ID: 981761212

View in Genome Browser
Species Human (GRCh38)
Location 4:148197063-148197085
Sequence TTCTTCCAACTCTACCTTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 362
Summary {0: 1, 1: 0, 2: 2, 3: 41, 4: 318}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981761212_981761214 15 Left 981761212 4:148197063-148197085 CCAAAAAGGTAGAGTTGGAAGAA 0: 1
1: 0
2: 2
3: 41
4: 318
Right 981761214 4:148197101-148197123 GATAACATTGCTGTGCCTCAAGG 0: 1
1: 0
2: 0
3: 20
4: 134
981761212_981761215 20 Left 981761212 4:148197063-148197085 CCAAAAAGGTAGAGTTGGAAGAA 0: 1
1: 0
2: 2
3: 41
4: 318
Right 981761215 4:148197106-148197128 CATTGCTGTGCCTCAAGGCCAGG 0: 1
1: 0
2: 1
3: 18
4: 153
981761212_981761216 25 Left 981761212 4:148197063-148197085 CCAAAAAGGTAGAGTTGGAAGAA 0: 1
1: 0
2: 2
3: 41
4: 318
Right 981761216 4:148197111-148197133 CTGTGCCTCAAGGCCAGGAGAGG 0: 1
1: 0
2: 1
3: 37
4: 288

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981761212 Original CRISPR TTCTTCCAACTCTACCTTTT TGG (reversed) Intronic
900334457 1:2154747-2154769 TTCGTCCAGCTCTACTTTCTGGG + Intronic
903009977 1:20322848-20322870 CTCTTCAAATTCTACCTGTTTGG - Intronic
904155244 1:28477604-28477626 TTATTCCAAATCTACCTTTCTGG + Intronic
905524833 1:38628697-38628719 TTTTTCTGACTCTTCCTTTTAGG + Intergenic
906373405 1:45273887-45273909 TTCTCCTAACTCAGCCTTTTGGG + Intronic
907056999 1:51378825-51378847 TTCTTCCAGCTCTAAGTTTGAGG + Intronic
907800668 1:57762089-57762111 TTTTTCTATCACTACCTTTTAGG - Intronic
908695412 1:66835022-66835044 ATCTTTCACCTCTAACTTTTTGG + Intronic
908755058 1:67462073-67462095 TTCCACCCACTCTACCTTCTAGG + Intergenic
909431033 1:75588172-75588194 TTCTCCTAACTCCACTTTTTTGG - Intronic
909479537 1:76116589-76116611 TTCTTCCATCTCTGCTCTTTAGG - Intronic
910609946 1:89129899-89129921 TTTTTTCAACTCAACATTTTAGG - Intronic
911747269 1:101453589-101453611 TTCTTCCAAATCTATCACTTAGG - Intergenic
912407777 1:109455332-109455354 CTTTTCCAACCCTAACTTTTGGG - Intergenic
913037605 1:114987099-114987121 TTTTTCCATCTTTACCCTTTGGG + Intronic
914263144 1:146016261-146016283 CTTTTCCAACTCTCTCTTTTTGG + Intergenic
917036001 1:170747431-170747453 TACTTCCAACTCCACTTTTTGGG + Intergenic
917042251 1:170818360-170818382 TGGTTCCAACTCTTCCCTTTTGG - Intergenic
917544951 1:175955137-175955159 TTCTCCCACCTCAACCTTCTGGG - Intronic
917708707 1:177661129-177661151 TTATTTCAACTCTACATTTTTGG - Intergenic
918671768 1:187225827-187225849 TTCTTCTAACACTACATCTTTGG + Intergenic
920617655 1:207509340-207509362 TACATCCTACCCTACCTTTTTGG - Intronic
920634041 1:207681350-207681372 TACATCCTACCCTACCTTTTTGG - Intronic
920929486 1:210373557-210373579 TTCATCCATCTCGAACTTTTCGG - Intronic
921580784 1:216893825-216893847 TTCCTTCAAATGTACCTTTTAGG - Intronic
921593539 1:217030399-217030421 TTAATCCCACTTTACCTTTTAGG + Intronic
921641356 1:217558893-217558915 TTCTTCCAACTATACTTGGTAGG + Intronic
921661277 1:217806093-217806115 TTCTTCCAATTTTTCCCTTTTGG - Intronic
923739636 1:236643518-236643540 TTCTCCCACCTGTAGCTTTTGGG - Intergenic
924597206 1:245457297-245457319 TTCTTCCAGCTCTCCTTTCTGGG - Intronic
1062866971 10:863903-863925 TGCTTCTAACCCTGCCTTTTTGG - Intronic
1063011916 10:2030663-2030685 TTGTCACAACTCTACCTTTCTGG - Intergenic
1063255795 10:4326044-4326066 TTCTTCCAGCTATTCCTTTAGGG + Intergenic
