ID: 981764250

View in Genome Browser
Species Human (GRCh38)
Location 4:148229854-148229876
Sequence CTAGAGTTCTTTAGGGAAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 374
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 167}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981764250_981764267 25 Left 981764250 4:148229854-148229876 CCCCCTTCCCTAAAGAACTCTAG 0: 1
1: 0
2: 1
3: 18
4: 167
Right 981764267 4:148229902-148229924 CTACAGCTTACTTATGTCCAGGG 0: 1
1: 0
2: 0
3: 11
4: 122
981764250_981764266 24 Left 981764250 4:148229854-148229876 CCCCCTTCCCTAAAGAACTCTAG 0: 1
1: 0
2: 1
3: 18
4: 167
Right 981764266 4:148229901-148229923 CCTACAGCTTACTTATGTCCAGG 0: 1
1: 0
2: 0
3: 2
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981764250 Original CRISPR CTAGAGTTCTTTAGGGAAGG GGG (reversed) Intronic
901596170 1:10386917-10386939 CAAGAGTTCCTAAGGGAAAGTGG - Intergenic
901596170 1:10386917-10386939 CAAGAGTTCCTAAGGGAAAGTGG - Intergenic
902951122 1:19883337-19883359 CCAGCTTTCTTTAGGGAACGCGG + Intronic
902951122 1:19883337-19883359 CCAGCTTTCTTTAGGGAACGCGG + Intronic
905693071 1:39956555-39956577 GAGGAGTTCTTTAGGGATGGTGG + Intronic
905693071 1:39956555-39956577 GAGGAGTTCTTTAGGGATGGTGG + Intronic
906674448 1:47683076-47683098 CTAGAGTTCCTTAGGGCATCTGG + Intergenic
906674448 1:47683076-47683098 CTAGAGTTCCTTAGGGCATCTGG + Intergenic
907972763 1:59400326-59400348 CTGGTGTTCTTTAAGGTAGGTGG - Intronic
907972763 1:59400326-59400348 CTGGTGTTCTTTAAGGTAGGTGG - Intronic
910119957 1:83776516-83776538 CCAGTGTTATTTAGGGTAGGAGG + Intergenic
910119957 1:83776516-83776538 CCAGTGTTATTTAGGGTAGGAGG + Intergenic
910576101 1:88765604-88765626 CTTGAGTTCTTTAGTGGAAGTGG + Intronic
910576101 1:88765604-88765626 CTTGAGTTCTTTAGTGGAAGTGG + Intronic
911375967 1:97051944-97051966 CAAGGGTTTTTTAGAGAAGGAGG + Intergenic
911375967 1:97051944-97051966 CAAGGGTTTTTTAGAGAAGGAGG + Intergenic
912185368 1:107268749-107268771 CTAGAATGGTTTTGGGAAGGAGG - Intronic
912185368 1:107268749-107268771 CTAGAATGGTTTTGGGAAGGAGG - Intronic
912403085 1:109412474-109412496 CTAGAGTCTTTGAGGGAAAGAGG - Intronic
912403085 1:109412474-109412496 CTAGAGTCTTTGAGGGAAAGAGG - Intronic
915074139 1:153295133-153295155 CTAAAGTTCATAAGGGATGGAGG + Intergenic
915074139 1:153295133-153295155 CTAAAGTTCATAAGGGATGGAGG + Intergenic
915322471 1:155063280-155063302 CTAAGGCTCTTTAGGGAAGGTGG + Intergenic
915322471 1:155063280-155063302 CTAAGGCTCTTTAGGGAAGGTGG + Intergenic
915615166 1:157032120-157032142 CTAGAGATCTTTAAGGATGGTGG - Intronic
915615166 1:157032120-157032142 CTAGAGATCTTTAAGGATGGTGG - Intronic
923151659 1:231238933-231238955 CTATTGTTCTTTAGGGAAGAGGG + Exonic
923151659 1:231238933-231238955 CTATTGTTCTTTAGGGAAGAGGG + Exonic
923881076 1:238104768-238104790 CCAGATATCTTTAGGGAAAGGGG - Intergenic
923881076 1:238104768-238104790 CCAGATATCTTTAGGGAAAGGGG - Intergenic
924435743 1:244040147-244040169 TTAGAGTTGTTTAGGAAAGCAGG + Intergenic
924435743 1:244040147-244040169 TTAGAGTTGTTTAGGAAAGCAGG + Intergenic
1065240806 10:23702204-23702226 GTACAGTTCTTTAGGGAAGAGGG + Intronic
1065240806 10:23702204-23702226 GTACAGTTCTTTAGGGAAGAGGG + Intronic
1066253394 10:33655565-33655587 CTGGAGTTCTTGAGGAAAGGAGG - Intergenic
1066253394 10:33655565-33655587 CTGGAGTTCTTGAGGAAAGGAGG - Intergenic
1066295332 10:34049131-34049153 TCAGAGTTCCTTAGGGAAGCTGG - Intergenic
