ID: 981776855

View in Genome Browser
Species Human (GRCh38)
Location 4:148378403-148378425
Sequence TATCCAAACCAATTCAGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 179}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981776855_981776862 27 Left 981776855 4:148378403-148378425 CCTGCACTGAATTGGTTTGGATA 0: 1
1: 0
2: 0
3: 13
4: 179
Right 981776862 4:148378453-148378475 ATTGTAATCTCCAGTGTTGGAGG 0: 76
1: 890
2: 2281
3: 3245
4: 3719
981776855_981776863 30 Left 981776855 4:148378403-148378425 CCTGCACTGAATTGGTTTGGATA 0: 1
1: 0
2: 0
3: 13
4: 179
Right 981776863 4:148378456-148378478 GTAATCTCCAGTGTTGGAGGTGG 0: 102
1: 1021
2: 2785
3: 3796
4: 3841
981776855_981776861 24 Left 981776855 4:148378403-148378425 CCTGCACTGAATTGGTTTGGATA 0: 1
1: 0
2: 0
3: 13
4: 179
Right 981776861 4:148378450-148378472 TGAATTGTAATCTCCAGTGTTGG 0: 40
1: 563
2: 1751
3: 3275
4: 4204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981776855 Original CRISPR TATCCAAACCAATTCAGTGC AGG (reversed) Intronic
900356418 1:2267173-2267195 TTACAAAACCAGTTCAGTGCTGG - Intronic
901174526 1:7289249-7289271 GATCCAAACCATATCAGTGAGGG + Intronic
901373693 1:8822117-8822139 TCTCCGTTCCAATTCAGTGCAGG - Intergenic
903674980 1:25057865-25057887 TATCCAGACCAACTGGGTGCTGG - Intergenic
906913343 1:49980755-49980777 TATCCAAATCAATTGAAAGCGGG - Intronic
910665837 1:89725256-89725278 TCTCCAAACCAAATCATTGAGGG + Intronic
912595245 1:110869440-110869462 TATCCTAAGCAATTTAATGCAGG + Intergenic
912752792 1:112299388-112299410 TATCCCCAGCAATTCAGTGCTGG - Intergenic
912805643 1:112754964-112754986 TATCCAAACCAATTTTGGGTGGG - Intergenic
913507872 1:119534715-119534737 TAGCCAAACCAATTGACTCCAGG + Intergenic
913660715 1:121004326-121004348 TCTTCAAACGAATTCAGTGCAGG + Intergenic
914012078 1:143787482-143787504 TCTTCAAACGAATTCAGTGCAGG + Intergenic
914165753 1:145173652-145173674 TCTTCAAACGAATTCAGTGCAGG - Intergenic
914650709 1:149696145-149696167 TCTTCAAACGAATTCAGTGCAGG + Intergenic
914973884 1:152339651-152339673 TATCCAAAACAATTGAAAGCAGG + Intergenic
917730332 1:177868693-177868715 TATCCTAAGCAATTTAATGCAGG - Intergenic
921127865 1:212194190-212194212 TATCCAAACTATATCAGTGAGGG - Intergenic
922975902 1:229783098-229783120 AATCCAAACCAAGTCAAAGCTGG + Intergenic
1063928842 10:11008958-11008980 TATGCAAAGAAATTCAGTGAAGG - Intronic
1064503225 10:15997782-15997804 TATCCTAAGCAAATCAATGCAGG + Intergenic
1065174086 10:23060452-23060474 TATCCAAACCACATCACAGCTGG + Intergenic
1065407455 10:25385454-25385476 TATCCAAAATAATTCAAAGCAGG - Intronic
1066469342 10:35682949-35682971 TATCCTAAGCAAATCAGTGCAGG - Intergenic
1074878931 10:117636520-117636542 TATCCAAACCCTCTCAGTGGGGG - Intergenic
1075059428 10:119244979-119245001 TATCCAAAAGAATTCAAGGCTGG + Intronic
1075944602 10:126421498-126421520 TTTCCAAAGCCATTCAGTCCCGG + Intergenic
1078205046 11:9221473-9221495 GGTCCCAACCCATTCAGTGCTGG + Intronic
