ID: 981782851

View in Genome Browser
Species Human (GRCh38)
Location 4:148445458-148445480
Sequence TGAGCCGCCGTCAGAGCGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981782851_981782866 20 Left 981782851 4:148445458-148445480 CCCCTCGCTCTGACGGCGGCTCA No data
Right 981782866 4:148445501-148445523 GGCGGGGCAAGCCGAGGAAGGGG No data
981782851_981782863 14 Left 981782851 4:148445458-148445480 CCCCTCGCTCTGACGGCGGCTCA No data
Right 981782863 4:148445495-148445517 CGGCTCGGCGGGGCAAGCCGAGG No data
981782851_981782859 3 Left 981782851 4:148445458-148445480 CCCCTCGCTCTGACGGCGGCTCA No data
Right 981782859 4:148445484-148445506 GCCCGCGGAGGCGGCTCGGCGGG No data
981782851_981782856 -6 Left 981782851 4:148445458-148445480 CCCCTCGCTCTGACGGCGGCTCA No data
Right 981782856 4:148445475-148445497 GGCTCAGACGCCCGCGGAGGCGG No data
981782851_981782855 -9 Left 981782851 4:148445458-148445480 CCCCTCGCTCTGACGGCGGCTCA No data
Right 981782855 4:148445472-148445494 GGCGGCTCAGACGCCCGCGGAGG No data
981782851_981782865 19 Left 981782851 4:148445458-148445480 CCCCTCGCTCTGACGGCGGCTCA No data
Right 981782865 4:148445500-148445522 CGGCGGGGCAAGCCGAGGAAGGG No data
981782851_981782857 -1 Left 981782851 4:148445458-148445480 CCCCTCGCTCTGACGGCGGCTCA No data
Right 981782857 4:148445480-148445502 AGACGCCCGCGGAGGCGGCTCGG No data
981782851_981782864 18 Left 981782851 4:148445458-148445480 CCCCTCGCTCTGACGGCGGCTCA No data
Right 981782864 4:148445499-148445521 TCGGCGGGGCAAGCCGAGGAAGG No data
981782851_981782861 4 Left 981782851 4:148445458-148445480 CCCCTCGCTCTGACGGCGGCTCA No data
Right 981782861 4:148445485-148445507 CCCGCGGAGGCGGCTCGGCGGGG No data
981782851_981782858 2 Left 981782851 4:148445458-148445480 CCCCTCGCTCTGACGGCGGCTCA No data
Right 981782858 4:148445483-148445505 CGCCCGCGGAGGCGGCTCGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981782851 Original CRISPR TGAGCCGCCGTCAGAGCGAG GGG (reversed) Intergenic