1066295332 10:34049131-34049153 TCAGAGTTCCTTAGGGAAGCTGG - Intergenic
1067184784 10:44017328-44017350 AGTGAGTTCTTTAGGGAAAGGGG - Intergenic
1067184784 10:44017328-44017350 AGTGAGTTCTTTAGGGAAAGGGG - Intergenic
1071184621 10:83027338-83027360 CCAGAGATCTTTAGAGAAAGAGG - Intergenic
1071184621 10:83027338-83027360 CCAGAGATCTTTAGAGAAAGAGG - Intergenic
1072808222 10:98439170-98439192 CTAGAGTGATTAAGGGAATGTGG + Intronic
1072808222 10:98439170-98439192 CTAGAGTGATTAAGGGAATGTGG + Intronic
1072931991 10:99673147-99673169 TCAGACCTCTTTAGGGAAGGTGG + Intronic
1072931991 10:99673147-99673169 TCAGACCTCTTTAGGGAAGGTGG + Intronic
1074391753 10:113063770-113063792 AAAGAGTTCTTTAGGAAAAGGGG + Intronic
1074391753 10:113063770-113063792 AAAGAGTTCTTTAGGAAAAGGGG + Intronic
1074546022 10:114403334-114403356 CAAGACTACTTTAGGGAAGCCGG + Intronic
1074546022 10:114403334-114403356 CAAGACTACTTTAGGGAAGCCGG + Intronic
1076524435 10:131102611-131102633 CCAGAGTTAATTAGGGGAGGAGG - Intronic
1076524435 10:131102611-131102633 CCAGAGTTAATTAGGGGAGGAGG - Intronic
1078410232 11:11108681-11108703 CCAGAGATCTTTAGAGATGGTGG - Intergenic
1078410232 11:11108681-11108703 CCAGAGATCTTTAGAGATGGTGG - Intergenic
1082763297 11:57146931-57146953 CTAGAGTCCTTTGTTGAAGGAGG - Intergenic
1082763297 11:57146931-57146953 CTAGAGTCCTTTGTTGAAGGAGG - Intergenic
1084116658 11:67046417-67046439 CTAGAGATAGTGAGGGAAGGTGG - Intronic
1084116658 11:67046417-67046439 CTAGAGATAGTGAGGGAAGGTGG - Intronic
1085845088 11:80056100-80056122 CTAGAATCCATCAGGGAAGGAGG - Intergenic
1085845088 11:80056100-80056122 CTAGAATCCATCAGGGAAGGAGG - Intergenic
1088847356 11:113679829-113679851 TTACAGTGCTTTAGGGAAGTAGG + Intergenic
1088847356 11:113679829-113679851 TTACAGTGCTTTAGGGAAGTAGG + Intergenic
1088936098 11:114401498-114401520 TTAGATTTATTTGGGGAAGGGGG - Intronic
1088936098 11:114401498-114401520 TTAGATTTATTTGGGGAAGGGGG - Intronic
1091893782 12:4083985-4084007 CTGGAGTTATTAAGGAAAGGGGG - Intergenic
1091893782 12:4083985-4084007 CTGGAGTTATTAAGGAAAGGGGG - Intergenic
1092797880 12:12131427-12131449 CTAGAATTCTTTAGTGAAAGAGG - Intronic
1092797880 12:12131427-12131449 CTAGAATTCTTTAGTGAAAGAGG - Intronic
1095963691 12:47852079-47852101 CTGGGGTTCCTTAGTGAAGGGGG + Intronic
1095963691 12:47852079-47852101 CTGGGGTTCCTTAGTGAAGGGGG + Intronic
1096808519 12:54155304-54155326 CTAGAGCTCTGGAGGGAAGAGGG - Intergenic
1096808519 12:54155304-54155326 CTAGAGCTCTGGAGGGAAGAGGG - Intergenic
1104473906 12:129054501-129054523 CTTGGGTTCTCTAGGGACGGGGG - Intergenic
1104473906 12:129054501-129054523 CTTGGGTTCTCTAGGGACGGGGG - Intergenic
1105227273 13:18447835-18447857 CCACAGCTCTTTAGGGCAGGGGG - Intergenic
1105227273 13:18447835-18447857 CCACAGCTCTTTAGGGCAGGGGG - Intergenic
1105589951 13:21783211-21783233 CAAGAGTTCTTTTGAGAAGCTGG + Intergenic
1105589951 13:21783211-21783233 CAAGAGTTCTTTTGAGAAGCTGG + Intergenic
1105665343 13:22549686-22549708 CTACAGATATTCAGGGAAGGTGG - Intergenic
1105665343 13:22549686-22549708 CTACAGATATTCAGGGAAGGTGG - Intergenic
1106169332 13:27275504-27275526 CTTGAGCTCTTTAGGGGAGCAGG + Intergenic
1106169332 13:27275504-27275526 CTTGAGCTCTTTAGGGGAGCAGG + Intergenic
1112121317 13:96415118-96415140 CTATGGTTCTTTGGGGAATGGGG + Intronic
1112121317 13:96415118-96415140 CTATGGTTCTTTGGGGAATGGGG + Intronic