1066251737 10:33639739-33639761 TTCTGAAAACTCTACCATTTTGG + Intergenic
1068014505 10:51499026-51499048 TTCTTCTCACTTTACCTCTTAGG - Intronic
1068175501 10:53452002-53452024 TTCTCCAAACTCTCCCTTTACGG - Intergenic
1069060491 10:63889474-63889496 TTGTTCCAATTCCACATTTTCGG + Intergenic
1069737470 10:70666450-70666472 TTCTCCCACCTCCACCTTCTTGG - Intergenic
1070378712 10:75859858-75859880 TTATTCTAATTTTACCTTTTAGG + Intronic
1072011997 10:91310132-91310154 TTCTTTTTTCTCTACCTTTTGGG + Intergenic
1073160504 10:101389962-101389984 TTTCTCCAACTCTGACTTTTTGG + Intronic
1075541876 10:123320231-123320253 TCCTACCAACTGTTCCTTTTGGG - Intergenic
1076016522 10:127032186-127032208 TTCTTCCAACTCTGCCTTCGTGG - Exonic
1078440335 11:11359776-11359798 TTTTTCCATCTCTACCTTCGGGG - Intronic
1079478251 11:20854327-20854349 TTCTTCCACCTCTACCCTTCTGG + Intronic
1079570482 11:21937059-21937081 TTCTTGCAACTTTTTCTTTTTGG + Intergenic
1080338583 11:31229843-31229865 TTCATCCATCTCTACTTTGTTGG - Intronic
1080609118 11:33888514-33888536 TTCTTCAAACTCTTGCTTTAGGG + Intronic
1080632664 11:34093370-34093392 TCCTCCCACCTCTACCTTATAGG + Intronic
1081053323 11:38374396-38374418 TCCCTCCCACTCTCCCTTTTTGG + Intergenic
1081554023 11:44140735-44140757 TTCTTCTAACTAAAGCTTTTAGG + Intronic
1082857713 11:57823952-57823974 TTCTTCCCTCTCTACTTGTTTGG - Intergenic
1082869958 11:57935177-57935199 TTATTCCAACTCCAGCTTTCTGG - Intergenic
1083084318 11:60126839-60126861 GTCTTTCAACTTTATCTTTTAGG + Intergenic
1083116855 11:60468870-60468892 TTATTCCACATCTACGTTTTTGG + Exonic
1084628648 11:70330180-70330202 CTCTTCCATATCTTCCTTTTGGG - Exonic
1085150746 11:74251286-74251308 CTCTTCCATCTCTGGCTTTTGGG - Intronic
1090856539 11:130613733-130613755 TTCTTCAAACTGTTCCTGTTAGG - Intergenic
1090960768 11:131554770-131554792 TTTTTCCATCCCTTCCTTTTTGG + Intronic
1091137503 11:133205208-133205230 CTCTTCAAACCCTGCCTTTTGGG - Intronic
1091616679 12:2054920-2054942 TGCTCCCAGCTCCACCTTTTGGG + Intronic
1092554342 12:9540398-9540420 GTCTTCCAACTCTACCGTTCGGG + Intergenic
1094332286 12:29307636-29307658 TTCTCTTTACTCTACCTTTTAGG + Exonic
1094517759 12:31150232-31150254 GTCTTCCAACTCTACCGTTCGGG - Intergenic
1096487120 12:51990774-51990796 TTCTTCCCACTCTGTTTTTTCGG + Intronic
1097336267 12:58386824-58386846 TTCTTCCCTGTCTTCCTTTTTGG - Intergenic
1098719585 12:73879990-73880012 TCCTGCCAAATCTACCTCTTCGG - Intergenic
1099430833 12:82583600-82583622 TACCTCCCACTCTTCCTTTTGGG - Intergenic
1099521572 12:83671531-83671553 TTCTTACCACTTTTCCTTTTTGG + Intergenic
1099692296 12:85972633-85972655 TTCTTACAACTGTGCATTTTTGG - Exonic
1099727099 12:86445018-86445040 TTCTTCCACCCCCACCTTTCTGG - Intronic
1100557061 12:95705533-95705555 TTCTTCCTTCTGTTCCTTTTTGG + Intronic
1102211508 12:111130701-111130723 GTCTTCAATCTCTTCCTTTTAGG + Intronic
1102428146 12:112860778-112860800 TTCTTCTCACTCTACCATTGGGG - Intronic
1102597625 12:114005027-114005049 TTATTCCTATTCAACCTTTTAGG - Intergenic
1102730296 12:115103190-115103212 TCCTTCCAACTCTGCCACTTGGG + Intergenic
1102743142 12:115225712-115225734 TTCTTCCAATACTAGCGTTTTGG - Intergenic
1103054629 12:117808947-117808969 TTCTCCCCAGTCTACCTTCTGGG + Intronic
1103257441 12:119554165-119554187 TATTTCCAACTCACCCTTTTAGG - Intergenic
1103685484 12:122729121-122729143 TTCACACAACTATACCTTTTGGG - Exonic
