ID: 981770348

View in Genome Browser
Species Human (GRCh38)
Location 4:148300982-148301004
Sequence TGGGGCTCCATGAGGAAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 283
Summary {0: 1, 1: 7, 2: 26, 3: 50, 4: 199}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981770348_981770352 -5 Left 981770348 4:148300982-148301004 CCTGTTTTCCTCATGGAGCCCCA 0: 1
1: 7
2: 26
3: 50
4: 199
Right 981770352 4:148301000-148301022 CCCCAGAAATTACAGGCAGATGG 0: 1
1: 0
2: 5
3: 29
4: 226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981770348 Original CRISPR TGGGGCTCCATGAGGAAAAC AGG (reversed) Intronic
900792680 1:4690430-4690452 TGTGGCTCCATGACGAAGAGAGG - Intronic
900956224 1:5887891-5887913 TGGGACTCCAGGAGGAAGACAGG + Intronic
901204862 1:7488387-7488409 TGGGGCTCCAGGAGCGAAGCTGG - Intronic
902368594 1:15992263-15992285 TGGGCCTCTATGAGGAAACAAGG + Intergenic
903858481 1:26351222-26351244 AGGGGTTGCATGAGGAAAAAGGG - Intronic
905445628 1:38026993-38027015 TGTGGCCCCAGGAGGAAGACTGG + Intergenic
906411121 1:45580342-45580364 TGGGGTTACATGAGGAAAACAGG + Intergenic
906490527 1:46264852-46264874 TGGGTCTCAATGAGGAGCACAGG - Intronic
907322857 1:53616660-53616682 TGGGTCTCCATGAGAAGGACTGG + Intronic
908598085 1:65709913-65709935 TGGGGCTCCATGATGTAAATGGG + Intergenic
911022000 1:93398646-93398668 TGGTGCTTCATGAAGAAGACAGG + Intergenic
911525687 1:98982803-98982825 TGGGGCTCCATGAGGAAGACAGG - Intronic
912093976 1:106116406-106116428 TGATGTTCCATGAGGAAAAGAGG - Intergenic
915285351 1:154848717-154848739 TAGGGCTTCATGAGGCAAAAGGG - Intronic
915363655 1:155301287-155301309 TGGGGCTCCAGGAGGTAAGAAGG - Exonic
916036173 1:160924362-160924384 TGGGGTTTCATGAGGAAAAAAGG + Intergenic
918307625 1:183261389-183261411 TGGGGCTCCATGTGGAAGAATGG - Intronic
919149407 1:193676441-193676463 TGAGGCTCAGTGAGGATAACTGG - Intergenic
922326281 1:224531304-224531326 TGGAACTCTATGGGGAAAACAGG + Intronic
922759621 1:228119241-228119263 TGGAGCTCCTTGGGAAAAACAGG - Intergenic
924483303 1:244455754-244455776 TGGGACTCCTTGGGAAAAACAGG + Intronic
1063666084 10:8061551-8061573 AGGGCCTCCATTAGGAAAACTGG + Intronic
1064175151 10:13068112-13068134 CGGGGTTCCATGAGAAAAACAGG - Intronic
1064453280 10:15463282-15463304 TGGGGGTCCAAGAAGAAAAAAGG - Intergenic
1064771557 10:18728901-18728923 CAGGGCTCCATGAGGATGACAGG + Intergenic
1064997958 10:21313066-21313088 TGAGGCTCCAGGTGGAAGACTGG - Intergenic
1066660235 10:37731332-37731354 TGGGGTTCCATGAGGAAAATAGG - Intergenic
1067278887 10:44856622-44856644 AGGAGCTGCCTGAGGAAAACAGG + Intergenic
1068907501 10:62343551-62343573 TAGGGTTTCATGAGGAAAACAGG + Intergenic
1070128020 10:73637540-73637562 AGTGGCTCTATGATGAAAACTGG + Intronic
1071297516 10:84232897-84232919 TGGTGCACTAGGAGGAAAACAGG + Exonic
1072442819 10:95471867-95471889 TGGAGCTTTATGAGGATAACAGG - Intronic
1072517620 10:96201284-96201306 TGGAACTACATGAGGAAAATTGG - Intronic
