ID: 981782852

View in Genome Browser
Species Human (GRCh38)
Location 4:148445459-148445481
Sequence CTGAGCCGCCGTCAGAGCGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981782852_981782859 2 Left 981782852 4:148445459-148445481 CCCTCGCTCTGACGGCGGCTCAG No data
Right 981782859 4:148445484-148445506 GCCCGCGGAGGCGGCTCGGCGGG No data
981782852_981782857 -2 Left 981782852 4:148445459-148445481 CCCTCGCTCTGACGGCGGCTCAG No data
Right 981782857 4:148445480-148445502 AGACGCCCGCGGAGGCGGCTCGG No data
981782852_981782868 30 Left 981782852 4:148445459-148445481 CCCTCGCTCTGACGGCGGCTCAG No data
Right 981782868 4:148445512-148445534 CCGAGGAAGGGGCCGAGAGCCGG No data
981782852_981782855 -10 Left 981782852 4:148445459-148445481 CCCTCGCTCTGACGGCGGCTCAG No data
Right 981782855 4:148445472-148445494 GGCGGCTCAGACGCCCGCGGAGG No data
981782852_981782865 18 Left 981782852 4:148445459-148445481 CCCTCGCTCTGACGGCGGCTCAG No data
Right 981782865 4:148445500-148445522 CGGCGGGGCAAGCCGAGGAAGGG No data
981782852_981782863 13 Left 981782852 4:148445459-148445481 CCCTCGCTCTGACGGCGGCTCAG No data
Right 981782863 4:148445495-148445517 CGGCTCGGCGGGGCAAGCCGAGG No data
981782852_981782866 19 Left 981782852 4:148445459-148445481 CCCTCGCTCTGACGGCGGCTCAG No data
Right 981782866 4:148445501-148445523 GGCGGGGCAAGCCGAGGAAGGGG No data
981782852_981782858 1 Left 981782852 4:148445459-148445481 CCCTCGCTCTGACGGCGGCTCAG No data
Right 981782858 4:148445483-148445505 CGCCCGCGGAGGCGGCTCGGCGG No data
981782852_981782861 3 Left 981782852 4:148445459-148445481 CCCTCGCTCTGACGGCGGCTCAG No data
Right 981782861 4:148445485-148445507 CCCGCGGAGGCGGCTCGGCGGGG No data
981782852_981782856 -7 Left 981782852 4:148445459-148445481 CCCTCGCTCTGACGGCGGCTCAG No data
Right 981782856 4:148445475-148445497 GGCTCAGACGCCCGCGGAGGCGG No data
981782852_981782864 17 Left 981782852 4:148445459-148445481 CCCTCGCTCTGACGGCGGCTCAG No data
Right 981782864 4:148445499-148445521 TCGGCGGGGCAAGCCGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981782852 Original CRISPR CTGAGCCGCCGTCAGAGCGA GGG (reversed) Intergenic