1106359538 13:29018037-29018059 TAGTTCCACCTCTACCTGTTTGG + Intronic
1106441167 13:29772764-29772786 TTCTTCCAAGTCTTCATTTTGGG - Intronic
1106903920 13:34385106-34385128 TTTTGCCACCTCTACCTTTGGGG + Intergenic
1106952812 13:34903737-34903759 TTCTTCCAATTGTAACTTGTAGG + Intergenic
1107415556 13:40196794-40196816 TTGTTCCAACTGTACTTATTTGG - Intergenic
1107864414 13:44689602-44689624 TTTTGCCAACTCTTCCATTTAGG - Intergenic
1109476402 13:62885275-62885297 TTTTTCCATCTTTTCCTTTTGGG - Intergenic
1109534349 13:63696910-63696932 TGCTTCCAAGTCTATGTTTTTGG - Intergenic
1111167815 13:84485259-84485281 TTCTTACAATTTTACTTTTTTGG - Intergenic
1111445041 13:88336202-88336224 TTCTTTCAAATATGCCTTTTAGG - Intergenic
1113036504 13:106055748-106055770 ATCTTCCATCACTATCTTTTGGG - Intergenic
1113268041 13:108641220-108641242 TTCTAACTACTCTACCATTTTGG + Intronic
1114049096 14:18905406-18905428 CTCCTCCTACTCTGCCTTTTGGG - Intergenic
1114113468 14:19496527-19496549 CTCCTCCTACTCTGCCTTTTGGG + Intergenic
1114115173 14:19614281-19614303 CTCCTCCTACTCTGCCTTTTGGG + Intergenic
1115501072 14:34050302-34050324 TGCTACAAACTCTGCCTTTTGGG + Intronic
1116606738 14:47008313-47008335 TTCTGCCAACACTACCTGTTAGG - Intronic
1117275117 14:54185928-54185950 TTGTTCAAAATATACCTTTTTGG - Intergenic
1117540780 14:56744604-56744626 TTATTTCTTCTCTACCTTTTAGG - Intergenic
1118597697 14:67448843-67448865 TTCCTCCAATTCTACCTCTTAGG - Intronic
1118884225 14:69853177-69853199 TGCTTCCAACTTTGTCTTTTAGG + Intergenic
1119226707 14:72950009-72950031 TTCTCCCAACTCCTCCTATTAGG - Intronic
1121731990 14:96193671-96193693 TGCTTCCAACTCTACCCCTTGGG + Intergenic
1122196519 14:100091485-100091507 CTCTCCCAACTCTGCCTTTTTGG - Intronic
1123505158 15:20934975-20934997 CTCCTCCTACTCTGCCTTTTGGG - Intergenic
1123562400 15:21508671-21508693 CTCCTCCTACTCTGCCTTTTGGG - Intergenic
1123580054 15:21706801-21706823 TACTTCCACTTCTACATTTTGGG - Intergenic
1123598645 15:21945958-21945980 CTCCTCCTACTCTGCCTTTTGGG - Intergenic
1123616702 15:22149423-22149445 TACTTCCACTTCTACATTTTGGG - Intergenic
1125000196 15:34761812-34761834 CTCTTACACCTCTACCTTTCTGG + Intergenic
1125270798 15:37936641-37936663 TTCTCTCAACTCCATCTTTTAGG - Intronic
1125445308 15:39748158-39748180 TTCTTCCAGTTCTTCTTTTTTGG + Intronic
1125532936 15:40425467-40425489 TTCTTCCATATCTTGCTTTTTGG + Intronic
1125683082 15:41545089-41545111 TTCATCCCACTCTCCCTTCTTGG + Intergenic
1126772240 15:52070014-52070036 TTCTTACAACTCTACGAATTAGG - Intergenic
1127672974 15:61213205-61213227 TTCTTCCAACTCCACTTCCTGGG + Intronic
1128845053 15:70885723-70885745 ATCTTCAAATTCTACCTATTTGG - Intronic
1129897237 15:79117556-79117578 TTGGCCCAACTCTGCCTTTTGGG - Intergenic
1130680431 15:85991605-85991627 TTTTCCCAACTCTTCCTTCTTGG - Intergenic
1130851760 15:87801865-87801887 TCCTTGCAATTCTACCATTTTGG + Intergenic
1131726079 15:95226686-95226708 TTTTGCCCACTCTACCTTTAAGG + Intergenic
1202970749 15_KI270727v1_random:235818-235840 CTCCTCCTACTCTGCCTTTTGGG - Intergenic
1202988924 15_KI270727v1_random:441046-441068 TACTTCCACTTCTACATTTTGGG - Intergenic
1134510842 16:14845681-14845703 TTCTTTCTCCTCTACCTTTGCGG + Intronic
1134698483 16:16244168-16244190 TTCTTTCTCCTCTACCTTTGCGG + Intronic
1134973351 16:18550510-18550532 TTCTTTCTCCTCTACCTTTGCGG - Intronic