1073030388 10:100520843-100520865 TTGGGCTCCATCATGATAACTGG - Intronic
1074194914 10:111175158-111175180 TGGGGCTCTATAAGGACAAAGGG + Intergenic
1076020258 10:127066566-127066588 TGGGTCTCCACGAGGGAAAAAGG - Intronic
1077720551 11:4624329-4624351 TGTGGTTTCACGAGGAAAACAGG + Intergenic
1078143092 11:8705704-8705726 TGGGGCTCCAGCCAGAAAACTGG + Intronic
1079718424 11:23779468-23779490 GGGGGTTCCATGATGAAATCAGG + Intergenic
1080810666 11:35701233-35701255 TGGGGTTCCATGAGGAAAACAGG + Intronic
1080810677 11:35701295-35701317 TGGGACTCCTTGGGAAAAACAGG - Intronic
1080945723 11:36971939-36971961 TGGAGCTCCAAGAGGAAGAAAGG + Intergenic
1083001541 11:59296851-59296873 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1083055477 11:59815111-59815133 TGGGGTCCCATAAGAAAAACAGG + Intergenic
1084878124 11:72149122-72149144 TGGGACTCCTTGGGGAAAACAGG + Intergenic
1084878132 11:72149176-72149198 TGGGGTTCCAAGAGGAAAACAGG - Intergenic
1084915160 11:72423288-72423310 TGTGGATCCCTGAGGAACACTGG - Intronic
1089364895 11:117915543-117915565 TGGGGCTCCATGAGCACTCCAGG - Intronic
1089401269 11:118166074-118166096 TGGGGCTCCATGGTGAATGCAGG - Exonic
1089752730 11:120662783-120662805 TGGGGCTGCATGAAGAGACCAGG + Intronic
1089940725 11:122413792-122413814 TGGGGCTCCATGAGGAAGACAGG - Intergenic
1091151335 11:133331062-133331084 TGAGGATCCAGGAGTAAAACTGG + Intronic
1092839575 12:12526930-12526952 TGGGGCTCCAGGAGGAAGCGGGG + Intronic
1094239899 12:28210568-28210590 TGGGACTCCTTGGGAAAAACAGG - Intronic
1098878540 12:75892262-75892284 GGGGGATCCTTGAGAAAAACTGG + Intergenic
1099695720 12:86016101-86016123 TGGGGCACCATTACCAAAACGGG - Intronic
1100816667 12:98393467-98393489 TGGGGCTGCATGAGGTTAAGGGG - Intergenic
1100816960 12:98395999-98396021 TGGGGCTGCATGAGGTTAAGGGG - Intergenic
1100897940 12:99205565-99205587 TGGGGCTCCGTGAGGAAGACAGG - Intronic
1103789312 12:123458304-123458326 TGGGGCGCCATGTTGAAACCTGG + Intronic
1104970346 12:132528097-132528119 TGGGGCTCCAGAGGGAAAGCGGG - Intronic
1105887428 13:24653649-24653671 CCTGGCTCCATGAGGAAACCTGG + Intergenic
1107401526 13:40074202-40074224 AGGGACTCCAGGAGGAAGACTGG - Intergenic
1107765257 13:43727514-43727536 TGGCTTTCTATGAGGAAAACTGG + Intronic
1108359679 13:49657686-49657708 TGGGTCTTCATGAGGACCACTGG + Intergenic
1109013623 13:56980614-56980636 AAGGGTTTCATGAGGAAAACAGG - Intergenic
1109422633 13:62133192-62133214 TGGGGTTCCATAAGGAAAAGAGG - Intergenic
1109887572 13:68561814-68561836 TCTGGCATCATGAGGAAAACAGG - Intergenic
1110762004 13:79241216-79241238 AGAGGCTCCATGAGGATAAGGGG - Intergenic
1111586403 13:90289088-90289110 TGGGGCTACTTGAGGAAGAACGG + Intergenic
1113448644 13:110389694-110389716 TGCGGCTCCAAGAGGAAAGCTGG + Intronic
1113664059 13:112128566-112128588 TGAGGCTCCTGGAGAAAAACAGG - Intergenic
1114632163 14:24166012-24166034 TGGTGCTCCAGGAGGCAAAGGGG + Intronic
1121307388 14:92915613-92915635 TGGGGATGCATGAGGAGAAATGG + Intergenic
1122756160 14:103982067-103982089 TGGTGCTCCATGAAGAAAGGGGG - Intronic