1112610972 13:100954304-100954326 CTAGAGTGCTATAGGGCTGGTGG - Intergenic
1112610972 13:100954304-100954326 CTAGAGTGCTATAGGGCTGGTGG - Intergenic
1113727708 13:112617652-112617674 TTAAAGACCTTTAGGGAAGGTGG + Intergenic
1113727708 13:112617652-112617674 TTAAAGACCTTTAGGGAAGGTGG + Intergenic
1114011722 14:18376289-18376311 CCACAGCTCTTTAGGGCAGGGGG - Intergenic
1114011722 14:18376289-18376311 CCACAGCTCTTTAGGGCAGGGGG - Intergenic
1114470767 14:22959597-22959619 CTAAAGTACTTTGGGGAATGAGG + Intronic
1114470767 14:22959597-22959619 CTAAAGTACTTTGGGGAATGAGG + Intronic
1117887046 14:60375420-60375442 CTGGAGTTTTTAAGGGAATGTGG - Intergenic
1117887046 14:60375420-60375442 CTGGAGTTTTTAAGGGAATGTGG - Intergenic
1119173785 14:72554557-72554579 CCAGAGTCCATTTGGGAAGGAGG + Intronic
1119173785 14:72554557-72554579 CCAGAGTCCATTTGGGAAGGAGG + Intronic
1119930935 14:78545789-78545811 GTAGAGTTCCTGAGGGAAAGAGG - Intronic
1119930935 14:78545789-78545811 GTAGAGTTCCTGAGGGAAAGAGG - Intronic
1120244002 14:81984252-81984274 CTAAACTTCCTTAGGGGAGGAGG - Intergenic
1120244002 14:81984252-81984274 CTAAACTTCCTTAGGGGAGGAGG - Intergenic
1122626367 14:103087328-103087350 CTTGTGCTCTTTTGGGAAGGTGG + Intergenic
1122626367 14:103087328-103087350 CTTGTGCTCTTTTGGGAAGGTGG + Intergenic
1125450731 15:39803926-39803948 CTAGATTTCTTTCTGGGAGGAGG + Intronic
1125450731 15:39803926-39803948 CTAGATTTCTTTCTGGGAGGAGG + Intronic
1126570197 15:50142463-50142485 CTAGAGTTGCTTTGGGGAGGAGG - Intronic
1126570197 15:50142463-50142485 CTAGAGTTGCTTTGGGGAGGAGG - Intronic
1129724012 15:77892444-77892466 CAAGAGTTCTTGGGGCAAGGAGG + Intergenic
1129724012 15:77892444-77892466 CAAGAGTTCTTGGGGCAAGGAGG + Intergenic
1129930105 15:79403421-79403443 TTAGAGTTCCTTAGGGAAGGAGG - Intronic
1129930105 15:79403421-79403443 TTAGAGTTCCTTAGGGAAGGAGG - Intronic
1131737889 15:95353441-95353463 CCACAGATCTTTGGGGAAGGAGG - Intergenic
1131737889 15:95353441-95353463 CCACAGATCTTTGGGGAAGGAGG - Intergenic
1133148761 16:3810633-3810655 CTTGATATCTGTAGGGAAGGTGG + Exonic
1133148761 16:3810633-3810655 CTTGATATCTGTAGGGAAGGTGG + Exonic
1137267535 16:46881406-46881428 ATACAGTTTCTTAGGGAAGGCGG - Intergenic
1137267535 16:46881406-46881428 ATACAGTTTCTTAGGGAAGGCGG - Intergenic
1137571483 16:49569044-49569066 CTAGAGTTCTTTAGAGGCGGGGG - Intronic
1137571483 16:49569044-49569066 CTAGAGTTCTTTAGAGGCGGGGG - Intronic
1137721748 16:50631606-50631628 CTAGAGATCCTGGGGGAAGGTGG + Intronic
1137721748 16:50631606-50631628 CTAGAGATCCTGGGGGAAGGTGG + Intronic
1137751193 16:50862352-50862374 CAAGGGTTCTTTGGGGAATGTGG + Intergenic
1137751193 16:50862352-50862374 CAAGGGTTCTTTGGGGAATGTGG + Intergenic
1138013413 16:53406270-53406292 TAAGAGTTCTTAAGGAAAGGTGG - Intergenic
1138013413 16:53406270-53406292 TAAGAGTTCTTAAGGAAAGGTGG - Intergenic
1139266159 16:65640372-65640394 CTAGAGTACATTTGGGGAGGGGG - Intergenic
1139266159 16:65640372-65640394 CTAGAGTACATTTGGGGAGGGGG - Intergenic
1141049050 16:80744307-80744329 ATAGAGTTGCTTAGGGAATGGGG - Intronic
1141049050 16:80744307-80744329 ATAGAGTTGCTTAGGGAATGGGG - Intronic
1142135799 16:88451581-88451603 GTGGACTTCTTTGGGGAAGGAGG + Intergenic
1142135799 16:88451581-88451603 GTGGACTTCTTTGGGGAAGGAGG + Intergenic
1142993286 17:3746171-3746193 TCAGCCTTCTTTAGGGAAGGAGG + Intronic
1142993286 17:3746171-3746193 TCAGCCTTCTTTAGGGAAGGAGG + Intronic
