ID: 981782849

View in Genome Browser
Species Human (GRCh38)
Location 4:148445453-148445475
Sequence CGCCGTCAGAGCGAGGGGAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981782849_981782859 8 Left 981782849 4:148445453-148445475 CCGGTCCCCTCGCTCTGACGGCG No data
Right 981782859 4:148445484-148445506 GCCCGCGGAGGCGGCTCGGCGGG No data
981782849_981782865 24 Left 981782849 4:148445453-148445475 CCGGTCCCCTCGCTCTGACGGCG No data
Right 981782865 4:148445500-148445522 CGGCGGGGCAAGCCGAGGAAGGG No data
981782849_981782863 19 Left 981782849 4:148445453-148445475 CCGGTCCCCTCGCTCTGACGGCG No data
Right 981782863 4:148445495-148445517 CGGCTCGGCGGGGCAAGCCGAGG No data
981782849_981782866 25 Left 981782849 4:148445453-148445475 CCGGTCCCCTCGCTCTGACGGCG No data
Right 981782866 4:148445501-148445523 GGCGGGGCAAGCCGAGGAAGGGG No data
981782849_981782864 23 Left 981782849 4:148445453-148445475 CCGGTCCCCTCGCTCTGACGGCG No data
Right 981782864 4:148445499-148445521 TCGGCGGGGCAAGCCGAGGAAGG No data
981782849_981782861 9 Left 981782849 4:148445453-148445475 CCGGTCCCCTCGCTCTGACGGCG No data
Right 981782861 4:148445485-148445507 CCCGCGGAGGCGGCTCGGCGGGG No data
981782849_981782856 -1 Left 981782849 4:148445453-148445475 CCGGTCCCCTCGCTCTGACGGCG No data
Right 981782856 4:148445475-148445497 GGCTCAGACGCCCGCGGAGGCGG No data
981782849_981782857 4 Left 981782849 4:148445453-148445475 CCGGTCCCCTCGCTCTGACGGCG No data
Right 981782857 4:148445480-148445502 AGACGCCCGCGGAGGCGGCTCGG No data
981782849_981782854 -7 Left 981782849 4:148445453-148445475 CCGGTCCCCTCGCTCTGACGGCG No data
Right 981782854 4:148445469-148445491 GACGGCGGCTCAGACGCCCGCGG No data
981782849_981782855 -4 Left 981782849 4:148445453-148445475 CCGGTCCCCTCGCTCTGACGGCG No data
Right 981782855 4:148445472-148445494 GGCGGCTCAGACGCCCGCGGAGG No data
981782849_981782858 7 Left 981782849 4:148445453-148445475 CCGGTCCCCTCGCTCTGACGGCG No data
Right 981782858 4:148445483-148445505 CGCCCGCGGAGGCGGCTCGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981782849 Original CRISPR CGCCGTCAGAGCGAGGGGAC CGG (reversed) Intergenic