAGGTGGGACATGGG - Intronic
1107819980 13:44277383-44277405 AGGGAGGAAAGGGAGGAAAGGGG + Intergenic
1107917659 13:45168951-45168973 AAGGAGGTAAGGAGGGAAAGAGG - Intronic
1107917673 13:45168994-45169016 AAGGAGGGAAGGAGGGAAAGAGG - Intronic
1108563512 13:51670868-51670890 TTCGAGGAAAGGTGGGCAAGTGG - Intronic
1110325751 13:74213567-74213589 AGGGAGGAAAGGAGGGAAAGAGG - Intergenic
1110619676 13:77581492-77581514 AGGGAGGAGAGGTGGGAATCTGG - Intronic
1110756071 13:79175726-79175748 ATGGAGAAAAGTTGGAGAATGGG + Intergenic
1111919269 13:94393652-94393674 AGGGAGGAATGGGGAGAAATGGG - Intronic
1112109994 13:96285914-96285936 AGGGAGGGAAGGAGGGAAAGTGG - Intronic
1112211059 13:97377531-97377553 TTGGAGAAAAGGAGGGAATTAGG - Intronic
1112651821 13:101407952-101407974 ATTGAGGCATGGTGAGAAATAGG - Intronic
1114415568 14:22540989-22541011 AAGGAGGAAAGGAGGGAAGGAGG + Intergenic
1114587146 14:23825581-23825603 ATGGGGTGAGGGTGGGAAATGGG - Intergenic
1114724451 14:24920697-24920719 ATTGAGGAGATGTTGGAAATGGG - Intronic
1114732186 14:25004730-25004752 ATTGAGGAAAAGAGGGAAAGAGG + Intronic
1115026790 14:28756113-28756135 AAGGAGGGAAGGAGGGAAAGAGG + Intergenic
1115071483 14:29328224-29328246 AGGAAGGAAGGGAGGGAAATGGG + Intergenic
1115316420 14:32029506-32029528 AAGGAGAAAAGCTGGGAATTTGG + Intergenic
1117422444 14:55560211-55560233 ATGGACTAAAAGTGGGAAAGAGG - Intronic
1118936952 14:70297205-70297227 AAGAAGGAAATGTGGGAAATGGG + Intergenic
1119186128 14:72643765-72643787 ATGGAGGTGTGGTGTGAAATTGG - Intronic
1119274963 14:73346835-73346857 CAGGAGCAAAGGTGGAAAATAGG - Intronic
1119431207 14:74569149-74569171 ATGGAGGGAAGGAGGGAAGAAGG + Intronic
1119724703 14:76914917-76914939 AGGGAGGAAAGGTCTGAAAGAGG + Intergenic
1119816480 14:77573205-77573227 ATGAAGAAAAGCTGGTAAATGGG + Intronic
1120803845 14:88723441-88723463 TAGGAGTACAGGTGGGAAATGGG + Intronic
1121167156 14:91814665-91814687 AAGGAGGAAAGATGAGAAAAGGG + Intronic
1121226069 14:92322966-92322988 ATGGAAGAAAGGAGAGAAAAAGG + Intronic
1121892279 14:97605366-97605388 GTGCAGGAGAGGTGGGAAAGTGG - Intergenic
1121943069 14:98091923-98091945 ATTGAAAAAAGGTAGGAAATGGG - Intergenic
1122000824 14:98651024-98651046 AGGGAGGTAAGCTGGGAATTCGG + Intergenic
1122874068 14:104655180-104655202 AGGGAGGAAAGGAGGGAAGGAGG + Intergenic
1122874108 14:104655290-104655312 AAGGAGGGAAGGTGGGAAGGCGG + Intergenic
1123688014 15:22813388-22813410 AAAGGGGAAAGGGGGGAAATGGG + Intronic
1124172409 15:27387929-27387951 AGGGAGGGAAGGAGGGAAAGAGG + Intronic
1124683178 15:31755122-31755144 ATGAAGGGAAGGTGGGAAGAGGG + Intronic
1124788994 15:32708993-32709015 AGGGAGGGAAGGAGGGAAAGAGG - Intergenic
1125715437 15:41817312-41817334 ATGGAGGGAAGGTGGGAGGCAGG + Intronic
1126332605 15:47549563-47549585 ATGGAAGAAAGGTTTTAAATAGG + Intronic
1126533989 15:49741013-49741035 ATGGAGAGAAGTTGGTAAATGGG + Intergenic
1126699442 15:51354852-51354874 ATGCAGGAAAGACTGGAAATGGG + Intronic
1127300860 15:57652159-57652181 ATGAAGGAATGGAGGGAAAAAGG - Intronic
1128457460 15:67840267-67840289 ATGAAGGAATCATGGGAAATAGG + Intergenic
1128793525 15:70449547-70449569 ATGGAGGGAAGGAGGGAAGGAGG + Intergenic
1129360405 15:75020690-75020712 GAGAAGGGAAGGTGGGAAATGGG - Exonic
1129387345 15:75203060-75203082 AGGTAGGGAAGGTGGGAGATGGG + Intronic
1129596208 15:76966424-76966446 ATGGAGGGAAGGGGGGACTTGGG + Intergenic
1129618515 15:77120793-77120815 ATGGAACACAGGTGGGAAGTAGG - Intronic
1129895907 15:79105656-79105678 ATGGCTGAAAAGTGGGAAAGAGG - Intergenic
1130000477 15:80042212-80042234 AAGTAGGAAAGGTGGGAGAGAGG - Intergenic
1130861493 15:87894798-87894820 GAGGAGGAAAGGTAGGAACTAGG - Intronic
1131241085 15:90744117-90744139 ATGGAAGGAATGTGGGAAAAGGG + Intronic
1131727155 15:95239283-95239305 AAAGAGGAAAGGAGGGAAAGAGG + Intergenic
1131844690 15:96476690-96476712 AGATAGGGAAGGTGGGAAATGGG - Intergenic
1132019731 15:98350139-98350161 ATGGAGGAAAGAGGGGAATCAGG + Intergenic
1132556949 16:576731-576753 ATGCAGGGAAGGTGGGAGATGGG - Intronic
1132632544 16:926828-926850 AGAGAGGAGAGGTGGCAAATGGG - Intronic
1133326869 16:4947245-4947267 ATGGAGGAAGGGAGGGAGAGAGG - Intronic
1134258881 16:12634542-12634564 ATGAAAGAAAGATGGGAAAGAGG + Intergenic
1134286784 16:12868630-12868652 AGGGAGGGAAGGAGGGAAAGAGG - Intergenic
1135887707 16:26326504-26326526 AAGGAGGAAAGGAGGGAAGAAGG + Intergenic
1136517870 16:30778703-30778725 ATGGAGGTCAGATGGGAACTTGG - Exonic
1136597603 16:31262302-31262324 AGGGAGGGAAGGAGGGAAAGAGG - Intronic
1138890593 16:61139732-61139754 ATGGAGGGATAGTGGGAAAGTGG - Intergenic
1139303083 16:65961902-65961924 AGGGAGGAAAGGAGGGAGAGAGG + Intergenic
1139303118 16:65962012-65962034 AGGGAGGAAAGGAGGGAGAGAGG + Intergenic
1139561215 16:67743621-67743643 AAGAAGGAAAGGTGAGAAAATGG - Intronic
1139766590 16:69235611-69235633 AAGGAAGAAAGGCGGGAAGTGGG + Intronic
1139990241 16:70934276-70934298 ATGAAGGGAAGGAGAGAAATGGG + Intronic
1140330799 16:74054934-74054956 AAAGAGGAAAGGTGAGAAAAAGG + Intergenic
1140978046 16:80079688-80079710 ATGGAGGAAAGTAGAGAAAGAGG - Intergenic
1141619048 16:85227070-85227092 ACTGAGGAAAGATGGGTAATGGG - Intergenic
1141775737 16:86121668-86121690 ATGGAGTATAGGAGGGAGATGGG - Intergenic
1141892109 16:86933199-86933221 AAGAAGGGAAGGAGGGAAATGGG + Intergenic
1141928453 16:87184568-87184590 GTGCAGGAAAGGTGGGGAGTGGG + Intronic
1141973067 16:87495778-87495800 ATGGGGGAGGGGTGGGAGATGGG - Intergenic