1147760451 17:42794760-42794782 CTGGAGCTCTTCTGGGAAGGAGG - Exonic
1147760451 17:42794760-42794782 CTGGAGCTCTTCTGGGAAGGAGG - Exonic
1148708857 17:49661537-49661559 GAAGAGTTCTTTGGGGAAGCTGG - Intronic
1148708857 17:49661537-49661559 GAAGAGTTCTTTGGGGAAGCTGG - Intronic
1154526104 18:15291640-15291662 CCACAGCTCTTTAGGGCAGGGGG + Intergenic
1154526104 18:15291640-15291662 CCACAGCTCTTTAGGGCAGGGGG + Intergenic
1155149672 18:23112968-23112990 CTGAAGTTCCTTAGGGAATGGGG + Intergenic
1155149672 18:23112968-23112990 CTGAAGTTCCTTAGGGAATGGGG + Intergenic
1158725555 18:59968576-59968598 CTAGAGGGCTGTGGGGAAGGAGG + Intergenic
1158725555 18:59968576-59968598 CTAGAGGGCTGTGGGGAAGGAGG + Intergenic
1158785568 18:60707664-60707686 CTCCAGGTCTTTAGTGAAGGAGG + Intergenic
1158785568 18:60707664-60707686 CTCCAGGTCTTTAGTGAAGGAGG + Intergenic
1159435899 18:68416496-68416518 CTAGGGTGATTTTGGGAAGGAGG - Intergenic
1159435899 18:68416496-68416518 CTAGGGTGATTTTGGGAAGGAGG - Intergenic
1161067527 19:2246069-2246091 CAAGTGTTCTTTACAGAAGGCGG + Intronic
1161067527 19:2246069-2246091 CAAGTGTTCTTTACAGAAGGCGG + Intronic
1162625612 19:11882199-11882221 TTGGAGTTCTTTAGGGGAGAGGG - Intronic
1162625612 19:11882199-11882221 TTGGAGTTCTTTAGGGGAGAGGG - Intronic
1162660909 19:12168506-12168528 CTCAAGTCCTGTAGGGAAGGGGG + Intronic
1162660909 19:12168506-12168528 CTCAAGTCCTGTAGGGAAGGGGG + Intronic
1165279379 19:34783453-34783475 CTGGAGTGATTTAGGGCAGGGGG + Intergenic
1165279379 19:34783453-34783475 CTGGAGTGATTTAGGGCAGGGGG + Intergenic
1165864055 19:38925346-38925368 TCAGAGTTCTGTGGGGAAGGAGG - Intronic
1165864055 19:38925346-38925368 TCAGAGTTCTGTGGGGAAGGAGG - Intronic
926227541 2:10978941-10978963 CTTGAGTACATGAGGGAAGGGGG - Intergenic
926227541 2:10978941-10978963 CTTGAGTACATGAGGGAAGGGGG - Intergenic
929764204 2:44830857-44830879 CTGGTGGTCTTTCGGGAAGGTGG - Intergenic
929764204 2:44830857-44830879 CTGGTGGTCTTTCGGGAAGGTGG - Intergenic
930174691 2:48289782-48289804 CTAAAGTTGTTTGGGAAAGGAGG + Intergenic
930174691 2:48289782-48289804 CTAAAGTTGTTTGGGAAAGGAGG + Intergenic
930463237 2:51710590-51710612 CAAGAGTTTTATAGGGAAGAAGG - Intergenic
930463237 2:51710590-51710612 CAAGAGTTTTATAGGGAAGAAGG - Intergenic
930485281 2:52004033-52004055 CTAGAGTTGTCTTGGGAAGCAGG - Intergenic
930485281 2:52004033-52004055 CTAGAGTTGTCTTGGGAAGCAGG - Intergenic
931643602 2:64402475-64402497 ATAAAGTTCTTTAGGGAAAGAGG - Intergenic
931643602 2:64402475-64402497 ATAAAGTTCTTTAGGGAAAGAGG - Intergenic
934102288 2:88664708-88664730 CTAGAGTTTTTTAAAGAATGTGG + Intergenic
934102288 2:88664708-88664730 CTAGAGTTTTTTAAAGAATGTGG + Intergenic
938525208 2:132123005-132123027 CCACAGCTCTTTAGGGCAGGGGG + Intergenic
938525208 2:132123005-132123027 CCACAGCTCTTTAGGGCAGGGGG + Intergenic
940109931 2:150140508-150140530 CCAGACTCTTTTAGGGAAGGCGG + Intergenic
940109931 2:150140508-150140530 CCAGACTCTTTTAGGGAAGGCGG + Intergenic
940200845 2:151148720-151148742 GTGGAGTTCTTTGGGGAAGCTGG - Intergenic
940200845 2:151148720-151148742 GTGGAGTTCTTTGGGGAAGCTGG - Intergenic
941225638 2:162843529-162843551 CTAGTGTTTTGTAGGGGAGGGGG + Intergenic
941225638 2:162843529-162843551 CTAGTGTTTTGTAGGGGAGGGGG + Intergenic
941575597 2:167226365-167226387 CTACAGAGCTATAGGGAAGGTGG - Intronic
941575597 2:167226365-167226387 CTACAGAGCTATAGGGAAGGTGG - Intronic