1079091265 11:17481928-17481950 TCTCCAAAGCAAATCACTGCAGG - Intergenic
1082663631 11:55946829-55946851 TATCCTAAGCAAATTAGTGCAGG - Intergenic
1082716230 11:56617527-56617549 TATCCAAAGCAAACCAATGCAGG - Intergenic
1083479953 11:62937518-62937540 TACCCAAACCATATCAGTGGTGG - Intronic
1086277714 11:85150863-85150885 TATCCAAAAGAATTCAAAGCAGG - Intronic
1091577169 12:1748695-1748717 TATCCAAAGCAATTCAATAATGG - Intronic
1095324499 12:40871971-40871993 TATCCAATCTCATTCAGTGGTGG - Intronic
1095431751 12:42142243-42142265 GATCCAAAGCAAATCAGTGTTGG - Intronic
1095569011 12:43660757-43660779 CATCCAGGCCAAATCAGTGCTGG + Intergenic
1098156686 12:67606855-67606877 TCGCCATACCAACTCAGTGCTGG + Intergenic
1099251186 12:80256955-80256977 TAGCAAAACCAATTTAGTTCTGG - Intronic
1103795097 12:123497874-123497896 TATCCAAAAGAATTGAGAGCAGG - Intronic
1110158286 13:72344319-72344341 TATCCCAATAAATTAAGTGCTGG + Intergenic
1113552131 13:111200780-111200802 TATCCAAAACGGTCCAGTGCAGG + Intronic
1114311068 14:21467721-21467743 TACCCAAAAGAATTCAGAGCTGG + Intronic
1114637960 14:24199174-24199196 TATCCAAACTATATCAGTGGGGG - Intronic
1116066418 14:39989243-39989265 TATCGAAATCTATTCATTGCTGG + Intergenic
1120649680 14:87117276-87117298 TATCTAAACAAATTCAGTATTGG - Intergenic
1121260060 14:92559459-92559481 TATCCAAACCCATCCAGCACTGG - Intronic
1125380692 15:39083578-39083600 TATCCAAAGTAATTCAAAGCTGG - Intergenic
1126920682 15:53519857-53519879 CATCCTAGTCAATTCAGTGCTGG + Intronic
1128939717 15:71778256-71778278 CATCCAAAACAACTGAGTGCTGG - Exonic
1132355526 15:101168625-101168647 GATCCAAACCAATGCTGTGCTGG + Intergenic
1134914765 16:18060380-18060402 TATCCAAACCAGTTAAGATCAGG + Intergenic
1135030587 16:19035150-19035172 TATCCAAAGCAAATTAATGCAGG + Intronic
1137070801 16:35903207-35903229 TAACCAAACCACTTCAGCCCTGG - Intergenic
1138880270 16:61005700-61005722 TATCCAATATAATTCTGTGCAGG + Intergenic
1139144155 16:64304418-64304440 TTTCCAGACCAAATGAGTGCAGG - Intergenic
1139279074 16:65754302-65754324 TAGCCAAACCATATCAGTGGGGG + Intergenic
1141930740 16:87200987-87201009 TATCCTAAGCAAATCAATGCGGG - Intronic
1144309597 17:14000404-14000426 TATCCAAACGATGTCAGTACGGG - Intergenic
1146825130 17:36015490-36015512 TATCCAAAATAATTCAAAGCAGG - Intronic
1147014652 17:37481770-37481792 TATCCAGACCAAGTCTGGGCTGG - Intergenic
1147277572 17:39331823-39331845 TATTCAAACCATTACAGTGCAGG - Intronic
1149480620 17:57000396-57000418 AACCTAAACCAATTCAGAGCTGG - Intronic
1150183503 17:63153915-63153937 AAACCAAACCAATTCACTGATGG + Intronic
1150456839 17:65313087-65313109 TCTCCAAAGCAGTTCAGAGCTGG - Intergenic
1153181162 18:2435265-2435287 TATCCAAATGAAGACAGTGCAGG - Intergenic
1153736799 18:8078987-8079009 CATCCAGACCATATCAGTGCTGG + Intronic
1159236557 18:65681553-65681575 TGTCCAAACCAATTCTCTGTAGG - Intergenic
1162272364 19:9626688-9626710 TATCCAAAACTGTTCAGAGCAGG - Intronic