1123769788 15:23517578-23517600 TAGGGTTCCATGAGAAAAACAGG + Intergenic
1124040094 15:26093912-26093934 TGGGGTTTCACGAGGAAAACAGG + Intergenic
1124601595 15:31137011-31137033 CAGGACTCCATGAGGAAGACAGG - Intronic
1126328884 15:47510726-47510748 TGGGGCTCCTTGTGGAGAAGTGG + Intronic
1126427325 15:48542676-48542698 TCGGGTTCCATGGGGAAAACTGG - Intronic
1126676417 15:51162509-51162531 CGTGGCTCCAGGAGGAAAAGGGG + Intergenic
1128080684 15:64855272-64855294 TGGGCCTGCAAGAGGAAAAGGGG - Intronic
1128581895 15:68816799-68816821 AGGGGCTCCATGATGAAGATGGG - Intronic
1129891568 15:79075181-79075203 TGGGGCTTCAGTAGGAAAAGAGG + Intronic
1130134110 15:81167577-81167599 TGAGACTCCAAGAGGCAAACAGG + Intronic
1130797744 15:87228610-87228632 TGGGGCTCCCCTAGGCAAACAGG + Intergenic
1202966443 15_KI270727v1_random:179797-179819 CGGCGCTGCATGCGGAAAACCGG - Intergenic
1132738641 16:1399672-1399694 TCGCGCTCCATGAGGGAAGCCGG + Intronic
1133025598 16:2987783-2987805 TGAGCCTCCATGAGGACAAAGGG + Intergenic
1133202412 16:4212366-4212388 TGCGCCTCCAAGAGGAGAACTGG - Intronic
1133997447 16:10759207-10759229 TGTGGCTCCCTGAGGAACACAGG + Intronic
1136351834 16:29715034-29715056 GGGGGTTTCATGAGGAAAACAGG - Intergenic
1136544436 16:30947687-30947709 TGGGGCCACAAAAGGAAAACCGG + Exonic
1137452715 16:48591794-48591816 TGGGGTTCCATGAGGAAAACAGG - Intronic
1138131371 16:54482751-54482773 TGGGTCTCCAGGAGGAAAGACGG - Intergenic
1138598684 16:58042635-58042657 TGGGGCTGCAGGAGGCAAAGAGG - Intronic
1139704785 16:68733800-68733822 AGGGGCTCCTTGTGGAAGACAGG - Intergenic
1140600700 16:76471649-76471671 TGGGGCTCCATGGAGAAGAGGGG - Intronic
1140747797 16:77996489-77996511 TGAGGCTCAAAGAGGAAAAGTGG - Intergenic
1142140438 16:88470376-88470398 TGGGGTTCCATGAGGTCACCTGG - Intronic
1143470798 17:7174005-7174027 TGGGCCTCCACGACCAAAACGGG - Exonic
1143976885 17:10836873-10836895 GGGGACTCCGTGAGGGAAACAGG - Intronic
1144087178 17:11821337-11821359 TGGTACTGCATTAGGAAAACTGG - Intronic
1145950621 17:28813907-28813929 TGGGGCTCATTTAAGAAAACTGG + Intronic
1146056259 17:29582799-29582821 TGGGGCTGCATGGGGCACACAGG + Exonic
1147400564 17:40178054-40178076 GGGGGCTCCCGGAGGAAAGCGGG - Intronic
1152807150 17:82361616-82361638 TGGGGGAACATGAGGGAAACTGG - Intronic
1158176010 18:54656746-54656768 TGGGTCAGCATGAGGAAAAGTGG - Intergenic
1158565249 18:58549654-58549676 TGGGGGCCCATGAGGAAGACAGG - Intronic
1161140000 19:2641565-2641587 TGGGGCTCCAGGGGAAAATCTGG - Intronic
1162161643 19:8722484-8722506 TTGGCATCCCTGAGGAAAACGGG + Intergenic
1162295502 19:9810846-9810868 TGGGGCTCAATGATGAAAACTGG + Exonic
1162523085 19:11193408-11193430 CGGTGCTCCAGGAGGAAAAGCGG - Exonic
1165356868 19:35309879-35309901 TGGGACTCCAGGAGGAGCACAGG - Exonic
1166402564 19:42494204-42494226 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1166900905 19:46062029-46062051 TAGGGTTTCATGAGGAAAACAGG + Intronic