1135108328 16:19670388-19670410 TTCTTCCAGCTCTGCGTTCTTGG + Intronic
1136579014 16:31140873-31140895 TCCTTCCAAATCTCCCTTCTAGG + Intronic
1139242722 16:65410674-65410696 TTCATTCCACTCTACCTTCTTGG + Intergenic
1140651043 16:77088964-77088986 TTCTAGCAGCTTTACCTTTTGGG + Intergenic
1141257879 16:82419932-82419954 GTCTTCCACCTCCACCTTTTGGG - Intergenic
1141892703 16:86937479-86937501 TTCCTCCAACCATAGCTTTTTGG + Intergenic
1144391430 17:14797179-14797201 TTCTGCCAACTCTGCTTTTACGG + Intergenic
1144844467 17:18209235-18209257 TCCTTCCAAGTCTAGCATTTGGG + Exonic
1144862759 17:18315821-18315843 TTCTTCATACTCTTCCTCTTTGG - Exonic
1146286925 17:31580421-31580443 CTCTTCCATCTCTAGCTTGTGGG - Intergenic
1149495406 17:57114306-57114328 TCCTTCAACCTCTACCTTCTGGG + Intronic
1150258940 17:63773243-63773265 TTCCTCTAACTCTGCCCTTTTGG + Intronic
1150612711 17:66747175-66747197 TCCTTCCACCTCAACCTCTTGGG + Intronic
1151179187 17:72313421-72313443 TCCTTCCACCTCTTCCTGTTGGG + Intergenic
1151647833 17:75445694-75445716 CTCTTCCAATTCTAAATTTTTGG + Intronic
1155054083 18:22170126-22170148 TTCTTCCTGCTCTCCCATTTGGG + Intronic
1155834523 18:30563262-30563284 TTAATCCAACTCTACATTCTTGG + Intergenic
1156409305 18:36812447-36812469 CTCTTCAAACTCTGTCTTTTGGG - Intronic
1156844436 18:41647946-41647968 CTCTTCCAGCTCTAACATTTGGG + Intergenic
1157560284 18:48640644-48640666 TCCTGCCAACTCTACCTTCCTGG - Intronic
1159056868 18:63474879-63474901 GTCTTCCTACTGTACCCTTTGGG + Intergenic
1159541536 18:69783432-69783454 TAATTCCACCTCTTCCTTTTTGG + Intronic
1160030589 18:75255159-75255181 TTCTTCCTCCTCTACCATCTGGG + Intronic
1162785172 19:13030302-13030324 TTCTTCCATGTCTAGCTTGTAGG + Intronic
1164138800 19:22439079-22439101 TTTTTAAAACTCTCCCTTTTTGG - Intronic
1165929401 19:39346403-39346425 TTCTTTCATCTCTATCTTTTGGG - Intronic
1167274384 19:48527733-48527755 CTCTTGAAACTCTCCCTTTTGGG - Intergenic
925601168 2:5610157-5610179 ATCTTCCATCTCTACTTTCTGGG + Intergenic
925878472 2:8331536-8331558 TGTTTCCAATTCTCCCTTTTGGG + Intergenic
926144026 2:10385933-10385955 TTCTTCCTGCTCTGCCTGTTTGG + Intronic
926636826 2:15189208-15189230 TTCTTAGATCTCTACCTTTGTGG - Intronic
927368465 2:22326868-22326890 TTCCTCCACCTCTATCTTTAAGG - Intergenic
928030495 2:27774281-27774303 GTCTTACAACTGAACCTTTTAGG + Intronic
928443603 2:31313758-31313780 TACTTCCAACTCAATTTTTTTGG - Intergenic
928920509 2:36522083-36522105 TTTTTCCAGATCAACCTTTTCGG + Exonic
931391039 2:61844396-61844418 TTTTTTAAACTCTACCTTTGAGG + Intronic
931509529 2:62975562-62975584 TTTTTATAATTCTACCTTTTAGG + Intronic
931688151 2:64812286-64812308 TTCTTCCAACTAGTCCTGTTTGG + Intergenic
932114100 2:69030031-69030053 TTCTTCCAAGTCCACCTTCTGGG + Intronic
932469567 2:71945055-71945077 TTCTTCCAATTCTTTCTCTTTGG - Intergenic
932544578 2:72694526-72694548 TTCTTCCACCTCCATATTTTTGG + Intronic
933106251 2:78329437-78329459 TTCTTCCAAGTCAAGCATTTTGG + Intergenic
934749884 2:96786984-96787006 TCCTTCCTACTCTACTGTTTTGG + Intronic
935529732 2:104217903-104217925 TTCTACCAGCTCTCCCTCTTGGG + Intergenic
936557519 2:113509230-113509252 TTGTTCCTAATCTCCCTTTTGGG - Intergenic
936959833 2:118061472-118061494 TTCTTGCAACTCTGCTTTCTTGG + Intergenic
937362491 2:121238747-121238769 GTCTTCAATCTGTACCTTTTTGG - Intronic