1142030651 16:87836809-87836831 AAGGAGGAAAGGAGGGAAGGAGG + Intronic
1143254026 17:5542707-5542729 AGGGAGGGAGGGAGGGAAATGGG - Intronic
1144247767 17:13384384-13384406 AGGGAGGAAAGGAGGGAGAGAGG + Intergenic
1144629124 17:16861445-16861467 ATGGAGGAAAGGCCGGAAAGAGG + Intergenic
1144631527 17:16875078-16875100 ATAGAGGAAAGGTGGGCAGTGGG + Intergenic
1144742281 17:17590795-17590817 ATGCAAGAGAGGTTGGAAATTGG + Intronic
1145045707 17:19614038-19614060 TTGGGGGATAGGTGGGACATGGG - Intergenic
1145868348 17:28255047-28255069 AGGGAGGAAAGGTGGAAGAAAGG + Intergenic
1146296405 17:31653901-31653923 AGGGAGGAAATGAGGGAAATTGG - Intergenic
1146750463 17:35373824-35373846 ACGGAGGAAGGGTGGGAAGAAGG - Intergenic
1147133800 17:38423902-38423924 ATGTATGAAAGGTGGGTTATGGG - Intergenic
1148074256 17:44926503-44926525 AGGGAGGAAAGGAGGGAAGGTGG + Intronic
1148210642 17:45806539-45806561 CTGGAGGAAGGGAGGGAAGTGGG + Intronic
1148533109 17:48414308-48414330 CTGGGGGAAAGGTGGGAAGTTGG + Intronic
1148603557 17:48911278-48911300 ATGTAGGGAAGGTTGGGAATAGG + Intronic
1148616272 17:49002766-49002788 TTGGAGGAAAGGTGGAAACTGGG + Intronic
1149040145 17:52178374-52178396 ATGGGGTAAAGGTAGAAAATGGG + Intergenic
1149984795 17:61339249-61339271 ATGAAGGAGAGGTGGGCACTAGG - Intronic
1150021647 17:61621203-61621225 ATGGTGGCAGGGAGGGAAATGGG - Intergenic
1150351074 17:64444927-64444949 AAGGAGGAAAGATGGGATAATGG - Intergenic
1150553349 17:66231337-66231359 AGGGAGGAAGGGAGGGAAAAAGG - Intronic
1150875624 17:68967169-68967191 AAGGGGGAAAGGTGGGAAGGGGG - Intergenic
1151268926 17:72978225-72978247 AGGGAGGAAAGAAGGGAAAGAGG - Intronic
1152123707 17:78433966-78433988 AGGGAGGGAAGGAGGGAAAGAGG + Intronic
1152369971 17:79880706-79880728 TTGGAGGGAAGGTGGGAAAATGG + Intergenic
1152499767 17:80700063-80700085 ATGGAGAAAAGGTAGGAAGAAGG + Intronic
1152984711 18:311222-311244 ATGGAGGAAGGGGGGGATATGGG + Intergenic
1153073703 18:1136881-1136903 ATCAAAGAAAGGTGGTAAATTGG - Intergenic
1153574140 18:6504049-6504071 AGGAAGGAAAGGAGGGAAAAAGG + Intergenic
1153682793 18:7516323-7516345 AGCGAGGAAAGGAAGGAAATAGG + Intergenic
1153904551 18:9649817-9649839 AGGGAGGAAAGCTGGGGAGTGGG - Intergenic
1154316674 18:13309754-13309776 GTGAAGGAAAGGTGGGAGAGAGG + Intronic
1154464741 18:14632537-14632559 ATAGAGGACAGGTGGCCAATGGG + Intergenic
1155099927 18:22600873-22600895 GTGGAGGCAAGGCTGGAAATGGG - Intergenic
1155572115 18:27206320-27206342 CTGGAGGAAAGCAGGGAAATTGG - Intergenic
1156075633 18:33275632-33275654 TTGGAGGAAGGGTAGGAAAGGGG + Intronic
1156298222 18:35811852-35811874 ATGGAAGAATGGTGAGAAATGGG + Intergenic
1156550539 18:38011821-38011843 AGGGAGGAAAGGGAGGAAACAGG + Intergenic
1156649095 18:39202991-39203013 ATGGAGTAAAGTGGGGCAATTGG - Intergenic
1156804600 18:41162578-41162600 AGGGAGAAAAAGTGGCAAATTGG - Intergenic
1157120146 18:44901557-44901579 AGGTAGGGAAGGTGGGGAATGGG + Intronic
1157367708 18:47081071-47081093 ATGGAGGGAAGGAGGGAAGAAGG - Intronic
1157553050 18:48594571-48594593 ATGGAGGGAGGGTTGGAAAGTGG - Intronic
1157728805 18:49986272-49986294 TAGGATGCAAGGTGGGAAATGGG - Intronic
1157967574 18:52225423-52225445 ATGGAGGAGAGGAAGGAAAAAGG - Intergenic
1158073859 18:53505809-53505831 GTGAAGGAAAGGTGGGCAGTAGG + Intronic
1158373847 18:56840841-56840863 ATTGTAGAAATGTGGGAAATGGG - Intronic
1158582258 18:58694051-58694073 TGGTAGGAAAGGTGGAAAATGGG - Intronic
1159134843 18:64325757-64325779 ATGGATGAAATATGGGAAAGAGG - Intergenic
1159356114 18:67338437-67338459 AGGGAGGAAAGGAGGGAAGAAGG - Intergenic
1159368722 18:67504491-67504513 AGGGAGGAAAGGAGTGAAATGGG - Intergenic
1160694944 19:479020-479042 ATGGAGGAAACGTGGGCGAAGGG + Intergenic
1161431201 19:4233369-4233391 CTGGAGGACAGGTGGGAGGTGGG - Intronic
1161905181 19:7151233-7151255 ATGGAGGGAGGGAGGGAAAGAGG - Intronic
1162084385 19:8239684-8239706 ATAAAGGAAACGTGGGAACTGGG - Intronic
1162404014 19:10462696-10462718 AAGGAGGAATTGGGGGAAATGGG - Intronic
1162490307 19:10987534-10987556 CTGGGTGAAAGGTGGGAGATGGG + Intronic
1162722753 19:12672306-12672328 ATGCAGGAAAAGGGGGAATTGGG + Intronic
1163477109 19:17532857-17532879 AGGGAGGAAGGGAGGGAAAGGGG + Intronic
1164123012 19:22285203-22285225 CTGGAAGAAAGGTGGAAAATGGG + Intergenic
1164286524 19:23822181-23822203 ATTGAGGGAAGGTGGAAAAAAGG - Intronic
1164571504 19:29378070-29378092 ATGGAGGAAAAGTGAAAAGTAGG + Intergenic
1164731047 19:30504565-30504587 AAGGAGGAAGGGTGGGAGAGAGG - Intronic
1164731057 19:30504605-30504627 AGGGAGGAAGGGTGGGAGAGAGG - Intronic
1165244028 19:34487655-34487677 ACTGAGGAAAGGCGGGGAATGGG + Intronic
1165291419 19:34889182-34889204 ATGCAGGGAAGGTAGGAGATGGG - Intergenic
1165530937 19:36400801-36400823 ATGAAGGGAAGCTGGGAAATAGG - Intronic
1166088746 19:40494303-40494325 AAGGAGGAAAGGAGGGAAGGAGG - Intronic
1166108873 19:40610929-40610951 ATGGAGGAAAGGGGAGAAGGAGG + Intronic
1166117293 19:40663629-40663651 TGGGAGGGAAGATGGGAAATGGG + Intergenic
1166147766 19:40849179-40849201 ATGGAGGAAGGGAAGGAAGTGGG + Intronic
1166151902 19:40880950-40880972 ATGGAGGAAGGGTAGGAAGTGGG + Intronic
1166178266 19:41089695-41089717 ATGGAGGAAGGGAAGGAAGTGGG - Intronic
1166650031 19:44566160-44566182 ATGGGGGAAAAGAGGGAAGTGGG + Intergenic
1167761694 19:51453950-51453972 ATGGAGGAGAGATGGTGAATCGG + Intronic
1167837924 19:52089857-52089879 ATGGAGGAGAGGTAGAAAAATGG - Intronic
1168517184 19:57017844-57017866 AGGGAGGGAAGGGGGGAGATGGG - Intergenic