1167662301 19:50802823-50802845 GGTGTCTCCATGAGCAAAACTGG - Intronic
1168027610 19:53654353-53654375 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1168027617 19:53654406-53654428 TGTGGTTCCATGAGGAAAACAGG - Intergenic
925471973 2:4172754-4172776 TGGGGTTTCATGAGGAAAACGGG + Intergenic
926247041 2:11129573-11129595 TGGGGCTACAAGAGGAAGGCCGG + Intergenic
927627798 2:24741950-24741972 TGGAGCACCCTGAGGAAGACGGG - Exonic
928313104 2:30226489-30226511 AGGGACTCCAGGAGGAAAATGGG + Intergenic
928382300 2:30829165-30829187 TAGGGTTCCATGAAGAAAACAGG - Intergenic
928931717 2:36631903-36631925 TTGGGTTCCATGAGGTAAACAGG + Intronic
930234057 2:48872353-48872375 AGGGGCTACATGAGGACAGCAGG - Intergenic
931730176 2:65146353-65146375 TGGGGCTTAATGAGGCACACAGG + Intergenic
932549869 2:72757596-72757618 TGGGCCCACATGAGGAAAACTGG - Intronic
933060637 2:77733451-77733473 TGTGTCTTCATGATGAAAACAGG - Intergenic
934165749 2:89292804-89292826 GGGGGCAGCATGAGGAAACCAGG + Intergenic
934201528 2:89889652-89889674 GGGGGCAGCATGAGGAAACCAGG - Intergenic
935149158 2:100417836-100417858 TGGGCCTCCATCCAGAAAACAGG + Intergenic
935850244 2:107211324-107211346 TGGGGATCTGTGAGGAAAACAGG + Intergenic
937121431 2:119442228-119442250 GGGGGCACCATCAGGAAATCAGG - Intronic
937263035 2:120598454-120598476 AGGGGCTACAGGAGGAAAGCGGG + Intergenic
938547915 2:132352349-132352371 AGGGGTTCAATGTGGAAAACGGG - Intergenic
939032647 2:137094942-137094964 AGGGGCTCCAGGAGGACCACTGG - Exonic
939091295 2:137782709-137782731 TGGGGATCCAAGAGGAAAACAGG - Intergenic
939449025 2:142348792-142348814 TGGGGTTCAAATAGGAAAACAGG + Intergenic
940156896 2:150666320-150666342 ATGGGAACCATGAGGAAAACAGG + Intergenic
940829450 2:158452246-158452268 TGGGGCTTCCTGTGGAGAACAGG + Intronic
941639588 2:167972750-167972772 TGGGACTCCTTGGGAAAAACAGG + Intronic
941853885 2:170211098-170211120 TGGGGTTCCATGAGAAAAACAGG + Intronic
941877765 2:170452279-170452301 TGGGGTTCCATGAGGAAAACAGG + Intronic
941896915 2:170638528-170638550 TGAGGCTCCAAGAGGTTAACTGG + Intronic
942017463 2:171831266-171831288 TGGGGTTCCATGAGGAAAACAGG - Intronic
942500199 2:176580991-176581013 TGGGCCTCAATGAGGGAAAAGGG - Intergenic
942620312 2:177838133-177838155 TGAGGTTCCATGAGGAAAACAGG - Intronic
943179738 2:184527383-184527405 TGGGGTCCAATGAGGAAAACAGG + Intergenic
943231338 2:185256399-185256421 TGGGGCTCTTTAAGGAAGACAGG - Intergenic
944519970 2:200555861-200555883 TGGGGTTTCATGAGGTAAATAGG + Intronic
945049302 2:205807910-205807932 TGGTGAACCATGAGGAAAACAGG + Intergenic
945068932 2:205971759-205971781 TGGGGTTCCATGAGGAATACAGG - Intergenic
945307949 2:208277136-208277158 TGGACATCCATGAGGAAAAATGG - Intronic
1168991773 20:2102124-2102146 AGGGGCTCCAGGGGGGAAACGGG + Exonic
1169264365 20:4158653-4158675 CGGGGCTGCATGGGGAAGACAGG - Intronic
1174093599 20:48069531-48069553 TTGGGGTCCAAGAGCAAAACTGG + Intergenic
1176157485 20:63628944-63628966 TGGGGCTCCAAGAGACAAACTGG + Intergenic