1164597337 19:29538941-29538963 CATCCAAACCATCTCAGTGATGG + Intronic
1164940953 19:32251974-32251996 TATCCAAACCATGTCAGCGGGGG - Intergenic
1165368262 19:35383711-35383733 CATCCAGGCCAAGTCAGTGCTGG + Intergenic
1165969330 19:39613237-39613259 GATCCAAACCATATCAGTGGGGG - Intergenic
927224582 2:20750883-20750905 TATCCTAACCAAATTAATGCAGG + Intronic
929237610 2:39623415-39623437 TTTCTAAACCAATTCAGTACTGG - Intergenic
930598617 2:53417920-53417942 TATCCAAAGCAAATTAATGCAGG - Intergenic
933167548 2:79092965-79092987 TAACCAAACCACTTCAGCCCTGG - Intergenic
933264989 2:80172160-80172182 TAGCCAAATCATTTTAGTGCAGG - Intronic
933736015 2:85494972-85494994 TATCCTAACAATTTCAGTACTGG - Intergenic
935157820 2:100498867-100498889 TATCCTAAGCAATTTAATGCAGG - Intergenic
935900935 2:107792473-107792495 TATCCAAAATAATTCAAAGCAGG + Intergenic
935947176 2:108297012-108297034 TTTCCAAACCAATTCTCTGTGGG - Intronic
939891391 2:147741114-147741136 TATCCAAAAGAATTAAGAGCAGG - Intergenic
942024460 2:171898567-171898589 TTGCCAAAGCAATTCAGTGGGGG + Intronic
944776254 2:202968874-202968896 TATCCATACAAATTCATGGCAGG + Intronic
945595401 2:211784589-211784611 TATCCAAAGGAATTAAATGCAGG - Intronic
946296955 2:218792330-218792352 TATCTAAACAATTTCAGTACTGG + Intronic
1171318606 20:24219040-24219062 TATCTAAACAATTTCAGTGTTGG + Intergenic
1172496568 20:35389832-35389854 TATCCAAAAGAATTCAAAGCAGG + Intronic
1174122358 20:48275862-48275884 TTTCTAGCCCAATTCAGTGCTGG + Intergenic
1174862898 20:54108918-54108940 TATCCAAAAGAATTCAATTCAGG - Intergenic
1175660005 20:60804316-60804338 TATCCTAAGCAAACCAGTGCAGG - Intergenic
1177061022 21:16374286-16374308 TTTCCAAACCACTTCACTGGTGG + Intergenic
1177326995 21:19603291-19603313 TATCTAAACAATTTCAGTACTGG + Intergenic
1178598853 21:33978829-33978851 TATCCAAAACAATTAAAAGCAGG - Intergenic
1179559349 21:42203021-42203043 GATACAAAGCAAATCAGTGCAGG + Intronic
1180578024 22:16798732-16798754 TATCCTAAGCAAATCAATGCAGG + Intronic
1180798443 22:18619520-18619542 TATCCAGCCCCATCCAGTGCTGG - Intergenic
1180940280 22:19656420-19656442 CACCCAAACCAATGCAGTTCCGG + Intergenic
1181223275 22:21375745-21375767 TATCCAGCCCCATCCAGTGCTGG + Intergenic
1181255464 22:21559881-21559903 TATCCAGCCCCATCCAGTGCTGG - Intronic
950845384 3:16010802-16010824 TATCCTAAGCAATTAAATGCAGG + Intergenic
952184146 3:30950637-30950659 TATTCAAAACAATCCAGTGGTGG + Intergenic
952985347 3:38774760-38774782 CAGCCAAAGCAATTCAGTGTGGG + Intronic
953104641 3:39864919-39864941 TAACCAAAACAGTACAGTGCTGG + Intronic
953333056 3:42070723-42070745 TATTAAAGACAATTCAGTGCTGG - Intronic
953490796 3:43348400-43348422 TATCCGTTCCAATTCAGTGGTGG - Exonic
956261498 3:67348135-67348157 TATCCAAACCACATCAGACCAGG + Intergenic
958446836 3:94225953-94225975 TATCCAGACAAATTCAGTATTGG - Intergenic
958926814 3:100167116-100167138 TATCTAAACTATTTCATTGCTGG - Intronic
959011700 3:101085231-101085253 TAGCCAAACCATATCATTGCGGG - Intergenic