925085530 2:1104925-1104947 AGGTAGGAAAGAAGGGAAATGGG + Intronic
925466459 2:4110870-4110892 AAGGAGGGAAGGTGGGAAGGAGG - Intergenic
925474700 2:4200081-4200103 ATGGAGGAAAGTGGGAACATAGG + Intergenic
925606946 2:5669323-5669345 AAGAAGGAAAGGAGGGAAAAGGG + Intergenic
925692769 2:6541878-6541900 AGGGAGGAATCATGGGAAATAGG - Intergenic
925783174 2:7402697-7402719 ATGGAGGAAGGGAGAGAAAGAGG + Intergenic
926467604 2:13210691-13210713 CTTGAGGAAAGGAGTGAAATGGG - Intergenic
926663164 2:15491172-15491194 ATGGAGGAAGGGTGGGAGGAAGG - Intronic
926849845 2:17183725-17183747 ATGGAGGAAGTGATGGAAATGGG + Intergenic
926942779 2:18155551-18155573 ATGCAGGAAAGTCGGGAAAAAGG + Intronic
926974011 2:18495306-18495328 AAGGAGAAAAGGAGAGAAATAGG - Intergenic
927047577 2:19295364-19295386 ATGGGGAAAGGGTGGGAAAGGGG - Intergenic
927509998 2:23638557-23638579 ATGGAGGAAGTGTGGGGAAGTGG - Intronic
927531531 2:23808897-23808919 TAGGAGGAAAGCTGTGAAATTGG - Intronic
927770092 2:25853080-25853102 ATGGTGGAAAGGGGGAAGATGGG - Intronic
928164794 2:28962812-28962834 AGGGAGGAAAGGAGGGAAGGAGG - Intronic
928723818 2:34148513-34148535 ATGTAGCAAAGGTAGGAAAGTGG + Intergenic
928737447 2:34308662-34308684 ATGGAGGCAGGGTGGGAGAAAGG - Intergenic
928752330 2:34485514-34485536 ATGGAAGAAAAATGGAAAATGGG - Intergenic
929914372 2:46121963-46121985 AAGGAGGGAAGGAGGGAAAAAGG - Intronic
930955346 2:57196878-57196900 AAGAAGGAAATATGGGAAATGGG - Intergenic
931552458 2:63461842-63461864 TTGGAGGACAGGTGGGAAACTGG - Intronic
931685030 2:64785356-64785378 ATGGAGGCAAGGGGGCAAATAGG + Intergenic
932207689 2:69897993-69898015 ATGGAGGACAGATGGGAGGTGGG + Intronic
932297215 2:70636299-70636321 ATGGAGTAAAGAAGGGAACTCGG - Intronic
932495978 2:72146016-72146038 CTGGAGGTGAGGAGGGAAATAGG - Intronic
932693074 2:73929983-73930005 AAGGAGGAAAATTGGTAAATCGG + Intronic
932890579 2:75593037-75593059 AGGGTGGGAAGGTGGGAAGTTGG - Intergenic
933804513 2:85988493-85988515 CTGGAGCACAGGTGGGAGATGGG - Intergenic
933916319 2:86997450-86997472 ATGGAGGGAAGGGGGAAATTTGG + Intronic
933943722 2:87266580-87266602 ATGGAGGAAATGTGAGAGACAGG + Intergenic
934006674 2:87772455-87772477 ATGGAGGGAAGGGGGAAATTTGG - Intronic
934558195 2:95298510-95298532 ATGTAGGAAAGAAGGGATATGGG + Intronic
934987677 2:98899654-98899676 ATGGAGGAAATGAGAGAAAAGGG + Intronic
935770322 2:106413376-106413398 ATGGAGGGAAGGGGGAAATTTGG - Intronic
935909766 2:107882559-107882581 ATGGAGGGAAGGGGGAAATTTGG + Intronic
935967890 2:108499440-108499462 ATGGAGGGAAGGGGGAAATTTGG + Intronic
936131550 2:109847697-109847719 ATGGAGGGAAGGGGGAAATTTGG + Intronic
936173467 2:110197418-110197440 AAAGAGGAAGGGTGGGAAAGGGG - Intronic
936213147 2:110523788-110523810 ATGGAGGGAAGGGGGAAATTTGG - Intronic
936293159 2:111243483-111243505 AAGGAGGAAAGGAGGGAGAATGG + Intergenic
936336498 2:111594999-111595021 ATGGAGGAAATGTGAGAGACAGG - Intergenic
936422286 2:112378345-112378367 ATGGAGGGAAGGGGGAAATTTGG - Intronic
936690095 2:114876652-114876674 ATTGAGCAAAGATGAGAAATTGG - Intronic
936768881 2:115887615-115887637 AGGGAAGAAAGGAGGGAAAGAGG - Intergenic
936828309 2:116608528-116608550 ATGGAGGAGAGGAGGGCTATAGG + Intergenic
937034541 2:118769852-118769874 AGGGAGGAAGGGAGGGAAAGAGG + Intergenic
938102966 2:128511047-128511069 ATGCAGGAAAGGAGGAAATTGGG - Intergenic
938408363 2:131045096-131045118 ATGGAGTGAAGGTGAGAGATGGG + Intronic
938721571 2:134071715-134071737 GAGGAGGAAGGGTGAGAAATGGG - Intergenic
939035566 2:137126913-137126935 ATGGGGGAATGGTGGGTAAGTGG + Intronic
939081186 2:137663655-137663677 ATGGAGGGAAGGAGGAAAAGAGG + Intronic
939176898 2:138759494-138759516 CAGGTGGGAAGGTGGGAAATGGG + Intronic
939504594 2:143029972-143029994 ATGGAGGACAGGAGGAAATTTGG + Intronic
939639099 2:144617889-144617911 ATGGAGGATACGTGGGAAGGGGG - Intergenic
939648543 2:144732801-144732823 ATGGAGGAAAGGGAGGAATCTGG - Intergenic
939875046 2:147568287-147568309 ATGGAGGGAAGGAGGGAAAGAGG + Intergenic
939881921 2:147640844-147640866 CTGGAGGAAGGGTGGGATGTAGG + Intergenic
939900198 2:147842284-147842306 AAGGAGGAAAGAAGGGCAATGGG + Intergenic
940098573 2:150007066-150007088 AGGGAGGAAAGGAGGGAGACAGG - Intergenic
940776672 2:157891987-157892009 ATGGAGGGAGGGTTGGCAATGGG + Intronic
940846661 2:158649805-158649827 ATGCAAGAAAGGTGGGAATATGG + Intronic
941560580 2:167039615-167039637 ATGGAGAGAATGTGGGAAATAGG + Intronic
941919984 2:170840634-170840656 AGGGAGGAAAGGAGGGAGGTAGG + Intronic
942325464 2:174772637-174772659 ATGAAGGAAGGGTGGGAAGCAGG - Intergenic
942374693 2:175324998-175325020 ATGGAGGCAAGGTGGCCATTGGG + Intergenic
942496911 2:176549489-176549511 AAGGAGGAAAGAGTGGAAATTGG + Intergenic
943044719 2:182846645-182846667 ATGGAGGAAAAGAGGACAATTGG - Intronic
943575941 2:189631116-189631138 AGGGAGGAAAGGTGGAAAGAAGG + Intergenic
944121810 2:196248542-196248564 CTGTAGGAAAGGTGGGGAAAGGG + Intronic
944177651 2:196850710-196850732 AGGGAGGAAGGGAGGGAAAGAGG + Intronic
944261818 2:197686191-197686213 GTGGGGGAAAGGTGGGAGGTGGG - Intergenic
944667793 2:201971546-201971568 AAGGAGAAAGGGTGGAAAATTGG - Intergenic
944737119 2:202577252-202577274 AGGGAGGAAGGGAGGGAAAGAGG + Intergenic
944875864 2:203963702-203963724 AAGGAGGAAATGTGGGGAAATGG + Intergenic
944906232 2:204264660-204264682 ATGGAGGTGAGATTGGAAATGGG + Intergenic
945416256 2:209576591-209576613 ATGGAAAAAAAGTGGGAAACAGG - Intronic
945600947 2:211864189-211864211 AAGAAGGAGAGGTGGGAAAAAGG - Intronic