1176877756 21:14150087-14150109 TGGAGCTCCAAGTGGAAATCTGG - Intronic
1179194812 21:39155206-39155228 CGGGGATTTATGAGGAAAACAGG - Intergenic
1180941164 22:19660058-19660080 TCGGGCCCCATGTGGAAATCCGG + Intergenic
1183507043 22:38215017-38215039 GGGGGCTGCAAGAGGAAGACAGG - Exonic
949990323 3:9573607-9573629 TGGGGCTCCGTGAGGAAGACAGG - Intergenic
953176649 3:40559532-40559554 TGGGATTCCATGAGGAAGACAGG + Intronic
954296546 3:49677476-49677498 TGGGGCTACCTGAGGCAAAAGGG + Intronic
954479771 3:50788163-50788185 TGTGGCACCATGATGAAAGCTGG + Intronic
954673331 3:52302428-52302450 TGGGGCAGCAGGAGGAAAAATGG - Intergenic
955909423 3:63845055-63845077 TGAGACTCCTTGAGGAACACAGG + Exonic
956839508 3:73124646-73124668 TGGGACCCCCTAAGGAAAACTGG - Intergenic
958536348 3:95409206-95409228 TGGGGTTCCATGAGTAAAACAGG - Intergenic
958592168 3:96171721-96171743 TGGGGTTCCAGGAGGAAAACAGG - Intergenic
959789857 3:110346620-110346642 TGGGGCTTAAAGAGGAAAACAGG - Intergenic
961510723 3:127401622-127401644 TAAGGTTTCATGAGGAAAACAGG + Intergenic
961595805 3:128015332-128015354 TGGGACTCCTTGGGAAAAACAGG + Intergenic
963174484 3:142283560-142283582 TGGGGTTACATGAGGAAAATAGG - Intergenic
964453540 3:156836281-156836303 GTGGGTTTCATGAGGAAAACAGG + Intronic
965205621 3:165716891-165716913 TGGGGTTCCATGAGAAAAACAGG + Intergenic
965632458 3:170747188-170747210 GGGGGGTCAAAGAGGAAAACTGG - Intronic
969284071 4:6191461-6191483 TGGGTCCCCATGAGGACAAGGGG - Intronic
969393895 4:6908763-6908785 GTGGGTTCCATGAGGAAAGCCGG - Intergenic
971345172 4:25805209-25805231 TGGAGACCCATGAGAAAAACTGG - Intronic
974434150 4:61835196-61835218 CAGGGTTTCATGAGGAAAACAGG + Intronic
975756259 4:77574333-77574355 TGTGGTTCCATGAAGAAAACAGG - Intronic
976023158 4:80655785-80655807 TGGGGCCCCAGGAGGAAAACTGG + Intronic
976796691 4:88941693-88941715 CAGGGCTCCAGGAGGAAGACAGG - Intronic
977354507 4:95927849-95927871 TGGGGTTCCATAAGAAAAACAGG - Intergenic
980130911 4:128814931-128814953 TGGGGCTAAATGGGGAAATCTGG - Intronic
981233595 4:142388538-142388560 TAGGGTTCCATGAGGAAAACAGG - Intronic
981730013 4:147887274-147887296 TTGGCCTCCATCAGGAACACAGG - Intronic
981770348 4:148300982-148301004 TGGGGCTCCATGAGGAAAACAGG - Intronic
982103126 4:151988209-151988231 TGGGGCTCCTAGAGGTGAACTGG + Intergenic
982606807 4:157526101-157526123 TGTTGTTCCATGAGGAAAACAGG + Intergenic
983915315 4:173285853-173285875 AGGGGTTCCATGAGGAAAACAGG + Intronic
984687402 4:182685679-182685701 TAGGCCTCCATCAGTAAAACAGG + Intronic
985049227 4:185972789-185972811 TGGGGCTCCATCAGGAAGAGGGG + Intergenic
987147007 5:15001452-15001474 AGGGGCTACAGAAGGAAAACAGG - Intergenic
991525953 5:67557916-67557938 TGCTGTTCCAGGAGGAAAACAGG + Intergenic
993832851 5:92780722-92780744 TGGGGTTCCATGAAGAAGACAGG - Intergenic
994092963 5:95824756-95824778 TGAGGCACCATGTGGAAAATGGG + Intergenic
994755869 5:103792337-103792359 TGGGGCTCATTTAGGAAGACAGG - Intergenic
995452449 5:112316944-112316966 TAGGGCTCCAAGAGACAAACAGG + Intronic