938426407 2:131193667-131193689 CTCCTCCTACTCTGCCTTTTGGG - Intronic
939162045 2:138602243-138602265 TTCTCCCAACTCCACCCTTTTGG + Intergenic
939508097 2:143073970-143073992 TTCTTCCAACTCCACTTAATCGG - Intergenic
939661447 2:144895614-144895636 TTCTTCCAAAAATGCCTTTTTGG - Intergenic
940118900 2:150240612-150240634 TGTTTCCAACTCTGCATTTTGGG + Intergenic
940394727 2:153174816-153174838 TTCTTCCAACACTCTCTTTAAGG + Intergenic
940415343 2:153413085-153413107 TCTTTCCAACTCTCCCCTTTTGG - Intergenic
940834115 2:158501300-158501322 GCCTTGCAACTCTGCCTTTTTGG + Intronic
941641670 2:167995651-167995673 TTCTTCTTAATGTACCTTTTTGG - Intronic
942771468 2:179526142-179526164 TTCTCCCAACTCAGCCTTCTGGG + Intronic
942926537 2:181439794-181439816 TTCTTACAACTCTACACTTTCGG + Intergenic
944032360 2:195250858-195250880 TTCATCCAATTCCACATTTTAGG - Intergenic
945538627 2:211053765-211053787 TTATTCAAACTTTTCCTTTTTGG - Intergenic
945781410 2:214177557-214177579 TTCTCCCAACTCTATTTTTTAGG + Intronic
949080374 2:242093142-242093164 TACTTCTCCCTCTACCTTTTTGG + Intergenic
1169053982 20:2604797-2604819 CTCTTCAAACTCTGCCCTTTGGG - Intronic
1169183829 20:3594905-3594927 CTCTTCCATCTCTACTCTTTGGG - Intronic
1169200773 20:3708314-3708336 TTCTGGCATCTCTTCCTTTTGGG - Intergenic
1169552673 20:6717178-6717200 TTTTTCCCATTCAACCTTTTTGG - Intergenic
1169863699 20:10177365-10177387 TTTTTCAAACTCTCCTTTTTTGG + Intergenic
1172696191 20:36824758-36824780 TTCTCCCACCTCAACCTCTTGGG + Intronic
1172798625 20:37560749-37560771 ATCTTCTAACTGAACCTTTTGGG - Intergenic
1173029330 20:39340297-39340319 TTCTTCCTTCTCTCCCTTATTGG + Intergenic
1173417999 20:42875578-42875600 TTCTCCCACCTCTATCTCTTAGG + Intronic
1174488953 20:50878757-50878779 TTGTGCCAACACTACATTTTGGG - Intronic
1174495243 20:50936590-50936612 TTCTTTCAACTTTAAATTTTAGG - Intronic
1177934680 21:27329253-27329275 TGCTTCCACCTCTATCTCTTTGG + Intergenic
1179284791 21:39967993-39968015 TTCTTCCAAATCTATTGTTTAGG + Intergenic
1180042901 21:45288859-45288881 TTCGTCCAATTATACCGTTTTGG - Intergenic
1180467573 22:15627794-15627816 CTCCTCCTACTCTGCCTTTTGGG - Intergenic
1182817490 22:33178569-33178591 TTCTTCAAACTATATTTTTTGGG + Intronic
1182995593 22:34809128-34809150 TTCTTGAAACTCTACCTTCTTGG - Intergenic
1183756277 22:39769266-39769288 TGCATCCAAGTCTGCCTTTTGGG - Intronic
1183756445 22:39770750-39770772 TGCATCCAAGTCTGCCTTTTGGG - Intronic
949272999 3:2242440-2242462 TTCTTCCAACTTTCCATTTCAGG + Intronic
950388795 3:12680282-12680304 TACTGCAACCTCTACCTTTTGGG + Intergenic
951126758 3:18994063-18994085 CTCTTCCAAATCTTCCTTTTTGG - Intergenic
951401529 3:22238240-22238262 GTCTTCCAACTTTGCTTTTTTGG + Intronic
951478529 3:23134534-23134556 TTCTTCCGACTGTCCCTTTTCGG - Intergenic
953045600 3:39291714-39291736 TATTTCCAACTCTTCCTTTCAGG + Intergenic
953220876 3:40970572-40970594 TTCTTTCACCTCTGCTTTTTGGG - Intergenic
954833120 3:53440252-53440274 TTGTTCTACTTCTACCTTTTAGG + Intergenic
957137887 3:76312466-76312488 TTCTGCCTACTGTACCTTTGAGG + Intronic
958170084 3:89928160-89928182 ATCTCCCAATTCTACCTTTATGG - Intergenic
959316094 3:104808986-104809008 TTATTTCCACTCTACCATTTAGG - Intergenic
959621585 3:108403800-108403822 TTCTTCCAGCCCTAGCTCTTTGG + Intronic
960256232 3:115514149-115514171 TTCTCACAATTCTACCTTCTGGG - Intergenic
