ID: 981763769

View in Genome Browser
Species Human (GRCh38)
Location 4:148223505-148223527
Sequence GCTGACTTAAGAGCAAAGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 113}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981763764_981763769 30 Left 981763764 4:148223452-148223474 CCACGGTGCCTGGCAGACTGTCA 0: 1
1: 0
2: 3
3: 34
4: 391
Right 981763769 4:148223505-148223527 GCTGACTTAAGAGCAAAGTCAGG 0: 1
1: 0
2: 0
3: 12
4: 113
981763765_981763769 22 Left 981763765 4:148223460-148223482 CCTGGCAGACTGTCAATAAATAT 0: 1
1: 0
2: 3
3: 38
4: 243
Right 981763769 4:148223505-148223527 GCTGACTTAAGAGCAAAGTCAGG 0: 1
1: 0
2: 0
3: 12
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981763769 Original CRISPR GCTGACTTAAGAGCAAAGTC AGG Intronic
901405881 1:9045396-9045418 GCTGACTTTAGAGTAAAGGCTGG + Intronic
901903145 1:12384234-12384256 GCTTACTTAGGAGTAGAGTCAGG + Intronic
901936527 1:12630673-12630695 TCTGATCTCAGAGCAAAGTCGGG + Intergenic
908891083 1:68848748-68848770 GTTGAATCAAGAGCAGAGTCTGG - Intergenic
910642383 1:89477647-89477669 GGTGACCTAAGAGCCAAATCAGG + Intergenic
914234492 1:145796003-145796025 TCTGATTTCAGAACAAAGTCTGG + Intronic
915066391 1:153228569-153228591 AATGATTTAAGAGAAAAGTCAGG + Intergenic
919883175 1:201914349-201914371 GTTGACATAAGAGCAAAGTGTGG - Intronic
924787080 1:247209079-247209101 TCTGACTCAAGTGCCAAGTCAGG + Intergenic
1066665234 10:37776443-37776465 CCCAACTTCAGAGCAAAGTCAGG - Intergenic
1068430252 10:56922522-56922544 GGTGACTTAAGAGTATATTCGGG + Intergenic
1071967174 10:90863617-90863639 ACTGAGTTAAGTGCAAAGTAAGG + Intergenic
1073349072 10:102806499-102806521 GCTGACTTAAGAGTAGACACTGG - Intronic
1075060091 10:119250667-119250689 GCTGACTTAAGGAAAAAGTGTGG - Intronic
1076466163 10:130683305-130683327 GCTGATGTCAGAGCAGAGTCAGG - Intergenic
1080089118 11:28323583-28323605 GTTCAGTTAAGAGCAAGGTCAGG + Intronic
1080575018 11:33590582-33590604 GCCTACTTAAGGGCGAAGTCTGG + Intronic
1080641082 11:34158757-34158779 CCTGACTGTAGATCAAAGTCAGG - Intronic
1084768502 11:71327514-71327536 GCAGACTCAAAAGCAAAGTCAGG - Intergenic
1087809295 11:102593088-102593110 GGTCACATAACAGCAAAGTCAGG + Intronic
1089395763 11:118135714-118135736 CCTGACATAACAGCAGAGTCTGG - Exonic
1091314099 11:134598604-134598626 GCTGACTGGAGCCCAAAGTCAGG - Intergenic
1091784879 12:3237312-3237334 GATGACTTACGATCAAAGACAGG + Intronic
1091906643 12:4194741-4194763 GCTGGCTTAAAGGCACAGTCAGG - Intergenic
1093965663 12:25322293-25322315 GCTGAATTAGGAGAGAAGTCAGG + Intergenic
1094079174 12:26513567-26513589 GCTGGCTTATGCTCAAAGTCAGG - Intronic
1096041113 12:48518391-48518413 GCTTCCTTAAAATCAAAGTCTGG + Intronic
1102552088 12:113698773-113698795 GCTGATTTAAGAGGATAGTAGGG + Intergenic
1104343268 12:127971911-127971933 GTTGTCTTAAGAGTAAAATCTGG + Intergenic
1107646142 13:42496119-42496141 GATGACTTTTGAGCAAAGACTGG - Intergenic
1107706368 13:43110489-43110511 CATTACTTAAGAACAAAGTCAGG + Exonic
1116736176 14:48694963-48694985 GGTGACTTAACAGCAAAGACCGG - Intergenic
1121435108 14:93914017-93914039 TCTCAGTTAATAGCAAAGTCAGG - Intergenic
1122220678 14:100237929-100237951 GCTGACTGGAGAGCAAAGAAGGG + Intergenic