960576912 3:119239437-119239459 CATCCAAAGCAAATCAGTGATGG - Intronic
960834553 3:121892288-121892310 TAACCAAACCAATTCAGAAATGG + Intergenic
961344407 3:126253820-126253842 TATCCAAACAATTTTAGTACTGG - Intergenic
962944981 3:140159887-140159909 TATCCTAAACAAATTAGTGCAGG + Intronic
963394833 3:144718272-144718294 TATCCAAAATAACTCATTGCCGG - Intergenic
964431162 3:156607279-156607301 TATCCAAAAGAATTCAAAGCAGG - Intergenic
964937137 3:162103607-162103629 TATCCAAAGCAAATTAATGCAGG - Intergenic
969605667 4:8201167-8201189 TTCCCAAACCCATTCAGGGCTGG + Intronic
971095722 4:23399787-23399809 TTTCCAACCCCATGCAGTGCAGG - Intergenic
971678439 4:29666436-29666458 TTTCCAACCCAATTCAATTCTGG + Intergenic
971684776 4:29749758-29749780 CATCCAAGCCAAATCAGTGCTGG + Intergenic
976572331 4:86626860-86626882 TATCCAAAATAATTCAAAGCAGG + Intronic
976576319 4:86676516-86676538 TATCCAAAATAATTCACAGCAGG + Intronic
977490863 4:97708392-97708414 TATCCAAACCAATGAAGTAAAGG + Intronic
977838727 4:101675575-101675597 TATATAAACCATTTCAGTACTGG - Intronic
978087704 4:104674370-104674392 TATCCTAACCAAATTAATGCAGG - Intergenic
978170469 4:105664128-105664150 TATCCAAAATAATTGAGAGCAGG - Intronic
980240839 4:130172690-130172712 TTTCTAAAACAATTCAGTGTTGG + Intergenic
981776855 4:148378403-148378425 TATCCAAACCAATTCAGTGCAGG - Intronic
986672553 5:10155747-10155769 TATCCAAAAGAATTCAAAGCAGG + Intergenic
987695338 5:21321591-21321613 TTTCCAAACGAATTCACTGGAGG - Intergenic
991388274 5:66114239-66114261 TATCCAAAGGAATTCAAAGCGGG + Intergenic
991745071 5:69730513-69730535 TTTCCAAACGAATTCACTGGAGG + Intergenic
991752634 5:69824709-69824731 TTTCCAAACGAATTCACTGGAGG - Intergenic
991796640 5:70310242-70310264 TTTCCAAACGAATTCACTGGAGG + Intergenic
991802252 5:70381445-70381467 TTTCCAAACGAATTCACTGGAGG - Intergenic
991824450 5:70605827-70605849 TTTCCAAACGAATTCACTGGAGG + Intergenic
991831953 5:70699838-70699860 TTTCCAAACGAATTCACTGGAGG - Intergenic
991889019 5:71309799-71309821 TTTCCAAACGAATTCACTGGAGG + Intergenic
997640158 5:135443688-135443710 AATCCAAATCAAATCAGTCCAGG - Intergenic
998994902 5:147860906-147860928 TATCAAATCCAATTCAATCCTGG - Intergenic
1000539737 5:162525441-162525463 TATCCACACCACTTGGGTGCTGG - Intergenic
1001257720 5:170197371-170197393 GATCCAAACCAATTTAGCACAGG + Intergenic
1001766915 5:174256587-174256609 TATCCAAAAGAATTGGGTGCAGG + Intergenic
1004997210 6:21205288-21205310 TATCCAAAAGAATTGAGAGCAGG - Intronic
1006282468 6:33065687-33065709 TATCCAAACCATATCAATGACGG + Intronic
1008419223 6:51277416-51277438 TATCCAACAAAATTCAGTGGAGG - Intergenic
1010920998 6:81680516-81680538 TATCCAAAGCAAATTAATGCAGG + Intronic
1012201907 6:96416958-96416980 TATCCTAAGCAAATCAATGCAGG + Intergenic
1013283604 6:108661640-108661662 TATCCAAACCATCTCTGTACAGG - Intronic
1013848049 6:114478467-114478489 TATCCAAACCGTTTCAGTAGGGG + Intergenic
1014068809 6:117157767-117157789 TATCCACACCCATTCACGGCTGG - Intergenic