999301528 5:150493734-150493756 TGGGGCAACATGAGGAAGGCAGG + Intronic
1000373637 5:160559973-160559995 AGGGCCTGCATGAGGAAAAGAGG + Intergenic
1000657352 5:163895977-163895999 TGGGGCCAGATGAGGAAAAGAGG - Intergenic
1000741177 5:164972301-164972323 TGGGGTTCCATGAGGAAAACAGG + Intergenic
1001110472 5:168891877-168891899 TCGGGCTGCATGTGGACAACAGG + Intronic
1005181485 6:23112388-23112410 TGGGGTTTCGTGAGGAAAACAGG + Intergenic
1007522214 6:42459621-42459643 TGTGGCTCCATTAGGGAATCTGG - Intergenic
1009716788 6:67408115-67408137 TGGGGTTTCATGAGGAAAAGAGG - Intergenic
1010719146 6:79262714-79262736 TGGGACTCCTTGGGCAAAACAGG - Intergenic
1010991732 6:82486736-82486758 TGGGGTTCCATAAGCAAAACAGG - Intergenic
1011286388 6:85728661-85728683 TGGGGTTCTATAAGGAAAAACGG + Intergenic
1012201057 6:96406491-96406513 TGGGGTTCCATGAAGAAAACAGG - Intergenic
1013142692 6:107354675-107354697 TGGGGCTCCCCAGGGAAAACTGG + Intronic
1014200650 6:118605598-118605620 TGGGGTTTCATGAGGAAAAGAGG + Intronic
1015377524 6:132527684-132527706 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1017792478 6:157813493-157813515 CAGGGCTCCATGAGGAAGACAGG + Intronic
1019029884 6:169000869-169000891 TGAGACCCCATGGGGAAAACAGG + Intergenic
1020762997 7:12290642-12290664 TAGACCTCCATGAAGAAAACTGG - Intergenic
1024281186 7:47721154-47721176 TGGGCCTCCGTGAGCAGAACTGG + Intronic
1024756949 7:52544860-52544882 AGGGGCTCCATGAGGAATTTTGG - Intergenic
1027763429 7:82308412-82308434 TGGGGCTCTATGAGGAAGATAGG - Intronic
1029811058 7:103049652-103049674 TGGGACTCCTTGGGAAAAACAGG - Intronic
1033563594 7:142557773-142557795 TAGGGAACCAGGAGGAAAACGGG - Intergenic
1033665666 7:143438206-143438228 TGGGGCCCCATGAGGAAATGAGG - Intergenic
1034220924 7:149445663-149445685 TGGGGCACCATATTGAAAACGGG - Intronic
1035824101 8:2626572-2626594 TGGGGATCCCTGAGAAAAAGAGG + Intergenic
1038130743 8:24728522-24728544 TTGGGCTCCAAGAGGAAGACAGG - Intergenic
1039043098 8:33426557-33426579 TGGGGACTCATGAGAAAAACTGG - Intronic
1040089695 8:43385123-43385145 TGGGATTTCATGAGGAAAACAGG + Intergenic
1041379534 8:57239382-57239404 TGGGGCTCTATGAAGTAATCAGG + Intergenic
1043232236 8:77817637-77817659 TGGGCCTCTTTGAGGAGAACTGG - Intergenic
1043593647 8:81859177-81859199 TGGTGCTCCCTGAGGAGAAGAGG - Intergenic
1046579019 8:116068557-116068579 TGGGACTCCTTGAGACAAACAGG + Intergenic
1047581565 8:126222099-126222121 TGGGATTCCATGAGGAAAACAGG + Intergenic
1048016447 8:130501585-130501607 TGGGGCTGCATTAGGAAAGGCGG + Intergenic
1051487814 9:17627231-17627253 TGGCGCTGCAGGATGAAAACAGG - Intronic
1051838161 9:21363817-21363839 TGGGGCTTCATGAGGAAGACAGG + Intergenic
1052751934 9:32500839-32500861 TGGAGCTCCAGGAGGAAGGCTGG - Exonic
1056142956 9:83701553-83701575 GGGGGCACTCTGAGGAAAACTGG - Intronic
1056726926 9:89127441-89127463 TGGGGCTCCTTGAGAAAAACAGG + Intronic
1056900826 9:90597595-90597617 TGGGTCTCCATCAGGAAGAGTGG + Intergenic