1126063045 15:44802395-44802417 GCTGACTCCAGTGCAAAATCAGG + Intergenic
1126783256 15:52156304-52156326 GCTGATTTTAGAGCAAGGACAGG - Intronic
1128867033 15:71121770-71121792 GCTGTCTTGAGAGGAAAATCAGG + Intronic
1129684985 15:77680686-77680708 CTTGACTTTAGAGCAAAGGCTGG + Intronic
1130260125 15:82348108-82348130 CCTCATTTCAGAGCAAAGTCTGG + Intronic
1131435374 15:92417532-92417554 GCAGACTCAAGAGCAAAGCATGG + Intronic
1131591915 15:93759199-93759221 GCTAGCTTAGGAACAAAGTCAGG - Intergenic
1135676269 16:24417636-24417658 ACTGACTTTTGAGAAAAGTCAGG - Intergenic
1137058755 16:35764271-35764293 GCTGAATAAAAAGCAAAGACTGG + Intergenic
1137269897 16:46896412-46896434 ACTGACTGAAGAGCAAATTGAGG - Intronic
1138852105 16:60641645-60641667 GGTAACTTCAGAGAAAAGTCTGG - Intergenic
1145916814 17:28578940-28578962 GCTGACTCAGGAGAGAAGTCAGG - Intronic
1156460874 18:37320682-37320704 GCTCAGTTCAGAGCAACGTCTGG + Intronic
1156854146 18:41762558-41762580 GCTGATTTTAGACCAAGGTCAGG - Intergenic
1160375849 18:78410873-78410895 ACCGACTTAAGAGTAAAATCTGG + Intergenic
1161128968 19:2576982-2577004 AATGACTTAAGAGCAAATTCAGG - Intronic
1202636419 1_KI270706v1_random:48190-48212 ACTGACTTAAAAAAAAAGTCTGG + Intergenic
928410620 2:31051397-31051419 AAAGACTTAAGAGCAAAGTCAGG + Intronic
935281467 2:101521589-101521611 CCTGACATCAGAGCAAGGTCTGG - Intergenic
938180737 2:129179543-129179565 TCTGATCTCAGAGCAAAGTCAGG - Intergenic
939515123 2:143156851-143156873 GCTGGTTTAAAAGCAAAGTCAGG - Intronic
942025165 2:171903706-171903728 GGTGACAGAAGAGCAGAGTCAGG - Intronic
945368103 2:208981020-208981042 GCTGACTAATAAGCAAAGTAGGG + Intergenic
946280680 2:218663780-218663802 ACAGACTTCAGAGCAAAGTTGGG + Intergenic
1169488225 20:6051335-6051357 ACAGACATCAGAGCAAAGTCTGG - Intronic
1169825009 20:9758160-9758182 GCTGCCTCAAGAGCAAAAGCAGG - Intronic
1170043940 20:12065931-12065953 TCTGACCTCAGAGCAAAGTCAGG - Intergenic
1171009321 20:21499772-21499794 GCTGACTTCAGAGCCTAGCCTGG + Intergenic
1173283073 20:41646475-41646497 GCAGACTCAAGAGCAGAGACTGG - Intergenic
1178601311 21:33997047-33997069 GCTGACACAAGAGTAAAATCAGG - Intergenic
1179095773 21:38313402-38313424 ACTGACTTGAGAGCAATGCCAGG - Intergenic
951065940 3:18265662-18265684 GCTTACTCAAGAGCCAACTCAGG + Intronic
952310953 3:32189862-32189884 GCTGATTTCAGATCAGAGTCTGG + Intergenic
952771905 3:37009286-37009308 ACTGACTCTAGAGCAAAGTCAGG - Intronic
953228653 3:41044041-41044063 GCTGACATAAGAGTGAGGTCAGG - Intergenic
954099415 3:48357910-48357932 TCTGATCTTAGAGCAAAGTCAGG - Intergenic
955535981 3:59924153-59924175 GCTGACTTAAAAGCAAAACCAGG + Intronic
962680012 3:137789346-137789368 TCTGACTTATTAGCAAATTCAGG - Intergenic
962791298 3:138813955-138813977 GCTGAATTAAGAGCCAAGTTGGG + Intronic
964620644 3:158717365-158717387 GCTGACTTAAGAGCTATGAGAGG + Intronic
968847115 4:3050321-3050343 GCTGATTTAAGATGAAAATCTGG + Intergenic
971477816 4:27088861-27088883 GCTGTCTCCAGAGCAAAGCCTGG + Intergenic
971611410 4:28731087-28731109 GCTGAATGAGGAGCAAAGTCAGG + Intergenic
972443348 4:39118450-39118472 ACAGAATTAAGAGCAAAGACTGG + Intronic
975635465 4:76443830-76443852 GTTGACATAAGTGCAAATTCAGG - Intronic
975939927 4:79630400-79630422 GCTCTCTTAAGAACAAGGTCAGG - Intergenic