945837044 2:214846131-214846153 ATGGAGGCAAGGTAACAAATGGG - Intergenic
945837315 2:214848493-214848515 ACGGAGGCAAGGTGACAAATGGG - Intergenic
945959016 2:216112896-216112918 ATTTAGGAAAGGTGTGAAAAAGG - Intronic
946046661 2:216827054-216827076 ATGGAGGAGAGCTGGGGACTTGG + Intergenic
946429157 2:219615403-219615425 ATGAGGGCAGGGTGGGAAATGGG + Intronic
946875035 2:224120382-224120404 ATGGAGGGAGGGTGGGAGGTGGG + Intergenic
946883483 2:224199548-224199570 ATGGAGGAAAACTGAGAAAAAGG + Intergenic
948302047 2:236914814-236914836 CTGGAGGTAATGTGGAAAATGGG + Intergenic
1168736645 20:145778-145800 ATGGAGGGAAAGTGGGAAGGGGG - Intergenic
1168789448 20:566386-566408 ATGGAAGAAAGGTGGGAGAAGGG - Intergenic
1168810115 20:699669-699691 AAGCAGGAGAGGTGGGAAAAAGG - Intergenic
1168884868 20:1242065-1242087 ACTGAGGAAAGGTGGGGAAGAGG - Intronic
1168919152 20:1516417-1516439 TTGGAGGATGGGTGGGAACTGGG + Intergenic
1170278492 20:14619505-14619527 AAGGAGGAAAGGAGGGAAGGAGG + Intronic
1170361171 20:15548072-15548094 ATGGAGGAAGGGAGGGGGATAGG - Intronic
1170461355 20:16579606-16579628 ATGGAGGAGAGGAGGGAAGTAGG - Intergenic
1170951780 20:20943247-20943269 GAGGAGGAAAGGCGGGAAAGGGG - Intergenic
1171347184 20:24474816-24474838 ATGGAGGTAACGTGTGAAAGCGG - Intronic
1171905820 20:30899263-30899285 AGGGAGGGAAGGAGGGAAAGAGG - Intergenic
1172168306 20:32912547-32912569 AGAGAGGATAGCTGGGAAATGGG - Intronic
1172590781 20:36116457-36116479 CAGGAGGAAAGGAAGGAAATGGG - Intronic
1173134153 20:40424445-40424467 ATGAAGGAAAGGTGGATAAATGG - Intergenic
1173541660 20:43857261-43857283 AGGGAGGAAAGGGGGAAAAAGGG + Intergenic
1173754319 20:45501681-45501703 ATGGAGGAAAAGAGGGACCTGGG - Intergenic
1174178441 20:48659333-48659355 AAGGAGGAAGGGAGGGAAAGAGG + Intronic
1174221569 20:48959590-48959612 AAGGAGGGAAGGAGGGAAAGAGG - Intronic
1174451471 20:50623435-50623457 AGGGAGCAAAGGTGGAGAATGGG + Intronic
1174952328 20:55055895-55055917 AGGGAGGAAAGGAGGGAAAGAGG - Intergenic
1175460281 20:59147126-59147148 ATGGAGAAAAGGGGGAAAAGAGG + Intergenic
1175984009 20:62755272-62755294 ATGGAGGGAAGGAGGGAGAGAGG - Intronic
1176270534 20:64233498-64233520 ATGGAGGAAGGAAGGGAAAAGGG - Intronic
1176652574 21:9564124-9564146 AAGGAGAGAAGGTGGGAAGTGGG + Intergenic
1176809796 21:13525846-13525868 ATAGAGGACAGGTGGCCAATGGG - Intergenic
1176995303 21:15548528-15548550 ATGGAGGGAGGGTGGTAAACAGG + Intergenic
1178669109 21:34575317-34575339 AAGGAGGAAAGGAGGGAAGTGGG - Intronic
1179242320 21:39603190-39603212 GAGGAGGAAATTTGGGAAATGGG + Intronic
1179716918 21:43293120-43293142 AGGGAGGAAAGGAAGGAAATGGG - Intergenic
1180614355 22:17118276-17118298 AGGAAGGACAGGTGGGGAATGGG + Exonic
1181537124 22:23552191-23552213 ATGAAGGATAGATGGGAAAATGG - Intergenic
1181537199 22:23552618-23552640 ATGGAGGATAGATGGGAAGGTGG - Intergenic
1181537224 22:23552725-23552747 ATGAAGGATAGATGGGAAAATGG - Intergenic
1181924260 22:26345482-26345504 ATGGATGAAAGGGGAGAAATGGG - Intronic
1182100785 22:27655999-27656021 ATGGAGGAAGGGAGGGAGAGAGG + Intergenic
1183588253 22:38765693-38765715 CTGGAGAAAAGGTAGGAAAGGGG + Intronic
949237985 3:1833891-1833913 ATGGAGGAATGAGGTGAAATTGG - Intergenic
949644220 3:6074844-6074866 ATGGAGGAAGGGAGAGAAAGAGG - Intergenic
949840099 3:8311112-8311134 GTGGGGGGAAGGTGGGAGATGGG - Intergenic
949975142 3:9449705-9449727 ATGGAGGGGAGGAGGGCAATAGG + Intronic
950907542 3:16552912-16552934 AGGGAAGAAAGGAGGGAAAGAGG + Intergenic
951193523 3:19798468-19798490 AGGGAGGAAGGGAGGGAAAGAGG + Intergenic
952530967 3:34261224-34261246 TTGGTGGAAAGGAGGCAAATTGG - Intergenic
952581861 3:34843404-34843426 ATGGGGGAGAGATGGAAAATAGG + Intergenic
952601978 3:35094638-35094660 ATCGAGAAATGGTGGGAAGTGGG + Intergenic
952609954 3:35196701-35196723 ACAGAGGAAAGGAGGGAGATGGG - Intergenic
953060008 3:39419405-39419427 TTGGAGGAAAGGAGGAAGATAGG - Intergenic
953068088 3:39493153-39493175 AAGGAGGAAGGGTGGGAAGAAGG + Intronic
953284422 3:41592409-41592431 AGGGAGAAAGGGTGGGAAAGGGG + Intronic
953343426 3:42155164-42155186 ATGGAGAAAAGGTGAGACAAAGG + Intronic
953378621 3:42449332-42449354 GAGGAGAAAAGGTGGGAAATGGG + Intergenic
953610010 3:44439630-44439652 ATTGTTGAAAGGTGGGAGATTGG - Intergenic
953651067 3:44804725-44804747 AAGGAGGAAAAGTGAGAAATGGG - Intronic
954656124 3:52195293-52195315 AAGGAGGGAAGGAGGGAAAAGGG + Intergenic
954987657 3:54809776-54809798 AAGGAGGGAAAGAGGGAAATGGG - Intronic
955672799 3:61419325-61419347 ATGGGGGAGAGGTAGGAAAGTGG - Intergenic
955790377 3:62582911-62582933 ATGAAGAGAATGTGGGAAATGGG + Intronic
955912582 3:63873010-63873032 AGAGAGGAAGGGTGGGAAGTGGG + Intronic
957067948 3:75541285-75541307 GTGGAGGAAAGGTAGGGGATAGG + Intergenic
957158437 3:76576958-76576980 AAGGAGGAAAGGAGAGGAATAGG + Intronic
957236407 3:77598012-77598034 ATGGAGTAACGGTAGAAAATTGG + Intronic
957473800 3:80697562-80697584 ATGGAGCAAAGGTGAGGATTCGG + Intergenic
957519123 3:81296167-81296189 ATGGAGGAGAGCTGGGGAAGTGG - Intergenic
958048017 3:88308557-88308579 ATGCAGCTAATGTGGGAAATAGG + Intergenic
958092539 3:88894849-88894871 TTGGGGGAAAGGTGGGAGAGGGG - Intergenic
958960830 3:100508120-100508142 ATGGTGGAAATGTGGAACATGGG - Intronic
959814385 3:110658248-110658270 ATGCTGGAAAGGAGGGATATGGG + Intergenic
960015157 3:112878899-112878921 ATGGAGGAGAAGTGGGAAAATGG - Intergenic
960452406 3:117826542-117826564 AGGGAGGAAGGGAGGGACATAGG + Intergenic