943150465 2:184106205-184106227 TTTGAGTTATTTAGGGAAGCAGG + Intergenic
943150465 2:184106205-184106227 TTTGAGTTATTTAGGGAAGCAGG + Intergenic
943992467 2:194714173-194714195 TTAGAATTTTTTAGGTAAGGAGG - Intergenic
943992467 2:194714173-194714195 TTAGAATTTTTTAGGTAAGGAGG - Intergenic
946028518 2:216687318-216687340 CTATATATCTTCAGGGAAGGAGG - Intronic
946028518 2:216687318-216687340 CTATATATCTTCAGGGAAGGAGG - Intronic
947327952 2:228998761-228998783 CCACAGATCTTTAAGGAAGGGGG - Intronic
947327952 2:228998761-228998783 CCACAGATCTTTAAGGAAGGGGG - Intronic
948527493 2:238580626-238580648 CCAGAGTGCTTTGGGGCAGGTGG + Intergenic
948527493 2:238580626-238580648 CCAGAGTGCTTTGGGGCAGGTGG + Intergenic
1168880378 20:1201435-1201457 CTGAAGTTCTTGGGGGAAGGGGG + Intergenic
1168880378 20:1201435-1201457 CTGAAGTTCTTGGGGGAAGGGGG + Intergenic
1169205108 20:3735064-3735086 CATGAGTTCTTTAAGGAAGGAGG - Intronic
1169205108 20:3735064-3735086 CATGAGTTCTTTAAGGAAGGAGG - Intronic
1169834030 20:9857831-9857853 CCAGAGTTCCTCAGAGAAGGAGG + Intergenic
1169834030 20:9857831-9857853 CCAGAGTTCCTCAGAGAAGGAGG + Intergenic
1176900116 21:14430876-14430898 CTATAGTTCTTTGGGTAATGTGG - Intergenic
1176900116 21:14430876-14430898 CTATAGTTCTTTGGGTAATGTGG - Intergenic
1178315038 21:31560094-31560116 CTAGAGCTCTTCAGGAGAGGAGG - Intergenic
1178315038 21:31560094-31560116 CTAGAGCTCTTCAGGAGAGGAGG - Intergenic
1178386144 21:32152096-32152118 CTAGAGTTCCTTAGAGAAATAGG + Intergenic
1178386144 21:32152096-32152118 CTAGAGTTCCTTAGAGAAATAGG + Intergenic
1179032500 21:37732728-37732750 CTAGAATTCTTAAGAGAAGCGGG - Intronic
1179032500 21:37732728-37732750 CTAGAATTCTTAAGAGAAGCGGG - Intronic
1179050917 21:37888009-37888031 CTGGAGCTGTGTAGGGAAGGTGG + Intronic
1179050917 21:37888009-37888031 CTGGAGCTGTGTAGGGAAGGTGG + Intronic
1179267711 21:39819418-39819440 CCAGAATTTTTTAGGAAAGGGGG - Intergenic
1179267711 21:39819418-39819440 CCAGAATTTTTTAGGAAAGGGGG - Intergenic
1180436215 22:15307097-15307119 CCACAGCTCTTTAGGGCAGGGGG - Intergenic
1180436215 22:15307097-15307119 CCACAGCTCTTTAGGGCAGGGGG - Intergenic
1181823836 22:25497237-25497259 CTACAGTTCTGTAGGGAGTGAGG - Intergenic
1181823836 22:25497237-25497259 CTACAGTTCTGTAGGGAGTGAGG - Intergenic
952984906 3:38770509-38770531 ATAGAGTTCTCCAGGGAAGTGGG + Intronic
952984906 3:38770509-38770531 ATAGAGTTCTCCAGGGAAGTGGG + Intronic
954958613 3:54544568-54544590 CTAGATTTTTGTAGGGATGGGGG + Intronic
954958613 3:54544568-54544590 CTAGATTTTTGTAGGGATGGGGG + Intronic
958076111 3:88680559-88680581 CATGAGTTTTTTAGTGAAGGAGG + Intergenic
958076111 3:88680559-88680581 CATGAGTTTTTTAGTGAAGGAGG + Intergenic
958712677 3:97737139-97737161 CTGGACTTCTTTAGGGAAGATGG - Intronic
958712677 3:97737139-97737161 CTGGACTTCTTTAGGGAAGATGG - Intronic
960433187 3:117594973-117594995 GTATAGTTCTTAAGGGAGGGTGG + Intergenic
960433187 3:117594973-117594995 GTATAGTTCTTAAGGGAGGGTGG + Intergenic
960965858 3:123104296-123104318 CTGGAGTTCTTCAGGGCAGAGGG + Intronic
960965858 3:123104296-123104318 CTGGAGTTCTTCAGGGCAGAGGG + Intronic
961632462 3:128311392-128311414 CCAGATTCCTGTAGGGAAGGAGG + Intronic
961632462 3:128311392-128311414 CCAGATTCCTGTAGGGAAGGAGG + Intronic
961923880 3:130455404-130455426 CTAGATAACTTTAGAGAAGGAGG - Intronic
961923880 3:130455404-130455426 CTAGATAACTTTAGAGAAGGAGG - Intronic