978137005 4:105274901-105274923 GCAAAGATAAGAGCAAAGTCAGG - Intronic
981763769 4:148223505-148223527 GCTGACTTAAGAGCAAAGTCAGG + Intronic
983664948 4:170170948-170170970 GATGAGGTAAGAGCACAGTCTGG + Intergenic
986510486 5:8501470-8501492 GAAGCATTAAGAGCAAAGTCTGG + Intergenic
991655950 5:68903971-68903993 TCTGACTTATGGTCAAAGTCTGG + Intergenic
995169356 5:109089564-109089586 ACTGACTTAATAGCAATGTATGG + Intronic
995455167 5:112343646-112343668 ACTGAGTTAAAAGCCAAGTCTGG - Intronic
1001441835 5:171749574-171749596 GCTGTTTCAAGAGCAAAGACAGG - Intergenic
1003440840 6:6140161-6140183 GCTGGCTTAAGACCAACTTCAGG - Intergenic
1005670186 6:28098016-28098038 TCTGACTTAAAAGCAAGTTCTGG - Intergenic
1011230938 6:85161249-85161271 GGTAACCCAAGAGCAAAGTCTGG + Intergenic
1014798886 6:125755840-125755862 TCTGACCTAAGAAAAAAGTCTGG + Intronic
1016769568 6:147834284-147834306 GCTGACGTAAGAGGAGAGTTGGG + Intergenic
1016779114 6:147939006-147939028 TCTGACTTATATGCAAAGTCTGG + Intergenic
1016888000 6:148977375-148977397 GCTGAGTAAAGAGGAAAGACTGG - Intronic
1019862971 7:3677428-3677450 GGTGAATGAGGAGCAAAGTCAGG + Intronic
1020207704 7:6131665-6131687 GCTGACTTTAGCTCTAAGTCTGG + Intronic
1021235105 7:18133460-18133482 GGAGACTTAGGAGCTAAGTCTGG + Intronic
1022345615 7:29511522-29511544 CCTGACTTAAGAGGAAACTGTGG + Intronic
1023081182 7:36527947-36527969 CCTGACTTAAGCTCAGAGTCAGG - Intronic
1024272012 7:47649765-47649787 GGTGACTCGAGAGCACAGTCTGG - Intergenic
1024436194 7:49357755-49357777 GCTAACTTAGGACCAAAGACAGG + Intergenic
1030076321 7:105740154-105740176 TCTGAATCAAGAACAAAGTCAGG + Intronic
1031755442 7:125636182-125636204 GTTGCCTTAAGATGAAAGTCAGG + Intergenic
1035234312 7:157486464-157486486 GCTGACTTAGACGCACAGTCAGG - Intergenic
1035252473 7:157606181-157606203 GCTGATCTTGGAGCAAAGTCAGG - Intronic
1036449417 8:8852792-8852814 GCTGACATCAGAACAGAGTCCGG + Intronic
1041357353 8:57014496-57014518 TCTGATGTCAGAGCAAAGTCAGG - Intergenic
1042196877 8:66238462-66238484 TCTGATCTTAGAGCAAAGTCAGG - Intergenic
1043087242 8:75849774-75849796 TCTGATCTCAGAGCAAAGTCAGG - Intergenic
1043229140 8:77777535-77777557 GCTGAGTTTAGTGAAAAGTCAGG + Intergenic
1047850024 8:128846829-128846851 GCTCAATCAAGAGGAAAGTCAGG + Intergenic
1048466894 8:134672976-134672998 GAAGACTTAAGAGGAAAATCTGG - Intronic
1050483912 9:6114350-6114372 TCTGATCTTAGAGCAAAGTCAGG + Intergenic
1050558839 9:6812754-6812776 GCTAACTAAAGATCAGAGTCAGG - Intronic
1052027743 9:23592746-23592768 GCTGACAGAAGAAGAAAGTCTGG + Intergenic
1052935462 9:34089248-34089270 GCAGACATAAAAGCAAAATCGGG + Intronic
1055385322 9:75755854-75755876 TCTGACTTTACATCAAAGTCAGG - Intergenic
1058666541 9:107322626-107322648 TCTGACTACAGAGCAAAGCCTGG + Intronic
1061681404 9:132244188-132244210 GCTGACTGAAGAGCAGAGGGAGG - Exonic
1186270872 X:7886812-7886834 GGTGCCTTAAGAGGAAAGTGGGG + Intergenic
1186655034 X:11603000-11603022 CGTGACTTAAGAATAAAGTCAGG - Intronic
1186802735 X:13109909-13109931 GCTGACTTAAGACAAATCTCTGG - Intergenic
1187223756 X:17355970-17355992 GATGACTTAATAGCACAGTGTGG + Intergenic
1187439962 X:19309513-19309535 GCTGTCTTAATAGGATAGTCAGG + Intergenic
1199967085 X:152829670-152829692 GCTTACTGAAGAGCAAAAGCAGG - Exonic