960981828 3:123236037-123236059 CTAGAGGAATGGAGGGAAATAGG + Intronic
961285213 3:125796698-125796720 GTGGAGGAAAGGTAGGGGATAGG - Intergenic
961522761 3:127476732-127476754 AAGGAGGGAAGGAGGGAAAGAGG + Intergenic
961802413 3:129461889-129461911 AGGGAGGAAGGGAGTGAAATTGG + Intronic
961820055 3:129571357-129571379 ATGGAGAAACGGTGGGGAGTGGG + Intronic
962789991 3:138802444-138802466 GCGGAGGAAAGGAGGGAAAGAGG + Intronic
963063147 3:141241305-141241327 AGGGAGGGAGGGTGGGAAAAAGG - Intronic
963083130 3:141413079-141413101 GAGGAGGAATTGTGGGAAATGGG + Intronic
964042020 3:152271666-152271688 GTGGAGGAAAGAAGTGAAATAGG + Intronic
964323233 3:155519522-155519544 ATCCAGGAAAGGGGAGAAATTGG + Intronic
964903872 3:161694045-161694067 AGGGAGGAAGGGAGGGAAAGAGG - Intergenic
964979757 3:162665029-162665051 AAGGAAGAAAGGGGGGAAACAGG - Intergenic
965083890 3:164069471-164069493 AAGGAGGGAAGGTGGGAAGGAGG + Intergenic
965463613 3:168999975-168999997 AGGGAGGAAGGGAGGGAAGTGGG + Intergenic
965529036 3:169752123-169752145 ATGAAGGAGAGGAGAGAAATAGG - Intergenic
966238175 3:177726043-177726065 ATGAAGGAGAGGAGGGAAATGGG - Intergenic
966288531 3:178326686-178326708 CTGAAGGAAGGGTGGGAAATAGG - Intergenic
966496062 3:180582066-180582088 ATGGAGGGATGGTGGAACATAGG + Intergenic
966557948 3:181284833-181284855 ATGTACAAAAGGTGGGCAATAGG + Intergenic
966687726 3:182714122-182714144 AGGGAGGGAGGGAGGGAAATAGG + Intergenic
966705142 3:182905437-182905459 AAGCAGGAAAGGTGAGAAATTGG + Intronic
967019965 3:185514145-185514167 AGGGAGGAAAGGAAGGAAAAAGG + Intronic
967025525 3:185560981-185561003 GTGGAGGAAAGGAGGGCAATGGG - Intergenic
967044304 3:185722543-185722565 ATGGTGGGAAGGTGGGAAGGTGG + Intronic
967136381 3:186516114-186516136 ATGGAGGACAGTTGGTAGATGGG - Intergenic
967334770 3:188331578-188331600 AAGGAGGAAAGGAGGCAGATGGG - Intronic
967726737 3:192869307-192869329 AAGGAGGGAAGGAGGGAAAAAGG + Intronic
967791293 3:193551816-193551838 AGGAAGGAAAGGTGAGAAAGTGG - Intronic
969331846 4:6478149-6478171 ATGGAGAAAAGGTGAGACGTAGG - Intronic
969424827 4:7118080-7118102 ATGGAGGAAGGGGTGGATATTGG + Intergenic
969424876 4:7118310-7118332 ATGGAGGGATGGAGGGATATTGG + Intergenic
969424912 4:7118492-7118514 ATGGAGGGATGGAGGGATATTGG + Intergenic
969475836 4:7422052-7422074 ATGGAGGAAAAGTAGCAAAGGGG - Intronic
969741566 4:9031876-9031898 GTGGAGGAAAGGTAGGGGATAGG - Intergenic
969800935 4:9564779-9564801 GTGGAGGAAAGGTAGGGGATAGG - Intergenic
970147389 4:13051215-13051237 CTGAAGGAGAGGTGGGAAGTGGG + Intergenic
970224556 4:13844119-13844141 ATGGAGGAAGGGAGGGAGAAAGG - Intergenic
970522382 4:16898778-16898800 ATGGAGGAAGGGAGGGAAGAAGG + Exonic
970536736 4:17037688-17037710 AAGGAGGAGAGGTGGGGAAGGGG + Intergenic
970991342 4:22217117-22217139 AAGAAGCAAAGGTGGGGAATGGG - Intergenic
972209609 4:36821794-36821816 ATGGAGGAAAGGAGAGGAAGGGG + Intergenic
972353074 4:38255102-38255124 ATGGAGGAAAGGAAGGAAAGAGG + Intergenic
973717263 4:53689545-53689567 ATGGGGGACAGGTGTGAAGTAGG - Intronic
973850325 4:54955376-54955398 ATGGAGGAAATTTAGGCAATAGG - Intergenic
974095499 4:57359475-57359497 ATGGAGGGAAGTTGGGAAGGAGG + Intergenic
974130595 4:57750382-57750404 ATGGAGGCAAGTTTGGGAATCGG + Intergenic
974441987 4:61930269-61930291 ATGGAGGAAGGGGGGTAACTAGG + Intronic
974659955 4:64874149-64874171 AAGGAGTAAATGTGGAAAATAGG + Intergenic
974670649 4:65025844-65025866 AGGGAGGAAAGGAGGGAGAAAGG - Intergenic
974991645 4:69098779-69098801 CTGAAAGAAAGATGGGAAATGGG + Intronic
975817752 4:78236717-78236739 CATGAGGAAAGGTGAGAAATAGG + Intronic
975890585 4:79022550-79022572 AAGGAGGAAAGGTTGAAAAAGGG + Intergenic
977363968 4:96042894-96042916 ATGGTGTTAAGCTGGGAAATGGG + Intergenic
977386419 4:96345379-96345401 ATGGAGAAAACCTAGGAAATTGG + Intergenic
977696098 4:99968329-99968351 ATGGAGGGGAGGTGGAAAGTGGG + Intergenic
978293152 4:107170291-107170313 ATGAGAGAAAGGAGGGAAATAGG - Intronic
978690767 4:111506494-111506516 ATGAAGGAAAGGATGGCAATGGG + Intergenic
978947632 4:114516960-114516982 AAGGGGGAAAGGTGGGGAAAAGG + Intergenic
979255303 4:118602018-118602040 AAGGAGGAAAGGAGGGAAAAAGG - Intergenic
979382896 4:120029513-120029535 ATGGAGGAAATGTGGAAACCAGG - Intergenic
979994316 4:127412148-127412170 AAGGAGGAAAGGAGGGAAGGAGG + Intergenic
981035982 4:140169336-140169358 ATGGAGCAAAGGAGGGAGAAGGG - Intergenic
981625152 4:146747062-146747084 ATGGAAGAAAGGTAGGATAGAGG + Intronic
981756655 4:148147202-148147224 ATGGAGGAAAGGTGGGAAATAGG - Intronic
982088055 4:151856179-151856201 ATGGACGTTAGGTGGGAAACTGG + Intergenic
982558625 4:156900878-156900900 AGGGAGGAAAGGAGGGAAGGAGG + Intronic
982807095 4:159780126-159780148 AGGGAGGGAGGGAGGGAAATGGG - Intergenic
984785768 4:183566044-183566066 ATGGAGGAAATGAGGGAAGGAGG + Intergenic
984927820 4:184821956-184821978 CTGGAGAAAATTTGGGAAATAGG - Intronic
985665489 5:1179793-1179815 ATATAGGAAATGTGGAAAATGGG - Intergenic
985706451 5:1404068-1404090 ATTGAGGAAAAGTGGACAATTGG - Intronic
986207324 5:5637316-5637338 AAGGAGGAAAGGCGGGAAAAAGG - Intergenic
986636016 5:9823458-9823480 AGGGAGGAAGGGAGGGAAAAGGG + Intergenic
987322482 5:16783564-16783586 ATGGTAGAAAGGTGGGAAGAGGG + Intronic
987373842 5:17217277-17217299 ATGGCGGATAGGAGAGAAATGGG + Intronic
988082246 5:26429295-26429317 ATGGAGATGATGTGGGAAATGGG - Intergenic
988371507 5:30374958-30374980 AAGGGAGAAAGGTGGTAAATAGG + Intergenic
988999918 5:36749330-36749352 TTGGGGGAAAGGAGAGAAATGGG - Intergenic