963311345 3:143713596-143713618 TTAAATTTCTTCAGGGAAGGAGG - Intronic
963311345 3:143713596-143713618 TTAAATTTCTTCAGGGAAGGAGG - Intronic
963953997 3:151233121-151233143 CTAGAGATGTTCAGGGGAGGAGG - Intronic
963953997 3:151233121-151233143 CTAGAGATGTTCAGGGGAGGAGG - Intronic
964612221 3:158627042-158627064 TTGGAGTTCTTTTGGGGAGGGGG + Intergenic
964612221 3:158627042-158627064 TTGGAGTTCTTTTGGGGAGGGGG + Intergenic
964700664 3:159562427-159562449 CTAATGTTCTTCAGGGAGGGAGG + Intronic
964700664 3:159562427-159562449 CTAATGTTCTTCAGGGAGGGAGG + Intronic
964823067 3:160795253-160795275 CTAGAGTTACTTAGAAAAGGGGG - Intronic
964823067 3:160795253-160795275 CTAGAGTTACTTAGAAAAGGGGG - Intronic
966557201 3:181276030-181276052 ATATAGTTCATAAGGGAAGGAGG - Intergenic
966557201 3:181276030-181276052 ATATAGTTCATAAGGGAAGGAGG - Intergenic
967320957 3:188194598-188194620 CTGTAGTTCTTGAGGGAAGAAGG + Intronic
967320957 3:188194598-188194620 CTGTAGTTCTTGAGGGAAGAAGG + Intronic
969296318 4:6272208-6272230 CAAGACTTCTCTAGGGCAGGGGG + Intronic
969296318 4:6272208-6272230 CAAGACTTCTCTAGGGCAGGGGG + Intronic
970366927 4:15368867-15368889 GCAGAGTTCTTTAGGGCAGATGG + Intronic
970366927 4:15368867-15368889 GCAGAGTTCTTTAGGGCAGATGG + Intronic
970745897 4:19294903-19294925 CTTCATTTCTTTTGGGAAGGTGG - Intergenic
970745897 4:19294903-19294925 CTTCATTTCTTTTGGGAAGGTGG - Intergenic
971839990 4:31838566-31838588 CTATATTTCTTTAGGGAACTAGG - Intergenic
971839990 4:31838566-31838588 CTATATTTCTTTAGGGAACTAGG - Intergenic
971872196 4:32256923-32256945 CTGGAGTTCTTCAGAGAAAGAGG - Intergenic
971872196 4:32256923-32256945 CTGGAGTTCTTCAGAGAAAGAGG - Intergenic
972389882 4:38604587-38604609 CTAGAGTTCAGGAGGGAAGATGG - Intergenic
972389882 4:38604587-38604609 CTAGAGTTCAGGAGGGAAGATGG - Intergenic
976526778 4:86101321-86101343 TTAGAGCTCTGTAGGCAAGGGGG - Intronic
976526778 4:86101321-86101343 TTAGAGCTCTGTAGGCAAGGGGG - Intronic
978113328 4:104989172-104989194 GTAGAGTTCTTTCTGGAAAGTGG - Intergenic
978113328 4:104989172-104989194 GTAGAGTTCTTTCTGGAAAGTGG - Intergenic
980081891 4:128352975-128352997 ATAGAATTATTTTGGGAAGGTGG + Intergenic
980081891 4:128352975-128352997 ATAGAATTATTTTGGGAAGGTGG + Intergenic
981764250 4:148229854-148229876 CTAGAGTTCTTTAGGGAAGGGGG - Intronic
981764250 4:148229854-148229876 CTAGAGTTCTTTAGGGAAGGGGG - Intronic
982099806 4:151956906-151956928 CTTGTGTTCTTTAGTAAAGGAGG + Intergenic
982099806 4:151956906-151956928 CTTGTGTTCTTTAGTAAAGGAGG + Intergenic
982990197 4:162263857-162263879 CAAAAGTACTTTAAGGAAGGTGG - Intergenic
982990197 4:162263857-162263879 CAAAAGTACTTTAAGGAAGGTGG - Intergenic
984744568 4:183201943-183201965 TTATAGTTCTCAAGGGAAGGGGG + Intronic
984744568 4:183201943-183201965 TTATAGTTCTCAAGGGAAGGGGG + Intronic
984846693 4:184114477-184114499 CCGGAGTTCTTAAGGAAAGGAGG + Intronic
984846693 4:184114477-184114499 CCGGAGTTCTTAAGGAAAGGAGG + Intronic
984846764 4:184115059-184115081 CCGGAGTTCTTAAGGAAAGGAGG + Intronic
984846764 4:184115059-184115081 CCGGAGTTCTTAAGGAAAGGAGG + Intronic
985746297 5:1650460-1650482 CTAGAGGTCTTACGGGAAGAAGG + Intergenic
985746297 5:1650460-1650482 CTAGAGGTCTTACGGGAAGAAGG + Intergenic
986546761 5:8906077-8906099 CTAGGCTTCTTGAGGGAGGGAGG + Intergenic
986546761 5:8906077-8906099 CTAGGCTTCTTGAGGGAGGGAGG + Intergenic
986644800 5:9906444-9906466 CAACAGTTATTTAGGGAAGGGGG + Intergenic