960487129 3:118267839-118267861 TCCTTCCAGCTCTACTGTTTTGG - Intergenic
961367835 3:126412624-126412646 TTCAACCAACTCTGCATTTTTGG + Intronic
961733773 3:128987392-128987414 TTCTTGAAACTCCACCTTTTGGG - Intronic
962030866 3:131599012-131599034 GTCTTCTAACTGTAGCTTTTAGG + Intronic
963287702 3:143451310-143451332 TTCTTCCAAGTGATCCTTTTTGG + Intronic
963491039 3:146000543-146000565 TTCTTCCCATTTTACCTGTTTGG + Intergenic
965711683 3:171561946-171561968 TGCTTCCAATTCTGCCTTTCAGG - Intergenic
965849351 3:173004548-173004570 TTATTCCAAGTCTATGTTTTTGG - Intronic
966092636 3:176158874-176158896 TTGTTTCAACTCCACCTCTTAGG - Intergenic
966294045 3:178397024-178397046 TTCTTCTATCTCTGCTTTTTTGG + Intergenic
966369591 3:179234615-179234637 ATCTTCAAAGTTTACCTTTTTGG - Exonic
967535670 3:190599805-190599827 TTCTTTCTACTCTGCTTTTTAGG + Intronic
967546857 3:190740776-190740798 TGCTTCCATCACTAACTTTTTGG + Intergenic
970806170 4:20036159-20036181 TTATTCCACCTCTATTTTTTTGG - Intergenic
970991371 4:22217303-22217325 TTCTTCCAACTCTATCTCATAGG - Intergenic
973749725 4:54002065-54002087 TTCTTCAAAATCTCTCTTTTAGG - Intronic
974744045 4:66046604-66046626 TTGTTCCAACTCAATCTCTTTGG - Intergenic
975172896 4:71253054-71253076 TTCCTCCAACTCCTCCTTCTTGG - Intronic
975190359 4:71453304-71453326 TTCTTCTATCTCTTTCTTTTTGG - Intronic
976027538 4:80708223-80708245 TTCAACCAATTCTTCCTTTTGGG + Intronic
976343470 4:83971955-83971977 TACCTCCAACCCTAGCTTTTTGG - Intergenic
977864317 4:102004999-102005021 TTATTCCCACTCTAGCTATTAGG - Intronic
978558951 4:110011116-110011138 TTCTTCAACCACTACCGTTTAGG + Intronic
978937975 4:114401147-114401169 TCCTTTCAACTCCACCTTATTGG - Intergenic
979228725 4:118321744-118321766 TTCCCCCAACTTTACTTTTTGGG - Intronic
979274180 4:118796521-118796543 TGCTGCCAACACTTCCTTTTGGG - Intronic
979372877 4:119910577-119910599 TTCTTCTAACTCTATTTTTTTGG + Intergenic
980164560 4:129209664-129209686 TTCCTCCAACTCTAGATGTTTGG - Intergenic
980680146 4:136150233-136150255 TTCTTATAACTCCACCTTTGCGG + Intergenic
980711285 4:136571986-136572008 TTATTCCAACTCTTCATTGTAGG - Intergenic
981761212 4:148197063-148197085 TTCTTCCAACTCTACCTTTTTGG - Intronic
982167829 4:152631202-152631224 TTCTTCCAACACTACTCTTTAGG + Intronic
982225913 4:153166447-153166469 TCCTTCCAGCACTGCCTTTTGGG - Intronic
983041371 4:162931539-162931561 CTCTTCCAACTCTTCATTTCTGG + Intergenic
983927217 4:173415100-173415122 TTCTGCCAACTCTCCAATTTGGG - Intergenic
983929586 4:173438740-173438762 TTCTTTCAACTATTGCTTTTGGG + Intergenic
985195390 4:187423117-187423139 TTTTTCCAAAGCTACCTTTGGGG - Intergenic
985282444 4:188300728-188300750 TCCCTCCTACTCTAGCTTTTGGG + Intergenic
986585561 5:9313370-9313392 TTCTTATAACTCTAGCTTCTGGG + Intronic
987692887 5:21291618-21291640 TTATTCCAGCTCTATCTCTTTGG - Intergenic
989582872 5:43049801-43049823 TTCCTGCAACACTACCTTATTGG + Intergenic
991096607 5:62746497-62746519 TTCTCCCCACCCTACCTTTTTGG + Intergenic
992137760 5:73764663-73764685 GTCCTCCTCCTCTACCTTTTGGG + Intronic
992322516 5:75627925-75627947 TTCTTCCTCCTCTATCTGTTGGG + Intronic
993284338 5:85971694-85971716 TTCTTTCTATTCTACCTTGTAGG - Intergenic
993352095 5:86862646-86862668 TTCTGCCAACTTTTCTTTTTGGG + Intergenic
995221371 5:109652538-109652560 TTCTTCCCACTCTGCCTTCTGGG + Intergenic
995235300 5:109822636-109822658 TTCTTCCAAATTTACCTCTTTGG - Intronic