989060161 5:37402915-37402937 AGGGAGGGAAGGAGGGAAAGAGG - Intronic
989570660 5:42943279-42943301 AAGGAGGGAAGGAGGGACATAGG + Intergenic
989991633 5:50774273-50774295 AAGGAGGAAATGTGGGGAAAAGG - Intronic
990174719 5:53094279-53094301 ATGGGGGAAAAGTATGAAATAGG + Exonic
990650807 5:57897669-57897691 AAGGAGGAAATGGGGGAAAATGG - Intergenic
991258270 5:64639115-64639137 ACAGAGGAAAGGGGGAAAATGGG + Intergenic
991622275 5:68557124-68557146 AGGGAGGAAAGGAGGGCAAAAGG + Intergenic
992804098 5:80320021-80320043 GGGGAGGAAGGGTGGGAAAGGGG - Exonic
992825792 5:80548661-80548683 TTGGGGAAAAGGTGGGAAAGGGG - Intergenic
992826513 5:80554672-80554694 AAGGGGGAAAGGTGGGAAAGGGG + Intergenic
992865889 5:80956854-80956876 AGGGAGGGAAGGAGGGAAAGAGG - Intergenic
992878779 5:81084481-81084503 ATCGTGGAAGGGTGGGAAACAGG - Intronic
993141371 5:84038251-84038273 TTGGAACACAGGTGGGAAATTGG - Intronic
993536979 5:89098630-89098652 AGGGAGGAAAGGAGGGAAGGAGG - Intergenic
993700623 5:91114550-91114572 AGGGAGGAAGGGAAGGAAATGGG + Intronic
993762846 5:91818285-91818307 ATGGAGGTAAGGAGGTAAAGAGG + Intergenic
994596400 5:101843227-101843249 AAGGAGGAAAGGAGGGAAGTAGG + Intergenic
994596412 5:101843259-101843281 AGGGAGGAAAGGAGGGAAGGAGG + Intergenic
995358161 5:111263332-111263354 ATGAAGGAAAGATAGGAATTGGG + Intronic
996021385 5:118594468-118594490 ATGGAGGAAACGTGGGAAGAGGG - Intergenic
996694383 5:126377523-126377545 CTGGAGGAAAAGTGTGAAAGAGG - Intronic
997419500 5:133754967-133754989 TTGAAGGAAGGGTGGGAAGTGGG - Intergenic
997894933 5:137708024-137708046 ATGAAGGAAAGGGGGAAAAAAGG + Intronic
998469221 5:142370355-142370377 AGGGAGGTAAGGAGGGAAGTGGG - Intergenic
998479735 5:142452842-142452864 ATGGAGGAATGGTGAGAAACTGG - Intergenic
998499657 5:142621387-142621409 GTGGAGGAAAGGAGGGAAGGAGG - Intronic
998526605 5:142848435-142848457 AGGGAGTAAAGGAGGAAAATGGG - Intronic
998638907 5:143987449-143987471 AGGAAGGAAAGGTGGGAAGGTGG - Intergenic
999075652 5:148793051-148793073 ATAGAGGAAAATTGGGAAGTGGG - Intergenic
1000280092 5:159774603-159774625 AAGGAGGAAAAGTGGAAAACAGG + Intergenic
1000950630 5:167477827-167477849 AAGGAGGAAAGGAGGGCAATAGG + Intronic
1001147201 5:169195239-169195261 TAGGAAGAAAGGGGGGAAATGGG - Intronic
1001449817 5:171815985-171816007 ATGTAGGAAATGTAGGACATTGG - Intergenic
1001468473 5:171990108-171990130 AAGGAGAAAAGGAGAGAAATGGG + Intronic
1001514334 5:172344948-172344970 ATGGAGGAAAGGAAGGAAGGAGG + Intronic
1001618625 5:173063165-173063187 TTGGAGGAAAGGTCATAAATTGG - Intronic
1002456908 5:179350505-179350527 CTGGAGGAGAAGTGGGAAGTGGG - Intergenic
1002643013 5:180639528-180639550 ATGGTGGAAAGGTGGGCATATGG + Intronic
1002899558 6:1399489-1399511 AGGGAGGTAAGGAGGGAAAGAGG + Intergenic
1003005604 6:2378193-2378215 AGGGAGGAAAGGAGGGAGAGAGG + Intergenic
1003674734 6:8192757-8192779 AGGGAAGAAAGGAGGGAAAGAGG + Intergenic
1004280343 6:14275067-14275089 AGGGAAGAAGGGAGGGAAATGGG + Intergenic
1004285985 6:14321404-14321426 CAGGAGGAAAGGGGGGAAATTGG - Intergenic
1004351361 6:14893079-14893101 ATGGAGGGAAGGAGGAGAATGGG + Intergenic
1005188861 6:23195123-23195145 AGGGAGGAAAGGAAGGAAGTAGG + Intergenic
1005681866 6:28216439-28216461 AGGGAGGTAGGGTGGGATATTGG - Intergenic
1005825854 6:29631626-29631648 AGAGAGGAATGGTGGGAAAGAGG + Intronic
1005926244 6:30448042-30448064 ATGGAGGAGAGGTGGCACCTGGG - Intergenic
1006195694 6:32240629-32240651 ATGGAGGGAATGAGGGAAATAGG + Intergenic
1006443742 6:34067569-34067591 AGGGAGGAAAGGAGGGAGAGAGG - Intronic
1007071477 6:39041411-39041433 CTGGAGGAAAGGTGGGGAGCTGG - Intergenic
1007112778 6:39322579-39322601 ATGGGGGAGAGGTGGGAAACAGG + Intronic
1007218469 6:40259919-40259941 ATTGAGGAATGGTGGCAAATGGG - Intergenic
1007886422 6:45235632-45235654 ATGGTGAGAAGGTGGAAAATTGG + Intronic
1008288386 6:49682534-49682556 ATGGAGGGAAGGAGGGAGGTGGG - Intergenic
1009518431 6:64650604-64650626 TTTGAGGAAAGGGGGAAAATTGG + Intronic
1009795855 6:68466331-68466353 ATGGAGGAAAGTAAGGGAATGGG + Intergenic
1010794108 6:80099603-80099625 ATGGAGGTAAGGTAAGATATGGG + Intergenic
1012651615 6:101761764-101761786 AGGGAGGGAGGGAGGGAAATGGG - Intronic
1012869050 6:104652295-104652317 ATGCCAGAAAGGGGGGAAATGGG + Intergenic
1013819576 6:114138441-114138463 ATGGTGGAAATGTGGGCAAAAGG + Intronic
1013895342 6:115081288-115081310 ATGGAAAAAGGGTAGGAAATAGG + Intergenic
1014950067 6:127543693-127543715 ATGAAGTGAAGGTGGGAAAATGG - Intronic
1015613158 6:135047687-135047709 ATGGATTAAAGGTGGTATATGGG - Intronic
1015747064 6:136521349-136521371 ATGGAGGATGGGTTGGAAAGAGG + Intronic
1015893969 6:137998566-137998588 ATGAAGGAAGGGAGGGAAAGAGG + Intergenic
1015962897 6:138668960-138668982 ATGGAGGAAGCAAGGGAAATTGG + Intronic
1016014578 6:139170802-139170824 ATGGAGGAAAGGTGCGGGAAAGG + Intronic
1016212878 6:141561958-141561980 ATGGGGGATGGGGGGGAAATGGG - Intergenic
1016555495 6:145331903-145331925 ATGGTGAAATGGTTGGAAATAGG - Intergenic
1017665370 6:156715115-156715137 AAATAGGACAGGTGGGAAATAGG + Intergenic
1018234528 6:161710983-161711005 ATGGAAGAAAGGAAGGAAAGGGG - Intronic
1018276144 6:162133546-162133568 ATGGAGAAAGGGAGAGAAATAGG + Intronic
1018487923 6:164261140-164261162 AGGAAGGCAAGGGGGGAAATGGG - Intergenic
1019281585 7:203032-203054 ATGGAGGGAAGGTGGTAGGTGGG + Intronic
1019530527 7:1500780-1500802 AGGGAGGAAAAGTGGGAAGAAGG - Intronic
1019730548 7:2627287-2627309 ATGGAGGAAAGGAGGGAGTGAGG + Intergenic