1014953293 6:127584902-127584924 TATCTAAACAATTTCAGTTCTGG + Intronic
1015350654 6:132214501-132214523 AAGCTAAATCAATTCAGTGCTGG - Intergenic
1017261432 6:152392076-152392098 CATCCACACCAATTCAGGGTGGG + Intronic
1017656896 6:156638352-156638374 TATCCAAAACAATTGAAAGCAGG + Intergenic
1020716970 7:11686707-11686729 AATCCTAAGCAAATCAGTGCAGG + Intronic
1022194685 7:28053307-28053329 TATCCAAAATAATTCAAAGCAGG - Intronic
1022540237 7:31128406-31128428 CCTCCAACCCAACTCAGTGCCGG - Intergenic
1028259177 7:88640057-88640079 CATCCAGTCCAAATCAGTGCTGG + Intergenic
1028984138 7:96996822-96996844 GATCCGAAACAAATCAGTGCGGG - Intergenic
1030708613 7:112722352-112722374 GATCCAAAGGCATTCAGTGCAGG - Intergenic
1033526705 7:142222541-142222563 TATAGAAACCATTTGAGTGCTGG - Intergenic
1034145977 7:148871969-148871991 TATCCAAAAGAATTCAAAGCAGG + Intronic
1035128902 7:156633176-156633198 TATCAAAACAATTTCAGTACTGG - Intergenic
1037480489 8:19300815-19300837 TATCCAAACGATATCAGTGATGG + Intergenic
1040538186 8:48328110-48328132 TATCCAAAGCAAATTAGTGGAGG + Intergenic
1040781640 8:51116590-51116612 TATCCACACCACTTCAGGTCAGG + Intergenic
1042045749 8:64649546-64649568 TATCCAAAGGAATTCAAAGCAGG - Intronic
1042685583 8:71435799-71435821 TATTCAAACCACTTCAGTGTTGG + Intronic
1045604615 8:103758378-103758400 TATACAAACCAAGTCTGTGGAGG + Intronic
1045610086 8:103829582-103829604 TATCCTAACCAATTTGATGCAGG + Intronic
1046113509 8:109755798-109755820 TATCCTAAGCAAATCAATGCAGG - Intergenic
1046796131 8:118374467-118374489 TATCCAAAAGAATTCAAAGCAGG - Intronic
1047360889 8:124168321-124168343 TTTCCAAAGCATTTCAGTCCAGG + Intergenic
1051737203 9:20212897-20212919 TATCCTCAGCAATTCAATGCAGG + Intergenic
1057886490 9:98833734-98833756 TTTCCAAACCTATTCAGTGAGGG - Intronic
1059050962 9:110925108-110925130 TATACAAACCAATTCAGCGTGGG - Intronic
1059329354 9:113525159-113525181 TATCCAAAAAAATCCAGGGCAGG - Intronic
1060621656 9:125073022-125073044 TATCCAAAAGAATTGAGAGCAGG - Intronic
1186523430 X:10225950-10225972 TATCCAAAACAGTACAGTACTGG - Intronic
1187996155 X:24929127-24929149 TAGCCAACCCAATTTGGTGCAGG - Intronic
1188194904 X:27221560-27221582 TATCCAAAGCAAATTAATGCAGG - Intergenic
1190051589 X:47154327-47154349 TATCCAAACCAAATAAATTCAGG - Intronic
1192405144 X:70877533-70877555 TATCCAAAAGAATTAAATGCAGG + Intronic
1193820666 X:86160553-86160575 CATCCAGGCCAAATCAGTGCTGG - Intronic
1193836956 X:86355171-86355193 TATCCTAAGCAAATCAATGCAGG - Intronic
1193958814 X:87898214-87898236 TATCCAAACAATTTCGGTCCTGG + Intergenic
1194569338 X:95534020-95534042 TATCTAAACAATTTCAGTACTGG + Intergenic
1198427158 X:136531709-136531731 TACGCAAAGCAATTCAGGGCAGG - Intergenic
1198494294 X:137175516-137175538 TACCCAAAGCAATTCAAAGCAGG + Intergenic
1199592290 X:149478266-149478288 TACCCAAAACAATTAAGAGCAGG + Intergenic
1200294796 X:154908986-154909008 CATCCAGCCCAAATCAGTGCTGG - Intronic