995869575 5:116730187-116730209 TCTTTCCAACTCTATCTTTGTGG + Intergenic
995909637 5:117170078-117170100 TTCTTCCTACTATGCCTTATTGG + Intergenic
997005275 5:129809574-129809596 TTCTTCCAAGTTTCTCTTTTTGG + Intergenic
997046563 5:130326108-130326130 TTCTGTCAAATCTACATTTTAGG - Intergenic
997085940 5:130798662-130798684 TTCTTTCATCTCTACCTTTTAGG + Intergenic
997380440 5:133432467-133432489 TTCTGCCAAACCTACCTTGTGGG + Intronic
997752912 5:136365965-136365987 ATCTTCCAACTTTACTATTTTGG + Intronic
999325654 5:150641773-150641795 TTCTTCCACTTCTTCCTTTCAGG - Intronic
999482377 5:151960488-151960510 TCCTTCCCACTCTACATTTCGGG + Intergenic
999520703 5:152348146-152348168 TGATTCTAACTCTACCTTTTGGG + Intergenic
1000038969 5:157470914-157470936 TTCTTCCAACTCTTCTGTTTGGG + Intronic
1000261784 5:159595354-159595376 TATTTCCAAATCTACTTTTTAGG - Intergenic
1000743304 5:164997468-164997490 TTCTTTCAACTCTTTCTTTAAGG + Intergenic
1000889770 5:166788526-166788548 TCCTTACAACTCTTCCTTTAAGG + Intergenic
1003664100 6:8093643-8093665 TTTTTAAAACTCTTCCTTTTAGG - Intronic
1003894671 6:10596091-10596113 TTTATCCAACTTCACCTTTTAGG + Intronic
1008376519 6:50798003-50798025 ATCCTCCATCTCTACCTATTTGG + Intergenic
1008866909 6:56223119-56223141 TTCTTCCAACATTACTTTCTGGG + Intronic
1009246498 6:61244729-61244751 TTCCTCAGACTCTACCTTTGGGG + Intergenic
1009411715 6:63372955-63372977 TACATCCAAGTCTAACTTTTGGG + Intergenic
1009684535 6:66938825-66938847 ATCTTCAAACTGGACCTTTTAGG + Intergenic
1010690056 6:78899975-78899997 TTTTTTCAACTGTACATTTTAGG - Exonic
1011756173 6:90500449-90500471 TTCTTCCACCTCTGCCTGCTGGG - Intergenic
1012217046 6:96599976-96599998 TTCCTACAGCTCTACCTGTTAGG + Intronic
1012344736 6:98171402-98171424 TTCTTCCAACCCTACCATCCGGG + Intergenic
1013021301 6:106222551-106222573 TTCTTATTACTCTTCCTTTTCGG - Intronic
1014053390 6:116983889-116983911 TTCTTTCCACTCAACCTTTGTGG + Intergenic
1015139695 6:129915724-129915746 CTTTCCCAACTCTGCCTTTTAGG - Intergenic
1016556863 6:145348363-145348385 TTCTTACGACTCTCCCTGTTTGG - Intergenic
1016661212 6:146582977-146582999 TTCTTGTAACTCTCCTTTTTGGG + Intergenic
1017333160 6:153223157-153223179 TTCTTCCATATATACTTTTTTGG + Intergenic
1017805601 6:157942944-157942966 TTTTTGCAACTCTTTCTTTTTGG - Exonic
1019999322 7:4745991-4746013 TTCTTAAAACTCTACCTCTAAGG - Intronic
1020497203 7:8870768-8870790 TTTTGCCAATTCTACCTTTTGGG - Intergenic
1020801426 7:12737439-12737461 ATCTCCCAACTCCTCCTTTTAGG - Intergenic
1021440874 7:20674043-20674065 TACTTCCATTTCTCCCTTTTTGG + Intronic
1021559931 7:21959593-21959615 TCCTTCCACCTCAACCTCTTGGG + Intergenic
1021665793 7:22978122-22978144 TTCTTCCAAATATAACTTTCTGG - Intronic
1021912307 7:25398391-25398413 TTATTCCAAATCTACTGTTTAGG + Intergenic
1023485039 7:40677222-40677244 TTCGGCCAACTCTACATTTTAGG + Intronic
1024164115 7:46713188-46713210 TTCTTACCACTCTACATTTCTGG + Intronic
1025263078 7:57434692-57434714 CTCTTCCAACACTATCTTTTTGG + Intergenic
1028040995 7:86054275-86054297 TGCTTCCAGCTTTTCCTTTTTGG + Intergenic
1028488179 7:91382827-91382849 TTCTTCCAACTCAAACTTTGAGG + Intergenic
1029329050 7:99836163-99836185 TTCTTCCAAGCCTGACTTTTCGG - Intronic
1029672042 7:102040032-102040054 TTCATTCAACGCAACCTTTTCGG + Intronic
1031308285 7:120161647-120161669 CTCTCCAAACTCTACCCTTTGGG + Intergenic