1019973398 7:4560658-4560680 GTAGAGGGAAGGTGAGAAATAGG + Intergenic
1021369679 7:19827775-19827797 CATGAGGAAAGGTGTGAAATTGG + Intergenic
1022554279 7:31276222-31276244 AGGGAGGAAGAGTGGGAAAGGGG + Intergenic
1023201490 7:37702320-37702342 AGGGAGAAAAGGAGGGAAAAGGG - Intronic
1023707886 7:42961270-42961292 ATGGAGGAAATGCGGGAGTTGGG + Intergenic
1024193847 7:47039402-47039424 ATGGAGAACAGGTAGGAACTCGG + Intergenic
1024777460 7:52804178-52804200 GTGGAGGAAAGGTGTTAAATAGG + Intergenic
1025776383 7:64564316-64564338 CTGGAAGAAAGGTGGGCAACAGG - Intergenic
1025864935 7:65372638-65372660 CTGGAAGAAAGGTGGGCAACAGG + Intergenic
1025935916 7:66037182-66037204 ATTTAGAAAAGGTGGGTAATAGG - Intergenic
1025948264 7:66121835-66121857 ATTTAGAAAAGGTGGGTAATAGG + Intronic
1026361706 7:69607306-69607328 AGGGAGGAAAGGAGGGAGGTGGG - Intronic
1026444873 7:70475390-70475412 AGGGGGGAAAGGTGGGAATGTGG - Intronic
1026501701 7:70948262-70948284 ATGGAGGAAGGGATGGAAAGAGG - Intergenic
1026632398 7:72048769-72048791 AAGGAGGAAGGGAGGGAAAAAGG - Intronic
1026762214 7:73135300-73135322 AAGGAGGAAAGGAAGGAAACGGG - Intergenic
1026774035 7:73220260-73220282 ATGGAGGGAAGATGGTGAATGGG + Intergenic
1027014892 7:74773646-74773668 ATGGAGGGAAGATGGTGAATGGG + Intergenic
1027073139 7:75172307-75172329 ATGGAGGGAAGATGGTGAATGGG - Intergenic
1027085010 7:75257385-75257407 AAGGAGGAAAGGAAGGAAACGGG + Intergenic
1027228250 7:76258272-76258294 CTGGAGGAAAGGAGGGGAAGCGG + Intronic
1027579339 7:79974796-79974818 ATGGATGAAAAATGTGAAATTGG - Intergenic
1028090687 7:86696936-86696958 AGGGAGAAAAGATGGGAGATAGG - Intronic
1028577663 7:92370204-92370226 ATGAAGAAAAGTTGGGTAATGGG + Intronic
1029209288 7:98892671-98892693 GTGGAGGAAATGGGGGAAAAGGG - Intronic
1029260568 7:99299875-99299897 ATGGACCAAAGGAGGGAAACAGG + Intergenic
1030072200 7:105707456-105707478 ATGGAGGAAGGCTGGGCTATGGG + Intronic
1030577259 7:111304361-111304383 ATGGAGGTAAGGTGGAGAAAGGG + Intronic
1030629312 7:111878590-111878612 ATGGGGGAGGGGTGGGAGATGGG - Intronic
1030878029 7:114840069-114840091 ATACAGGAAAAGTTGGAAATTGG - Intergenic
1031061995 7:117062106-117062128 AGGGGGGAAAGGTGGGAGAGAGG + Intronic
1031270856 7:119647268-119647290 ATGGAGGATAGGTGGTAGGTTGG - Intergenic
1032239246 7:130148339-130148361 ATGGTGGAAAGGTGGGGAAGAGG - Intergenic
1032442857 7:131955389-131955411 ATAGAGGAAAGGAGGGGAAAGGG + Intergenic
1032535364 7:132658442-132658464 ATGAAAGAAAAGTAGGAAATAGG - Intronic
1032619038 7:133509021-133509043 GAGGAGAAAAGGTGGGTAATTGG - Intronic
1032650434 7:133872115-133872137 CTGGAGGAAAGGTGGGGATCAGG + Intronic
1032738206 7:134712064-134712086 AGGGAGGGAAGTTGGGAAAGAGG + Intergenic
1033313582 7:140280123-140280145 ATGGGGGAAAGTTGAGAAGTAGG - Intergenic
1033411252 7:141119701-141119723 ATGGAGGAAAGGCTGGAGAAGGG + Intronic
1033961578 7:146919953-146919975 ATGGAGGAAAATTGGCAGATAGG - Intronic
1033966891 7:146986148-146986170 ATGGAGAAAGGGTGGGAGAGGGG - Intronic
1033999357 7:147392502-147392524 AGGGAAGAAAGGTGGGAGAGGGG - Intronic
1034279416 7:149842215-149842237 AGAGAGGAAAGGTGCGAGATAGG + Intronic
1034468729 7:151244865-151244887 CTGGAGGAAAGCAAGGAAATGGG + Intronic
1034477066 7:151291402-151291424 GTGGAGGAAAGGTGAGTCATGGG - Intergenic
1035564995 8:635483-635505 AGGGAGGACAGGTGGGGACTGGG - Intronic
1037009749 8:13826232-13826254 ATGGAGGAAAGGGCAGAAAATGG + Intergenic
1037268391 8:17095718-17095740 AAGGAGGAAAGGAGGGAAAAAGG - Intronic
1037552974 8:19992942-19992964 ATGGACGGAAGGGGGAAAATGGG - Intergenic
1038048356 8:23786394-23786416 CTGGAGGGAAGGTGGGAATGAGG + Intergenic
1038143329 8:24870297-24870319 CTGGAGGAAAGGTTAAAAATCGG - Intergenic
1038195109 8:25360180-25360202 ATGGCAGAAAGGTGGGTAATGGG - Intronic
1039819639 8:41124503-41124525 AAGGAGGACAGGTGGGAAAAAGG + Intergenic
1041866585 8:62581784-62581806 AGGGAGGATAGGTGGGAGAAAGG - Intronic
1041988240 8:63953186-63953208 ATGGAGGAAAGGAGGAACATAGG - Intergenic
1042499358 8:69491879-69491901 ACGGAGAAAAGAGGGGAAATTGG + Intronic
1042619905 8:70693755-70693777 ATGGGGGACTTGTGGGAAATTGG + Intronic
1043250986 8:78072683-78072705 AAGAAGGAAAGGTGGGAAAAGGG - Intergenic
1043550871 8:81371307-81371329 ATGCATGAGAGGTGGGAAGTTGG + Intergenic
1043887895 8:85623495-85623517 AGGGAGGAAAGGAGGGAGAAAGG - Intergenic
1045605056 8:103763552-103763574 AGGGAGGAAAGGAAGGATATAGG + Intronic
1046890364 8:119415888-119415910 AGGGAGGAAAGGAGAGAAAGAGG - Intergenic
1047056656 8:121172295-121172317 ATAGAGGAAGGGAGGGAAAAAGG + Intergenic
1047330209 8:123880165-123880187 GTGGAGGGAAGTTGGGAACTGGG - Intronic
1047701719 8:127455625-127455647 ATGGAGAAATGGTAGGAATTGGG + Intergenic
1047825344 8:128567526-128567548 GAGGAGGAAAGGAGGGAGATGGG + Intergenic
1048513271 8:135081159-135081181 ATGAGGGAAAGGAGGGAAAGGGG + Intergenic
1049464203 8:142743730-142743752 ATGGGGGATGGATGGGAAATGGG + Intergenic
1049464421 8:142744463-142744485 ATGGGGGATGGATGGGAAATGGG + Intergenic
1050191904 9:3035151-3035173 ATGTAGCAAAGGCAGGAAATAGG + Intergenic
1050415637 9:5414076-5414098 ATAGAGGAAGGGTGGGAACAGGG + Intronic
1050802306 9:9630407-9630429 GTGTAGGAAAAGTGGGACATTGG - Intronic
1051131032 9:13861209-13861231 AGGGGGCAAAGGTGGAAAATAGG + Intergenic
1051252947 9:15180654-15180676 ATGGAGAGAAGTTGGAAAATGGG - Intronic
1052274392 9:26661076-26661098 ATGGAGGAAAGGAGGGAGGGAGG + Intergenic
1052727755 9:32250392-32250414 ATGGAGGAAAGGAAAGGAATTGG + Intergenic