986644800 5:9906444-9906466 CAACAGTTATTTAGGGAAGGGGG + Intergenic
987881378 5:23750214-23750236 CTACAGATCTCTAGGGTAGGGGG + Intergenic
987881378 5:23750214-23750236 CTACAGATCTCTAGGGTAGGGGG + Intergenic
988046203 5:25957964-25957986 CTATCTTTCTTTAGGGAATGAGG + Intergenic
988046203 5:25957964-25957986 CTATCTTTCTTTAGGGAATGAGG + Intergenic
988731375 5:33976355-33976377 ATAAACTTCTTGAGGGAAGGGGG - Intronic
988731375 5:33976355-33976377 ATAAACTTCTTGAGGGAAGGGGG - Intronic
990475522 5:56158528-56158550 ACAAAGTTCTTGAGGGAAGGTGG - Intronic
990475522 5:56158528-56158550 ACAAAGTTCTTGAGGGAAGGTGG - Intronic
991416252 5:66396043-66396065 TCACTGTTCTTTAGGGAAGGGGG - Intergenic
991416252 5:66396043-66396065 TCACTGTTCTTTAGGGAAGGGGG - Intergenic
993335059 5:86646677-86646699 CTAGAGTTTATTTGGGAAGTGGG + Intergenic
993335059 5:86646677-86646699 CTAGAGTTTATTTGGGAAGTGGG + Intergenic
993509815 5:88757580-88757602 CTGTAGTTAATTAGGGAAGGGGG - Intronic
993509815 5:88757580-88757602 CTGTAGTTAATTAGGGAAGGGGG - Intronic
994407341 5:99361217-99361239 CTATAATTTCTTAGGGAAGGAGG + Intergenic
994407341 5:99361217-99361239 CTATAATTTCTTAGGGAAGGAGG + Intergenic
995849824 5:116533443-116533465 CTAGAATACTTGGGGGAAGGGGG + Intronic
995849824 5:116533443-116533465 CTAGAATACTTGGGGGAAGGGGG + Intronic
998596774 5:143538628-143538650 CTAGAGTTCTATGAGTAAGGAGG - Intergenic
998596774 5:143538628-143538650 CTAGAGTTCTATGAGTAAGGAGG - Intergenic
1000366440 5:160495583-160495605 CTTTAGATCTTTAGGGAAGTAGG + Intergenic
1000366440 5:160495583-160495605 CTTTAGATCTTTAGGGAAGTAGG + Intergenic
1001036775 5:168302457-168302479 CTAGAGCTCTTTTAGGAAGGTGG + Intronic
1001036775 5:168302457-168302479 CTAGAGCTCTTTTAGGAAGGTGG + Intronic
1003272225 6:4617346-4617368 CTACAGTTCTTGAGAGAAGGAGG - Intergenic
1003272225 6:4617346-4617368 CTACAGTTCTTGAGAGAAGGAGG - Intergenic
1003583349 6:7362678-7362700 CCAGAGTTCCTTAGAGAATGAGG + Intronic
1003583349 6:7362678-7362700 CCAGAGTTCCTTAGAGAATGAGG + Intronic
1005112558 6:22299387-22299409 CTAGCGTTCTTTAGAAAAGATGG - Intergenic
1005112558 6:22299387-22299409 CTAGCGTTCTTTAGAAAAGATGG - Intergenic
1008384307 6:50870897-50870919 CTTGAATTCTTTAGGGAAAAGGG - Intergenic
1008384307 6:50870897-50870919 CTTGAATTCTTTAGGGAAAAGGG - Intergenic
1011878067 6:91987074-91987096 CTTGAGTTCTTTAGCTTAGGTGG + Intergenic
1011878067 6:91987074-91987096 CTTGAGTTCTTTAGCTTAGGTGG + Intergenic
1013007718 6:106089440-106089462 ATACTGTTCCTTAGGGAAGGGGG - Intronic
1013007718 6:106089440-106089462 ATACTGTTCCTTAGGGAAGGGGG - Intronic
1015251946 6:131135901-131135923 CCTGAGTCCTTTTGGGAAGGAGG - Intronic
1015251946 6:131135901-131135923 CCTGAGTCCTTTTGGGAAGGAGG - Intronic
1015527216 6:134185174-134185196 CTAAAGTTCTTGAGGAAAGTTGG - Intronic
1015527216 6:134185174-134185196 CTAAAGTTCTTGAGGAAAGTTGG - Intronic
1020286173 7:6682756-6682778 CTAACTTTCTTTGGGGAAGGTGG + Intergenic
1020286173 7:6682756-6682778 CTAACTTTCTTTGGGGAAGGTGG + Intergenic
1022505549 7:30907024-30907046 CGAGAGTTCTCTTGTGAAGGAGG + Intergenic
1022505549 7:30907024-30907046 CGAGAGTTCTCTTGTGAAGGAGG + Intergenic
1024466463 7:49716645-49716667 CTAGAGGGCTTTAGGGTAGCAGG + Intergenic
1024466463 7:49716645-49716667 CTAGAGGGCTTTAGGGTAGCAGG + Intergenic
1026732199 7:72921737-72921759 CTACAGTTGTTTATGGTAGGAGG + Intronic
1026732199 7:72921737-72921759 CTACAGTTGTTTATGGTAGGAGG + Intronic