1035183107 7:157105110-157105132 TTCTTCAAACTCTGTCTTTTGGG + Intergenic
1035350640 7:158243601-158243623 TTCTTCCAAATCAACCTTTGTGG - Intronic
1035538419 8:411334-411356 TACTTCTCCCTCTACCTTTTTGG + Intronic
1036979857 8:13458277-13458299 TTCTTCCAACTCTAAAATTATGG - Intronic
1037805261 8:22055192-22055214 TCATTCCAACTCTACCTCTGGGG + Intronic
1039316611 8:36380519-36380541 TTCTTCCACCTCTAACTGATTGG + Intergenic
1040785898 8:51161712-51161734 TTTTTCCAACTCTACATAGTTGG - Intergenic
1041868202 8:62600970-62600992 TTCTATCAACTTTAGCTTTTGGG + Intronic
1043100835 8:76043200-76043222 TCTTCCCAAATCTACCTTTTTGG - Intergenic
1043588897 8:81804300-81804322 TTCATCCTACTCTTTCTTTTGGG - Intronic
1044050994 8:87503851-87503873 TTATTCTACCTGTACCTTTTAGG - Intronic
1044257330 8:90081314-90081336 TTTTTACTTCTCTACCTTTTGGG + Intronic
1044556011 8:93562848-93562870 TTCTCACAACTCTTCCTTCTGGG + Intergenic
1046384257 8:113488148-113488170 TTGTTCCTACTCTTCATTTTCGG + Intergenic
1047232424 8:123008843-123008865 TTCTTGTATCTCTCCCTTTTAGG - Intergenic
1047728675 8:127707262-127707284 TTCTTTCTACTCTTCCTTCTAGG + Intergenic
1047910442 8:129522678-129522700 TTCCTCCTCCTCTATCTTTTGGG - Intergenic
1048068347 8:130995398-130995420 GTTTTTAAACTCTACCTTTTTGG + Intronic
1048181547 8:132199561-132199583 TTCTTCTAAATCTACCTCGTGGG + Intronic
1049895491 9:108068-108090 TTGTTCCTAATCTCCCTTTTGGG + Intergenic
1051030451 9:12668770-12668792 TTCTTTCAACTATACCTTAAAGG - Intergenic
1051494736 9:17707302-17707324 TTCTTCTAAATCTTCCTCTTGGG + Intronic
1051587057 9:18737595-18737617 TTCTTACCACTCTGGCTTTTTGG - Intronic
1053535955 9:38926350-38926372 TTCCTCCAGCTCTAACATTTAGG + Intergenic
1054630178 9:67437602-67437624 TTCCTCCAGCTCTAACATTTAGG - Intergenic
1058322259 9:103647796-103647818 TTCTTCAGCATCTACCTTTTTGG - Intergenic
1059055910 9:110979285-110979307 TTTTTTTAACTCTACATTTTGGG - Intronic
1061079001 9:128358885-128358907 ATCTTCCACCTCTACCTGCTTGG - Intronic
1061440267 9:130598002-130598024 TTTTTCCATGTCTACCTTTTGGG - Intronic
1186033499 X:5395313-5395335 CTTTGCAAACTCTACCTTTTTGG + Intergenic
1186687750 X:11943327-11943349 TTCTTCCCCCTCTACTTTTAGGG + Intergenic
1187009839 X:15267993-15268015 TTCTTCCATTTTTACCTTTTTGG + Intronic
1187816472 X:23238144-23238166 TTATTGCATCTCTACGTTTTTGG + Intergenic
1188528337 X:31110035-31110057 TTCTTACAAATCCACCATTTTGG - Intronic
1188537871 X:31217546-31217568 TTCTACCAACTCTAACTTTAAGG - Intronic
1190748926 X:53344388-53344410 TTCTCCCACCTCAACCTCTTGGG + Intergenic
1191193393 X:57691449-57691471 TTCTTCCAACTTTACTTTTTTGG + Intergenic
1191940766 X:66479448-66479470 TTCTTTCAATTCTACCAATTTGG - Intergenic
1193248975 X:79265396-79265418 TATTTTCAATTCTACCTTTTTGG - Intergenic
1194931204 X:99889266-99889288 TTCCTCCTATTCTACCTTTTTGG - Intergenic
1195295021 X:103468039-103468061 GTTTTACAACTCTACCTTTTAGG + Intergenic
1195885836 X:109636511-109636533 CTCTTCTAACTCTTCCTTCTTGG - Intronic
1198586954 X:138132587-138132609 CTCTTCTAACTTTAGCTTTTAGG + Intergenic
1199266227 X:145830460-145830482 TTTTTCTAAATCTACTTTTTAGG - Intergenic
1200474280 Y:3625440-3625462 TTCTTCCTCCTCTATTTTTTTGG + Intergenic
1201731514 Y:17209753-17209775 TTATTCCAAATCTACATATTTGG - Intergenic
1201947703 Y:19529754-19529776 TTTTTCCATCTCTACATGTTTGG - Intergenic