1052849204 9:33366088-33366110 AGGGAGGAAAGGAGGGGAATGGG - Intronic
1054729788 9:68689717-68689739 AGGAAGGAAAGGAGTGAAATTGG + Intergenic
1054902374 9:70382982-70383004 ATGGAGGAAAGGGGGAAAGAAGG - Intergenic
1056235551 9:84590355-84590377 AATGAGGGAAGGAGGGAAATGGG - Intergenic
1056251496 9:84753137-84753159 AGGGAGGAGTGGTGGTAAATTGG + Intronic
1056319049 9:85419502-85419524 ATGAAAGATTGGTGGGAAATTGG - Intergenic
1056704394 9:88939754-88939776 CTGGAGGGAAGGTGGGAGAGGGG - Intergenic
1057108749 9:92446887-92446909 ATGAAGAAAAGGAGGGAAAAAGG + Intronic
1057405137 9:94763360-94763382 ATACAGTACAGGTGGGAAATGGG - Intronic
1057412008 9:94825127-94825149 ATGGAGGAGAGGAGGGAAATTGG + Intronic
1057598044 9:96433389-96433411 AGGAAGAAAAGGTGGAAAATGGG + Intergenic
1058237007 9:102502697-102502719 TTGGAGGGAAGATGGGAACTTGG + Intergenic
1058378205 9:104349496-104349518 AAGGAGGAAAGGAGGGAAGGAGG + Intergenic
1058771253 9:108234526-108234548 TGGGAGGAAAGGTGGGAAGGGGG + Intergenic
1059382701 9:113939769-113939791 AGGGAGGGAAGGAGGGAAAGAGG - Intronic
1061695515 9:132370340-132370362 CTGGAGGAAAGGATGGAAACAGG + Intergenic
1062252407 9:135604948-135604970 AAGGAGGAAAGGAGGGAAGCAGG + Intergenic
1185566257 X:1097632-1097654 CTGGAGGAAAGGTGGGTGAGAGG + Intergenic
1185708298 X:2281821-2281843 AAGGAGGAGAGGGAGGAAATAGG + Intronic
1185834072 X:3328987-3329009 AGGGAGGGAAGGTGGGAAGCAGG + Intronic
1185834128 X:3329239-3329261 AAGGAGGGAAGGTGGGAAGCAGG + Intronic
1185910719 X:3978422-3978444 ACTGTGGAAAGGTAGGAAATTGG + Intergenic
1186045561 X:5532860-5532882 AGAGAGGGAAGGAGGGAAATAGG + Intergenic
1186505696 X:10090153-10090175 TTGGAGGAAAGGTGGGAGGAAGG + Intronic
1186621815 X:11249267-11249289 AGGGAGAAAGGGTGGGAAAGGGG + Intronic
1186887931 X:13933384-13933406 ATGGAGGATATGGGGTAAATGGG - Intronic
1186923949 X:14311606-14311628 CTGGGGGAGAGGTGGAAAATGGG + Intergenic
1187185534 X:16981210-16981232 ATGGAGCAGATGTGGGAACTTGG + Intronic
1187233141 X:17441625-17441647 AAGGAGGAAAGGAGGGAGATGGG - Intronic
1187407626 X:19018025-19018047 ATGGAGGGAAACTGGGAGATGGG - Intronic
1187455938 X:19441321-19441343 ATTGAGGGAAGCTGGGAAGTGGG + Intronic
1187514625 X:19957217-19957239 TAGGAGGAAAGAAGGGAAATGGG - Intronic
1188618342 X:32187814-32187836 CTGGAGAAAAGATGGGAAAACGG + Intronic
1189004351 X:36980549-36980571 ACTGAGGACAGGTGGGAAAGGGG - Intergenic
1189373514 X:40448474-40448496 ATGGAGGACAGGTAGGAAGAGGG - Intergenic
1189401050 X:40669090-40669112 ATGGAGGAAAACTGAGACATGGG - Intronic
1189588663 X:42488554-42488576 AGGGAGGAAAGGAGGGAAGGAGG - Intergenic
1190128617 X:47726464-47726486 ATGGAGGAATGGATGGGAATGGG - Intergenic
1190265492 X:48825388-48825410 ATTGACCACAGGTGGGAAATTGG + Intergenic
1190325500 X:49204797-49204819 ATGGAGGAAAGGGGAGAGAGCGG - Intergenic
1190325959 X:49206941-49206963 GTGGAGGAGGGGTGGGAACTGGG - Intronic
1190411634 X:50141895-50141917 ATGGAGCAGAGGTGGGATAGTGG + Intergenic
1192211954 X:69133311-69133333 GTGGAGGACAGGTGGGGAAGTGG - Intergenic
1192342573 X:70276482-70276504 ATGCAGGAAAGGTGAGGACTGGG + Exonic
1192432631 X:71122713-71122735 AAGGAGGAAAAGTGGTAAAGGGG - Intronic
1193355514 X:80515811-80515833 ATGGTGGGAGGGTGGGAAAGAGG - Intergenic
1193631762 X:83898620-83898642 ACTGAGGAAAAGTGGCAAATAGG + Intergenic
1193741806 X:85226125-85226147 AATGGGGAAGGGTGGGAAATAGG - Intergenic
1193806391 X:86000865-86000887 ATGAAGTAAAGTTGGTAAATGGG + Intronic
1194066879 X:89271621-89271643 AAGGAAGAAAAGGGGGAAATAGG + Intergenic
1194621075 X:96172799-96172821 AAGGAGAAAAGGAGAGAAATGGG + Intergenic
1194853323 X:98896507-98896529 ATGTAGGAAAGAAAGGAAATAGG - Intergenic
1194982560 X:100455047-100455069 AAGGAGGAAAGGAGGGAAGGAGG + Intergenic
1195264197 X:103164258-103164280 ATGGAGGCCACATGGGAAATAGG - Intergenic
1195329352 X:103784617-103784639 GTGGAGGAAACTTTGGAAATTGG - Intronic
1195669041 X:107453693-107453715 GGGGAGGAAAGGAGGGAAAATGG - Intergenic
1195840297 X:109168562-109168584 CTGGAGGAGAGGTGTGAATTAGG - Intergenic
1196650013 X:118159182-118159204 AAGGAAGGAAGGAGGGAAATCGG + Intergenic
1196658084 X:118240890-118240912 ATGGAAAGAAGGTGAGAAATAGG - Intergenic
1196815802 X:119664897-119664919 AGGGAGGAGAGGTGGGGACTGGG - Intronic
1197509237 X:127350474-127350496 AAGGAGGAAAAGAGAGAAATAGG - Intergenic
1197947741 X:131858909-131858931 ATGGAGAAAAGGTGTGTAAATGG - Intergenic
1198000078 X:132424758-132424780 AAGGAGGAAAGGAGGGAGAGAGG - Intronic
1198679870 X:139170033-139170055 ATGGAGTTCAGGTGGGAATTGGG - Intronic
1199550577 X:149057025-149057047 ATGGAGGAGGGGTGGGAACAGGG - Intergenic
1199766509 X:150945490-150945512 ATGAAGGCAGGGTGGGAAGTAGG - Intergenic
1199895910 X:152127741-152127763 ATGGAGGAGGGGTGGGAACAGGG - Intergenic
1200072360 X:153535524-153535546 CCGGAGGAAGGGTGGGAAACAGG - Intronic
1200721044 Y:6605780-6605802 AAGGAAGAAAAGGGGGAAATCGG + Intergenic
1200806983 Y:7443381-7443403 AGGGAGGAAAGGTGGGAGGAAGG - Intergenic
1200807005 Y:7443471-7443493 AGGGAGGAAAGGTGGGAGGAAGG - Intergenic
1201458958 Y:14201452-14201474 CTGGAGGAGAGGAGGGAAATGGG + Intergenic
1201522540 Y:14891964-14891986 ATAGATGTAATGTGGGAAATAGG - Intergenic
1202170074 Y:22034115-22034137 ATAATGGAAAGTTGGGAAATAGG + Intergenic
1202221292 Y:22552258-22552280 ATAATGGAAAGTTGGGAAATAGG - Intergenic
1202321823 Y:23643404-23643426 ATAATGGAAAGTTGGGAAATAGG + Intergenic
1202548944 Y:26026652-26026674 ATAATGGAAAGTTGGGAAATAGG - Intergenic