1029446156 7:100613727-100613749 CTTGAGTTCTGTAGGGAGGGAGG + Intronic
1029446156 7:100613727-100613749 CTTGAGTTCTGTAGGGAGGGAGG + Intronic
1030872493 7:114774516-114774538 TGAGAGTTCTTTCAGGAAGGAGG - Intergenic
1030872493 7:114774516-114774538 TGAGAGTTCTTTCAGGAAGGAGG - Intergenic
1032005531 7:128299337-128299359 CTGGAGTGATTTAGGGCAGGGGG + Exonic
1032005531 7:128299337-128299359 CTGGAGTGATTTAGGGCAGGGGG + Exonic
1032098696 7:128954724-128954746 TTAGAGTTGTTTAGACAAGGAGG - Exonic
1032098696 7:128954724-128954746 TTAGAGTTGTTTAGACAAGGAGG - Exonic
1034963221 7:155374929-155374951 GTAGGGTCCTTTAGGGAAGGAGG + Intergenic
1034963221 7:155374929-155374951 GTAGGGTCCTTTAGGGAAGGAGG + Intergenic
1037073598 8:14684308-14684330 ATCAAGTTCTTTAGGGAAAGTGG + Intronic
1037073598 8:14684308-14684330 ATCAAGTTCTTTAGGGAAAGTGG + Intronic
1042298933 8:67254434-67254456 CTTAAGTTCTTTATGGAAGGTGG - Intronic
1042298933 8:67254434-67254456 CTTAAGTTCTTTATGGAAGGTGG - Intronic
1043912649 8:85880954-85880976 CTAAAGCTCTGTAGGGAAGATGG + Intergenic
1043912649 8:85880954-85880976 CTAAAGCTCTGTAGGGAAGATGG + Intergenic
1047762657 8:127965657-127965679 GTAGAGTTATTTAGAGAAGGCGG + Intergenic
1047762657 8:127965657-127965679 GTAGAGTTATTTAGAGAAGGCGG + Intergenic
1048806350 8:138245111-138245133 CTAGACTTCTTCAGGGTTGGGGG - Intronic
1048806350 8:138245111-138245133 CTAGACTTCTTCAGGGTTGGGGG - Intronic
1050705325 9:8390315-8390337 CTAGAGTTTTAAAGGCAAGGAGG - Intronic
1050705325 9:8390315-8390337 CTAGAGTTTTAAAGGCAAGGAGG - Intronic
1053703919 9:40730457-40730479 CCACAGCTCTTTAGGGCAGGGGG + Intergenic
1053703919 9:40730457-40730479 CCACAGCTCTTTAGGGCAGGGGG + Intergenic
1054414002 9:64854066-64854088 CCACAGCTCTTTAGGGCAGGGGG + Intergenic
1054414002 9:64854066-64854088 CCACAGCTCTTTAGGGCAGGGGG + Intergenic
1054874263 9:70078903-70078925 GTAGAATTCCTAAGGGAAGGAGG - Intronic
1054874263 9:70078903-70078925 GTAGAATTCCTAAGGGAAGGAGG - Intronic
1057078692 9:92155674-92155696 CCAGAGTTAATTAGGGGAGGAGG - Intergenic
1057078692 9:92155674-92155696 CCAGAGTTAATTAGGGGAGGAGG - Intergenic
1057627612 9:96691779-96691801 TGGGAGTTTTTTAGGGAAGGAGG + Intergenic
1057627612 9:96691779-96691801 TGGGAGTTTTTTAGGGAAGGAGG + Intergenic
1062086885 9:134653686-134653708 CCAGGGTTCTATAGGGATGGTGG + Intronic
1062086885 9:134653686-134653708 CCAGGGTTCTATAGGGATGGTGG + Intronic
1187967788 X:24630182-24630204 CTCAAGTTCTTTGGGGAAGGAGG - Intronic
1187967788 X:24630182-24630204 CTCAAGTTCTTTGGGGAAGGAGG - Intronic
1188456578 X:30373185-30373207 CTACAGTTCTATAGAGAAGAGGG + Intergenic
1188456578 X:30373185-30373207 CTACAGTTCTATAGAGAAGAGGG + Intergenic
1191840955 X:65513356-65513378 CAAGATTGCTTTAGGGAGGGTGG + Intronic
1191840955 X:65513356-65513378 CAAGATTGCTTTAGGGAGGGTGG + Intronic
1194344982 X:92751677-92751699 CCAGAGGTCTTTGGGGAAAGTGG + Intergenic
1194344982 X:92751677-92751699 CCAGAGGTCTTTGGGGAAAGTGG + Intergenic
1195964606 X:110418659-110418681 CCAGAGTTTGTTAGGGAAGATGG + Intronic
1195964606 X:110418659-110418681 CCAGAGTTTGTTAGGGAAGATGG + Intronic
1197940334 X:131782221-131782243 CTAGAATTCTTTAGGCTAAGTGG - Intergenic
1197940334 X:131782221-131782243 CTAGAATTCTTTAGGCTAAGTGG - Intergenic
1200653322 Y:5868319-5868341 CCAGAGGTCTTTGGGGAAAGTGG + Intergenic
1200653322 Y:5868319-5868341 CCAGAGGTCTTTGGGGAAAGTGG + Intergenic