1057726123 9:97569457-97569479 TGGGGGTGAATGAAGAAAACTGG - Intronic
1057780672 9:98047458-98047480 TGGGACTCCTTGGGTAAAACAGG + Intergenic
1057913904 9:99041061-99041083 TGGGACTCCCTCAGGAACACAGG - Intronic
1058342708 9:103918438-103918460 TGGGTCTCCATGAAGACAGCAGG + Intergenic
1058355754 9:104081966-104081988 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1059065939 9:111083780-111083802 TGAGTCTTCATGAGGAAAGCTGG - Intergenic
1059668987 9:116475798-116475820 TTGGGCTCCATGAGGAGTATGGG - Intronic
1061410510 9:130418777-130418799 TGGGGCTCCACCTGGAACACCGG - Exonic
1061830611 9:133291394-133291416 TGGGGTTTCATGAGGAAAACAGG + Intergenic
1062608226 9:137358336-137358358 TGGGGCTCCGTGCTGAAACCAGG - Intronic
1185435153 X:38153-38175 TGGGTCTCATTGAGGAAAAATGG + Intergenic
1185498361 X:576875-576897 TGGGTGTCCATGAGTAACACAGG - Intergenic
1186482579 X:9907280-9907302 TGTGGCTCCCTGAGCAGAACTGG + Intronic
1189618238 X:42807744-42807766 TAAGTCTCCATGAGGAAGACAGG + Intergenic
1189630881 X:42952060-42952082 TGGGGTTCCATTTGGAAAACAGG + Intergenic
1189650056 X:43178921-43178943 TGGCACTCCATAAGGAAAACAGG - Intergenic
1190172430 X:48122131-48122153 TGGGGCTCCAGGAGCAACAGAGG + Intergenic
1190180071 X:48184647-48184669 TGGGGCTCCAGGAGCAACAGAGG - Intergenic
1190184042 X:48219424-48219446 TGGGGCTCCAGGAGCAACAGAGG + Intronic
1190189970 X:48268873-48268895 TGGGGCTCCAGGAGCAACAGAGG + Intronic
1190197197 X:48329566-48329588 TGGGGCTCCAGGAGAAACAGAGG + Intergenic
1190658724 X:52635378-52635400 TGGGGCTCCAGGAGCAACAGAGG + Intergenic
1190722904 X:53165278-53165300 TGGGGTTTCATGAGGAAAACAGG - Intergenic
1191617244 X:63182421-63182443 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1191619054 X:63196502-63196524 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1192682346 X:73264702-73264724 TTGAGTTTCATGAGGAAAACAGG + Intergenic
1192777154 X:74256962-74256984 TGGGGTTTCATGAGGAAAACAGG - Intergenic
1193269403 X:79511593-79511615 TGGGGTTCCATGAGAAAAACAGG - Intergenic
1193485698 X:82083557-82083579 TGGGGTTTCATTAGAAAAACAGG + Intergenic
1193791103 X:85815894-85815916 TGGGGTTTCATGAGGAAAATAGG - Intergenic
1194059539 X:89180475-89180497 TGTGGTTCCCTAAGGAAAACAGG + Intergenic
1194131474 X:90087737-90087759 TGGGACTCCATGGGAAAAACAGG - Intergenic
1194170018 X:90569747-90569769 TGGAGCTTCATGAGGAAAAAAGG + Intergenic
1194227453 X:91279020-91279042 TTGGGTTCCATGAGAAAAACAGG + Intergenic
1194508112 X:94758552-94758574 TGGGGCTCCACAAGGAAAAGAGG + Intergenic
1197396855 X:125938217-125938239 TGGGATTCCATGAGCAAAACAGG + Intergenic
1197650315 X:129056966-129056988 GGTGGCTCAATCAGGAAAACAGG - Intergenic
1198020684 X:132654835-132654857 TGTGGCTCCTTGAGGAAGAGTGG - Intronic
1198181978 X:134219230-134219252 TGGGACTCCTTGAGAAAAACAGG - Intergenic
1200070540 X:153526938-153526960 TGGGGCCCCATTAGGAATCCTGG - Intronic
1201364712 Y:13190955-13190977 TGGGTCCCCATTAGGAAAATGGG - Intergenic